Gut Pathology and Responses to the Microsporidium Nosema ceranae in the Honey Bee Apis mellifera

Abstract

The microsporidium Nosema ceranae is a newly prevalent parasite of the European honey bee (Apis mellifera). Although this parasite is presently spreading across the world into its novel host, the mechanisms by it which affects the bees and how bees respond are not well understood. We therefore performed an extensive characterization of the parasite effects at the molecular level by using genetic and biochemical tools. The transcriptome modifications at the midgut level were characterized seven days post-infection with tiling microarrays. Then we tested the bee midgut response to infection by measuring activity of antioxidant and detoxification enzymes (superoxide dismutases, glutathione peroxidases, glutathione reductase, and glutathione-S-transferase). At the gene-expression level, the bee midgut responded to N. ceranae infection by an increase in oxidative stress concurrent with the generation of antioxidant enzymes, defense and protective response specifically observed in the gut of mammals and insects. However, at the enzymatic level, the protective response was not confirmed, with only glutathione-S-transferase exhibiting a higher activity in infected bees. The oxidative stress was associated with a higher transcription of sugar transporter in the gut. Finally, a dramatic effect of the microsporidia infection was the inhibition of genes involved in the homeostasis and renewal of intestinal tissues (Wnt signaling pathway), a phenomenon that was confirmed at the histological level. This tissue degeneration and prevention of gut epithelium renewal may explain early bee death. In conclusion, our integrated approach not only gives new insights into the pathological effects of N. ceranae and the bee gut response, but also demonstrate that the honey bee gut is an interesting model system for studying host defense responses.

About the Authors:

Claudia Dussaubat

Affiliation: INRA, UR 406 Abeilles et Environnement, Site Agroparc, Avignon, France

Jean-Luc Brunet

Affiliation: INRA, UR 406 Abeilles et Environnement, Site Agroparc, Avignon, France

Mariano Higes

Affiliation: Bee Pathology Laboratory, Centro Apícola Regional, JCCM, Marchamalo, Spain

John K. Colbourne

Affiliation: The Centre for Genomics and Bioinformatics, Indiana University, Bloomington, Indiana, United States of America

Jacqueline Lopez

Affiliation: The Centre for Genomics and Bioinformatics, Indiana University, Bloomington, Indiana, United States of America

Jeong-Hyeon Choi

Affiliation: The Centre for Genomics and Bioinformatics, Indiana University, Bloomington, Indiana, United States of America

Raquel Martín-Hernández

Affiliation: Bee Pathology Laboratory, Centro Apícola Regional, JCCM, Marchamalo, Spain

Cristina Botías

Affiliation: Bee Pathology Laboratory, Centro Apícola Regional, JCCM, Marchamalo, Spain

Marianne Cousin

Affiliation: INRA, UR 406 Abeilles et Environnement, Site Agroparc, Avignon, France

Cynthia McDonnell

Affiliation: INRA, UR 406 Abeilles et Environnement, Site Agroparc, Avignon, France

Marc Bonnet

Affiliation: INRA, UR 406 Abeilles et Environnement, Site Agroparc, Avignon, France

Luc P. Belzunces

Affiliation: INRA, UR 406 Abeilles et Environnement, Site Agroparc, Avignon, France

Robin F. A. Moritz

Affiliation: Institut für Biologie, Martin-Luther-Universität Halle-Wittenberg, Halle (Saale), Germany

Yves Le Conte

Affiliation: INRA, UR 406 Abeilles et Environnement, Site Agroparc, Avignon, France

Cédric Alaux

* E-mail: [email protected]

Affiliation: INRA, UR 406 Abeilles et Environnement, Site Agroparc, Avignon, France

Introduction

The Microsporidia constitute a group of obligate intracellular single-cell spore-forming parasites that can infect a variety of insect taxonomic orders [1], including honey bees. Indeed, honey bees, which are important for the development and maintenance of natural ecosystems and agriculture, are commonly infected by microsporidia from the genus Nosema. Host infection takes place after ingestion of mature spores that germinate in the midgut by polar tube extrusion and injection of the sporoplasm inside the epithelial cell cytoplasm [2]. The European (Apis mellifera) and the Asian (A.cerana) honey bees were originally parasitized by N. apis and N. ceranae, respectively [3], [4], however recent natural infections of N. ceranae in the European honey bee have been found across the world (see [5], [6], [7] for reviews and [8]). In its new host, N. ceranae is considered to cause major health problems characterized by an immune suppression [9], a degeneration of gut epithelial cells [2] and a reduction of bee lifespan [2], [10], [11], [12]. Yet, laboratory assays comparing the virulence of N. apis and N. ceranae gave contradictory results, with one study showing that N. ceranae is more virulent than N. apis [2] and a second one revealing a lack of difference in their virulence [13]. However, those divergent results might be explained by genetic differences in both the host and the parasite isolates [14], [15]. In the field, N. ceranae has been found to be highly virulent and a potential cause of colony collapse in Spain [6], [16] but epidemiological studies performed in the US [17], [18] and in Germany [19], [20] failed to associate this new parasite to colony losses. Those geographic differences might reflect the better adaption of N. ceranae to elevated temperature as compared to N. apis [21], [22].

Finally, if this parasite might not act on its own it can potentially interact with others stress factors since pesticide exposure increase its proliferation [23], [24] and its impact on bee health [25], [26].

Even though, lots of information has been gathered on the prevalence, development and epidemiology of this emergent parasite [5], [6], [7], little is known about how N. ceranae cause host damages and the mechanisms by which bees protect themselves. Yet this information is vital for designing effective diagnoses and therapeutics. Since the genome sequences of A. mellifera [27] is available, it seems promising to use this information to develop novel insights into the gut defense response in insects. Since ingestion is the main entry route of many pathogens, the intestinal epithelium is the first line of defense protecting the host against invasion and dissemination of pathogenic microorganisms. If the classic innate immune system plays a central role in the defense against a broad spectrum of microorganisms [28], one of the most immediate epithelial response in mammals to combat the pathogen involves the generation of antimicrobial reactive oxygen species (ROS) [29], [30]. After the ingestion of microbe-contaminated food, insects can rapidly mount an immune response involving different molecular pathways (NF-κB, Toll and immune deficiency pathways) [31], [32], but the production of ROS is also a key feature of this protective response [30], [33], [34]. A concurrent elimination of residual ROS is also observed to protect the host [35], since the homeostasis of redox (reduction-oxidation) balance mediated by antioxidant enzymes is essential to the host survival.

In order to investigate how honey bee gut cells respond to infection by N. ceranae and how the parasite affects gut epithelium, we performed a transcriptomic analysis of infected and non-infected bees using a recently developed honey bee tiling. As a complementary approach, we tested the activity of the antioxidant system, required for host protection against gut infection in Drosophila [35], by determining the activity of major antioxidant enzymes: the superoxide dismutases (SODs) and glutathione peroxidases (GPs). The indirect antioxidant functions carried out by enzymes such as glutathione reductase (GR), which allows the recovery of reduced glutathione from oxidized glutathione (product of glutathione reactions catalyzed by GP), and glutathione-S-transferases (GST), which catalyze the conjugation of glutathione xenobiotics [36] were also analyzed. Another enzyme that may play a key role in the maintenance of midgut homeostasis and that presents a strong activity in the midgut tissue in insects [37] is the alkaline phosphatase (AP), which, in the gut of mammals, is involved in the dephosphorylation of bacterial lipopolisaccharides (reducing their toxicity), nutrient absorption and the reduction of gut inflammation [38]. Thus, we determined the influence of N. ceranae infection on its activity in honey bees. Finally, to connect molecular changes induced by N. ceranae infection to higher-order modifications, we determined the impact of the parasite on the host midgut epithelium and mortality.

Results and Discussion

The experimental infection was performed in Spain with the local subspecies of honey bee A. m. iberiensis. Before analysing the pathological effects of N. ceranae on A. mellifera bees, we first verified that the parasite significantly reduced the lifespan of the host, as observed by previous studies [2], [10]. The cumulative mortality rate of honey bee workers infected with N. ceranae was significantly higher than that of control bees (log-rank test: p<0.001). All infected bees died within 14 days post infection in each trial (Figure 1), showing a consistent negative effect of the parasite on bees from the different colonies used for assessing the transcriptomic and enzymatic responses to the spore infection.

[Figure omitted. See PDF.]

Figure 1. Mortality induced by N. ceranae.

Data show the percentages of surviving bees per replicate (n = 3) and per day in cages composed of 30 bees each (90 bees total/treatment). Cages with N. ceranae infected bees achieved one-hundred percent of mortality at day 14 post infection, while in control groups mortality remained low.

https://doi.org/10.1371/journal.pone.0037017.g001

Nosema Ceranae Induces Oxidative Stress in the Midgut

We used a tiling microarray based on gene predictions and annotation from the honey bee genome sequencing project [27] to identify at the gut level the pathological impact of N. ceranae on worker bees at seven days post-infection. A total of 9,293 genes were expressed in the gut, which represents approximately 70% of the genes so far identified from the honey bee genome. Out of those genes, the transcription of 336 genes was found to be significantly altered by the proliferation of N. ceranae spores (see Table S1 for the list of genes). Since we analyzed bees from 3 different colonies (i.e. different genetic backgrounds) that were each headed by a multi-drone inseminated queen, those genes might represent the “general” gut pathology and/or response to the parasite.

When challenged by microorganism infections, insects can rapidly mount a potent immune response involving different molecular pathways [31]. For example, ingestion of bacteria activates the Imd pathway in the gut [32]. An activation of the innate immune system was therefore expected after challenging the bees with microsporidia, as it was found in drones [39]. However, no immune gene was more highly transcribed in workers after a seven-day infection. On the contrary, 2 genes (basket (GB16401) and u-shaped (GB16457)) that are involved in Drosophila immune responses [40], [41] were downregulated (Table S1), perhaps indicating an immune suppression by the parasites, as suggested by Antunez et al. [9]. Several studies have shown that one of the most immediate immune response of the gut involves the production of reactive oxygen species (ROS) to fight bacterial infection both in mammals [30], [42] and insects [34], [35], [43]. ROS, which are efficient antimicrobial molecules, are generally derived from oxidation-reduction process. We performed a Gene Ontology analysis to explore which functional components were affected by N. ceranae, and found that genes involved in “oxidation reduction” were significantly overrepresented in the gene set upregulated upon spore infection (Table 1). This increase of oxidation reduction in the gut epithelia of bees parasitized by N. ceranae would therefore indicate an enhanced generation of ROS in response to the infection and suggests that ROS production is a general gut immune response to microorganism infection, including microsporidia.

[Figure omitted. See PDF.]

Table 1. Functional analysis of honey bee genes affected N. ceranae parasitism.

https://doi.org/10.1371/journal.pone.0037017.t001

Since residual ROS can cause inflammatory disease, a balance between synthesis and elimination of ROS via antioxidants is necessary to protect the host gut [29], [34], [35], [43]. Therefore, the antioxidant system may play an essential role during gut infection. Interestingly, the functional analysis also revealed a “response to oxidative stress” in the bee gut (Table 1, see Table S2 for the list of genes associated with each Gene Ontology category), notably with the upregulation of the catalase (GB30227) and glutathione peroxidase-like 2 (Gtpx2 (GB18955)) genes, which have both antioxidant properties. A similar catalase, the immune-regulated catalase has been shown to be a key player of the Drosophila defense system during microbe infection in the gut epithelia [35]. Two cytochromes P450 were induced in the bee gut (CYP6AS4 (GB15793) and CYP6BC1 (GB10466)). CYP6AS4 has been shown to metabolize quercetin contained in honey and pollen [44], but it is not known whether they might contribute to the production or elimination of ROS. We further tested whether the protective response in the bee gut increased in response to N. ceranae infection by measuring the activity of major antioxidant and detoxification enzymes: superoxide dismutase (SOD), glutathione peroxydase (GP), glutathione reductase (GR) and glutathione-S-transferase (GST). The activity of SOD and GR was not significantly different between control and infected bees (Mann-Whitney U tests: p = 0.931 and p = 0.558, respectively; Figure 2). Unexpectedly, the general activity of GP was significantly decreased by the spore infection (p = 0.002). We observed the opposite pattern for Gtpx2 at the transcriptome level (see above). The lower GP activity may either reflect a post-translational modification or the expression level of the other GP found in the bee genome (Gtpx1 (GB14138)) but its expression was not significantly different. The gut might also respond to a potential inhibition of GP activity upon spore infection by increasing the transcription of Gtpx2. Further experiments are needed to explore the GP pattern. Finally, the GST activity was induced by N. ceranae (p = 0.04 Figure 2), as recently found by Vidau et al. [26]. Different GST genes have been found to be significantly induced in the intestinal tissue after an oral bacterial infection, suggesting that GSTs might be involved in the protection of gut epithelium against pathogens [32]. The gut protection after N. ceranae challenge was therefore not really confirmed at the enzymatic level but a previous studies reported an increase of the total antioxidant capacity in infected queens one week post-infection [45].

[Figure omitted. See PDF.]

Figure 2. Activity of antioxidant enzymes in the midguts of bees challenged by N. ceranae.

Differences in enzymatic activity of A) superoxide dismutase (SOD), B) glutathione reductase (GR), C) glutathione peroxydase (GP) and D) glutathione-S-transferase (GST) were estimated by a Mann-Whitney U test. Means±SE are shown for 4 pools of 3 midguts per replicate (n = 3 replicates, 36 bees total/treatment). * and ** denote significant differences at p<0.05 and p<0.01, respectively.

https://doi.org/10.1371/journal.pone.0037017.g002

Nosema Ceranae Impairs Cell Signalling and Tissue Integrity in the Midgut

A significant number of genes involved in cell signaling (e.g. of GO terms: “positive regulation of cell communication”, “enzyme linked receptor protein signaling pathways”, “transmembrane receptor protein tyrosine kinase signaling pathway”) was inhibited by the parasites (Table 1). Cell-cell communication enables cells to perceive and correctly respond to their environment during tissue development and repair or the regulation of tissue homeostasis. Accordingly, the function “tissue homeostasis” was downregulated in parasitized bees, as well as biological processes implicated in “morphogenesis of an epithelium” and “open tracheal system development” (Table 1). The deregulation of “protein amino acid phosphorylation” by the parasite (Table 1) might be involved in the degeneration of the gut tissue. Since protein phosphorylation regulates many aspects of cell life, the modification of the phosphorylation states of intracellular proteins might be a cause or a consequence of the disease state [46]. These results suggest that the proliferation of N. ceranae caused a degeneration of the gut epithelium. Interestingly, the effect of N. ceranae on tissue morphogenesis and integrity at the molecular level was confirmed at the histological level (Figure 3) as in a previous study [2]. The epithelial cells of infected bees showed major signs of degeneration, which are linked to the downregulation of biological process like “positive regulation of cell communication” and “tissue homeostasis and morphogenesis” (Table 1). Gut cells are usually renewed via the multiplication and differentiation of stem cells in the basal cell layer that, once differentiated, move toward the lumen. In insects, this renewal of intestinal stem cells is controlled by the canonical Wnt signaling pathway, which includes the main downstream components frizzled and armadillo [47], [48]. Our results indicated that four main genes (frizzled2 (GB12765), groucho (GB13456), basket (GB16401) and armadillo (GB12463)) from this pathway were inhibited by the parasite, suggesting that N. ceranae development inhibited the self-renewal of intestinal cells of the host.

[Figure omitted. See PDF.]

Figure 3. Histology of honey bee midguts 7 days post-infection.

Light microscopy analysis of control (A, B) and N. ceranae infected midguts (C, D) stained with Hematoxylin-Eosin. In control guts, the peritrophic membrane (pm) and epithelial cells (ec) are homogenous, while in parasitized the guts peritrophic membrane and epithelial cells show signs of degeneration and lyses, respectively. Similar lesions were observed in each infected bees (n = 2 bees per replicate and treatment, giving n = 6 bees per treatment). A) and C) x100, B) and D) x400. Scale bar: 10 µm.

https://doi.org/10.1371/journal.pone.0037017.g003

This finding might be surprising, since the reaction of the gut to microorganisms involved not only the activation of the immune system, but also integrated responses controlling self-renewal and differentiation of stem cells, essential to the gut tissue homeostasis [32]. However, similar results have been found with Encephalitozoon microsporidia that induces a disruption of the cell cycle of the host cells [49] but without killing the host. The dramatic lifespan reduction of bees parasitized by N. ceranae could likely be explained by greater changes in the host cell cycle as compared to changes induced by non-lethal microsporidian species.

We explored whether genes affected by N. ceranae in the honey bee gut were connected through functional networks. The network analysis was performed by testing our gene list in GeneMania, which determines whether genes are connected through physical (protein) or genetic interactions based on a large set of functional association data [50]. We found that 34 out of the 336 genes affected by N. ceranae were connected within a single network, characterized by 63% of physical interaction and 37% of genetic interaction (Figure 4, see Table S3 for the GB name of honey bee genes). All of those genes from this network were downregulated by the parasite, which represents 25% of the total number of downregulated genes. Interestingly, most of the genes were involved in tissue and neuron development and included the 4 main genes of the Wnt signaling pathway (frizzled2, groucho, basket and armadillo), although we cannot exclude other effects of the observed changes in expression of these genes, since a gene can be involved in different biological processes. The microsporidian might therefore induce the degeneration of the epithelial cells of the bee gut through the inhibition of this network. The functional analysis also revealed a negative impact of the parasite on neuron development and differentiation and neuromuscular process (Table 1). In insects, the enteric nervous system (ENS) of the gut is composed of interconnected ganglia and nerve plexuses that contribute to the regulation of feeding and swallowing and gut peristalsis and metabolism [51]. The impairment of the ENS is further confirmed by the inhibition of some genes involved in the circulation of Ca2+ and Na+ (Ca2+-channel-protein-β-subunit (GB17403), Calcium ATPase at 60A (GB17876), Na pump α subunit (GB20055), Na+-driven anion exchanger 1 (GB19698)) that are important for neuromuscular transmission in insects [52], [53]. In particular mutation of the Na pump α subunit causes a pronounced neurodegeneration in the nervous system and reduces life span [52], [54]. Therefore, our results showed that the pathology induced by the microsporidia development is characterized by an impairment of both the epithelium and the ENS of the gut. It is also noteworthy that the corticotrophin-releasing hormone (CRH)-binding protein, which is highly conserved between insects and vertebrates [55] was upregulated in parasitized bees (Table S1). In mammals, the CRH plays an important role in mediating stress responses in the gut (i.e. increase in motility, transit, defecation, diarrhea) [56]. The upregulation of this gene might thus represent a stress response to the N. ceranae infection.

[Figure omitted. See PDF.]

Figure 4. Network of genes downregulated by Nosema in the bee gut.

The composite functional association network derived from different genomic and proteomic data sources was generated with GeneMania using the Drosophila orthologs of bee genes. Physical and genetic interactions between genes are indicated by dot and solid lines, respectively. Grey and white circles represent implemented genes (known genes affected by Nosema) and new genes predicted to be functionally associated to the known genes, respectively. The size of the predicted gene circle provides an indication of its interaction score. Except ETS-domain lacking (edl), the predicted genes roundabout (robo), longitudinal (lola), Cyclin D (CycD), Optix, kekkon-1 (kek1) had bee orthologs: GB17658, GB12094, GB14028, GB16761 and GB17490.

https://doi.org/10.1371/journal.pone.0037017.g004

Finally, to further understand the pathological impact of the parasite, we measured the activity of the alkaline phosphatase (AP). Its biological role in insect gut is not well known. However, in mammals, the activity of the AP plays a pivotal role in gut health [38] since it is involved in the regulation of nutrient absorption [57], the detoxification of bacterial lipopolysaccharide [58], prevents bacterial invasion [59] and effectively reduces intestinal inflammation caused by bacteria [60]. In addition, there are numerous structural and functional homologies between insect and mammal APs [37]. Here, its activity was significantly decreased by N. ceranae (Figure 5, Mann-Whitney U test: p = 0.007), suggesting a reduction of gut protection or health. Similarly, Antunez et al. [9] found that this microsporidian induces an immune suppression in bees, which would affect the host susceptibility to others pathogens.

[Figure omitted. See PDF.]

Figure 5. Activity of alkaline phosphatase (AP) in the midguts of bees challenged by N. ceranae.

Means±SE are shown for 4 pools of 3 midguts per replicate (n = 3 replicates, 36 bees total/treatment). ** denotes significant differences at p<0.01 using a Mann-Whitney U test.

https://doi.org/10.1371/journal.pone.0037017.g005

Nosema Ceranae Increases Sugar Metabolism in the Midgut

The α-glucosidase gene (GB19017), which is involved in sugar metabolism, was upregulated in infected bees (Table S1). This protein hydrolyzes sucrose from the flower nectar to glucose and fructose in the hypopharyngeal glands [61], [62] suggesting an increase in sucrose breakdown in the midgut. Since carbohydrates represent the main source of energy, specialized transporter proteins are needed to transport these molecules across the plasma membrane of cells. This was confirmed by a higher transcription of genes that might be involved in the transport of trehalose (glucose-glucose), the main major carbohydrate energy storage molecule in insects (GB12932: facilitated trehalose transporter Tret1-like, GB13688: trehalose transporter 1 and GB17752: facilitated trehalose transporter Tret1-like, Table 1 and S1). The increase of sugar metabolism is not yet clear, but previous studies clearly showed that N. ceranae infected bees have a higher sugar demand and consumption [11], [25], [63], [64]. This observation might be explained by the fact that microsporidia, including N. ceranae, are usually amitochondriate, and thus have a high dependency on host ATP [65], [66], especially for their germination. This dependence of microsporidia on host energy likely causes the increase in sucrose needs in bees, which would stimulate the expression of sugar transporter and α-glucosidase. However, we cannot exclude that the increase in sugar metabolism is an energy requirement for the bee gut epithelium to enhance the production of ROS in response to infection (see above).

Expression of Nosema Ceranae and Other Microorganisms’ Genes

Since the tiling arrays were spotted with N. ceranae probes based on gene predictions and annotation from the microsporidia genome sequencing project [66] but also with gene sequences of other microorganisms, we could measure in parallel the transcriptome of the parasite and other microorganisms. In order to consider a gene to be significantly expressed we took into account the median value of all the probe fluorescence signals in a gene, but due to the weakness of the fluorescence signal for most of the probes, we did not find any microsporidia genes to be expressed in infected bees. However, the signal intensities of 174 single probes (representing 81 genes) were more highly expressed in infected bees (Table S4). Therefore, only a small fraction of the parasite genome was found to be expressed on the array, possibly representing actively transcribed and/or the most highly expressed N. ceranae genes at this moment of its life cycle. This is rather low in comparison to the 2,614 protein-coding genes found in the parasite genome [66], but it might be possible that RNA from spores could not be isolated due to spore wall protection, which could lead to poor hybridization and weak signal on the arrays. However, during the germination of spores, the rigid wall ruptures, allowing the polar filament to infect the cytoplasm of host cells. Alternatively, the observed signal might come from few spores that were actively germinating, since the spore count level off around 8 days post-infection [13], [67]. By conducting an Expressed Sequenced Tags (EST) survey of the microsporidian Encephalitozoon cuniculi, a parasite of the mosquito Edhazardia aedis, Gill et al. [68] also identify a small number of transcripts (133 unique genes).

We then checked whether the populations of other microorganisms were affected by N. ceranae infection. Only one gene of the bacteria Paenibacillus larvae (Plarl_010100002528, M = 0.48, q = 0.099), three genes of the fungus Ascosphaera apis (2 upregulated: Ascosphaera_26355, M = 0.52, q = 0.097; Ascosphaera_07711, M = 0.56, q = 0.052; 1 downregulated: Ascosphaera_15598, M = -0.52, q = 0.094) and the Lactobacillus sp. 16S rRNA (EF032161: M = 0.66, q = 0.05) were differentially expressed between infected and control bees. Therefore we could not really draw conclusion on changes of the microorganism population. The differential expression of bacterial RNA that is usually non-polyadenylated might be surprising at first sight, since for the microarray analysis the RNA was amplified with a reverse-transcription reaction using an initial dT-priming step. However, studies have long reported the presence or the differential expression of RNA believed to be non-polyadenylated, like rRNA, in cDNA libraries (for a review, see [69]) and cDNA microarray analysis relying on a polyadenylated tail reverse-transcription reaction (see [70], [71]), respectively, which suggest that polyadenylation has a functional role those RNA. This phenomenon could be explained by the fact that in prokaryotes and organelles both mRNAs and non-coding RNAs can be polyadenylated [72]. In those systems, polyadenylation has a functional role and is well-known to promote RNA decay by the degradosome [72], [73]. Further experiments are needed to better characterize the N. ceranae gene expression and the gut microorganism modifications in infected bees. Finally, we did not find any effects on virus infection but recently, a negative correlation between N. ceranae spore loads and deformed wing virus infection was found in the bee midgut [74].

Conclusions

In summary, we captured the molecular events defining the bee gut response to N. ceranae infection, notably characterized at the gene expression level by the generation of oxidative stress. This gut immune response previously identified in Drosophila appears thus to be a more general phenomenon in insects. However, this mechanism does not seem to be sufficient for preventing bee mortality. Tissue degeneration and cell renewal impairment induced by infection would be two of the main factors leading to serious mortality during continuous intestine-Nosema infection. These pathological effects were captured late after the initial infection, while bees were dying, which gave some clues about the factors that caused the death of bees. However, future experiments will also benefit from similar analysis at the beginning of the infection or while the spores are proliferating in order to develop a complete picture of N. ceranae pathology. In sum, the honey bee gut is an interesting model system for studying host-pathogen relationship; and since both N. ceranae and N. apis are cross-infective across hosts in both A. cerana and A. mellifera [75], [76], cross-comparison of molecular events during infection would provide great insights into the evolution of host-microsporidia interactions.

Materials and Methods

Nosema Ceranae Infection and Bee Rearing

In order to determine the transcriptomic and enzymatic changes induced by N. ceranae in the midgut of honey bees, we performed experimental infections. They were performed at the Regional Apicultural Center in Marchamalo, Central Spain, with A. m. iberiensis. Frames of capped brood were obtained from healthy colonies located 20 km away from CAR to provide a supply of newly emerged honey bees free of Nosema for all trials (Nosema-free honey bees confirmed by PCR following method from Martín-Hernández et al. [77]). After emergence bees were kept in an incubator at 33°C (±1°C) (Memmert Mod. IPP500) until they were 7-day old. Then, bees were starved for 2 hours and then anesthetized with CO2 to facilitate individual feeding with 2 µl of 50% sucrose solution containing 100,000 fresh spores of N. ceranae. This dose, currently found in naturally infected bees [78] and ten times higher than the minimal infectious dose required to infect all the bees [13], was chosen to guarantee a successful infection of each bee and reduce the variability in infection between bees. Purified spores of N. ceranae were obtained from experimentally infected honey bees and the spore concentration was calculated using haemocytometer chamber [2]. Controls were fed only with the sucrose solution. After that, bees were introduced in cages and reared in two separated incubators at 33°C (±1°C), one containing N. ceranae infected bees and the other one containing non-infected bees in order to avoid cross contamination. They were fed ad libitum with water, a solution of sucrose (50% w/w in water) and 2% Promotor L (Calier Laboratory), a commercial mixture of amino acids and vitamins.

Three experiments consisting of control and N. ceranae-infected groups were performed to assay the effect of the microsporidia on mortality (30 bees per cage), transcriptomic (20 bees) and enzymatic activity (50 bees). Each experiment was repeated 3 times (one repetition corresponding to one cage) on 3 colonies randomly distributed within the apiary in order to avoid any bias due to colony genetics and to analyze the “general” host/pathogen interactions. In the mortality assay, dead bees were counted daily and the mortality experiment ended when all bees infected with N. ceranae were dead; results were compared using a log-rank test. For the transcriptome and enzymatic activity analysis of the nosemosis type C, bees were flash frozen in liquid nitrogen and store at −80°C seven days post-infection, just before the infection level (spore count) reaches a plateau [13], [67]. At this time N. ceranae infection is largely developed in the midgut, while bees are still alive [2]. A few days later, bees died en masse (Figure 1).

RNA Labeling, Array Hybridization and Statistical Analysis

Gene expression was analyzed in honey bee midguts. Twelve bees per group were treated with RNA later Ice (Ambion) following kit instructions and midguts were dissected on dry ice. Pools of four midguts were homogenized in Trizol (Invitrogen). Whole infected midguts containing Nosema ceranae or control midguts were homogenized with a hand motor-driven grinder (Kondes) and RNA extraction was carried out as indicated in the Qiagen RNeasy kit (Qiagen) for total RNA with on-column DNase I treatment (Qiagen). For each group, RNA isolated from three samples was equally pooled giving a larger pool of 12 midguts that was used for microarray analysis. Three pools of Nosema infected bees were then directly compared to three control pools (one pool of each per colony) using a set of four custom NimbleGen HD2 tiling microarrays containing sequences from the following draft genomes (Table S5): the honey bee A. mellifera version Amel_4.0, NCBI AADG00000000 interrogating 9,295 annotated gene models and 12,581 transcripts [27]; the bacterium Paenibacillus larvae, NCBI AARF00000000 interrogating 4,718 of 5,019 annotated genes [79]; the filamentous fungus Ascosphaera apis, NCBI AARF00000000 [79]; the microsporidian Nosema ceranae, NCBI ACOL00000000 interrogating 2,295 of 2,678 annotated genes [66]; and 10 viruses including Varroa destructor virus 1, NCBI AY251269 [80], Deformed wing virus, NCBI NC_004830 [81], Sacbrood virus, NCBI NC_002066 [82], Kakugo virus, NCBI NC_005876 [83], Chronic bee paralysis virus RNA 1, NCBI NC_010711 [84], Chronic bee paralysis virus RNA 2, NCBI NC_010712 [84], Kashmir bee virus, NCBI NC_004807 [85], Black queen cell virus, NCBI NC_003784 [86], Israel acute paralysis virus of bees, NCBI NC_009025 [87], and Acute bee paralysis virus, NCBI NC_002548 [88] and 16 s ribosomal RNA sequences from different bacteria, including probiotics (see Table S5 for a list). Note that only 1,540 out of 9,244 unmapped A. mellifera sequences are represented on the microarrays, those being the first 1540 sequences of the “GroupUn” set from assembly 4.0. The probes on the microarrays range in size between 50 to 60 bp, and are tiled across the unique sequences of genomes at median distances of 25 bp (mean = 33 bp); only 76,315 probes are tiled at distances >100 bp and 4,285 probes are tiled at distances >1000 bp. The microarray platform is deposited at NCBI GEO under the MIAME-compliant accessions GPL11147, GPL11148, GPL11149, GPL11150.

Total RNA concentration and integrity was determined using the Nanodrop ND-1000 (ThermoScientific) and the Bioanalyzer 2100 with the RNA6000 Nano Kit (Agilent Technologies), respectively. Total RNA was primed with oligo-dT-T7 primer and converted to amplified RNA using MessageAmpII aRNA Amplification Kit (Ambion) according to the manufacturer’s recommendations. Then, amplified RNA was primed with Random hexamer Primer (Promega) and converted to double stranded (ds) cDNA using Double-stranded cDNA Synthesis kit (Invitrogen). After treating samples with RNaseA, ds cDNA was purified with ChargeSwitch PCR Clean-Up Kit (Invitrogen). Next, ds cDNA (1000 ng) was labeled using NimbleGen Dual Color Labeling Kit (Roche NimbleGen) in triplicate following the kit’s instructions to produce enough labeled product for 3×2.1 M microarray chips. Hybridization and post-hybridization washing was performed using Hybridization Kit (Roche NimbleGen) and Wash Buffer Kit (Roche NimbleGen) according to manufacturer’s recommendations.

Arrays were scanned using an Axon GenePix 4200A Professional scanner (Molecular Devices, Sunnyvale, CA), 5 micron resolution and images analyzed with NimbleScan 2.5 Software (Roche NimbleGen) and raw signal intensities extracted as PAIR files. First, replicate arrays were quantile normalized [89] and to each probe the median value of the replicate probe values was assigned. The fluorescence signal of random probes, designed to reflect the genome nucleotide composition by Markov modeling, was used to determine a false positive rate threshold. Probes were considered positive if their fluorescence signal was higher than the 99th percentile of the fluorescence signal of the random probes. The data analysis to measure differential expression of genes was performed using the statistical software package R (R-Project 2009) [90] and Bioconductor [91] with additions and modifications. The signal distributions across chips, samples and replicates were adjusted to be equal according to the mean fluorescence of the random probes on each array. All probes including random probes were quantile-normalized across replicates. Expression-level scores were assigned for each predicted gene based on the median log2 fluorescence over background intensity of probes falling within the exon boundaries. We calculated the per-gene, per-treatment differential expression (DE) levels with LIMMA R package [92] producing M, A expression estimates, t-statistic, probability, and probability adjusted for multiple testing by using the Benjamini-Hochberg method. The data are deposited at NCBI GEO under the MIAME-compliant accession GSE25455.

Functional Analysis

We tested whether molecular functions or biological processes from the list of genes differentially expressed after N. ceranae parasitism were represented by larger numbers of genes than expected by random. Drosophila melanogaster orthologs were identified by reciprocal best BLASTX match to honey bee genes, and Gene Ontology (GO) terms were assigned based on annotation of Drosophila genes. Then, DAVID 6.7 bioinformatic resources was used to identify overrepresented terms (molecular function and biological process) [93].

Network Analysis

Network analysis was performed by analyzing all differentially expressed genes in GeneMania, which uses a large set of functional association data including protein and genetic interactions [50]. The algorithms underlying the bioinformatic tools consists of two parts: 1) a linear regression-based algorithm that calculates a single composite functional association network from multiple data sources and 2) a propagation algorithm for predicting gene function given the composite functional association network. This principle enable to predict new genes functionally associated with known genes (see [50] for details). In GeneMania, Drosophila was selected and the physical (protein-protein interaction data) and genetic (genetic interaction data) network options were enabled. See GeneMania website for detailed instructions. Cytoscape (version 2.7.0) was used to display the networks.

Verification by Reverse-transcriptase PCR

Confirmation of some of the results obtained from tiling array analysis was performed with quantitative PCR (qPCR) on selected genes affected by N. ceranae parasitism. The qPCR analysis was carried out with 6 RNA pools of 4 bees per treatment, which included the RNA stocks used for tiling array analysis. For cDNA synthesis, 500 ng of RNA per sample was reverse-transcribed using the SuperScript III kit (Invitrogen, France). The transcript abundance was measured for the transcription factor Hairy [94]), Slit, which is involved in neuron differentiation [95] and α-glucosidase [96] with an Mx3000P QPCR Systems (Agilent) and the SYBR green detection method (Agilent). qPCR values of the selected genes were normalized to the housekeeping gene eIF3-S8, that did not vary in expression levels on the tiling array (q-value = 0.99). Relative expression was calculated by raising 2 to the power of the difference in Ct values. Primer sequences (5′ to 3′) were: Hairy (GB14857) forward: CCAGCGCGACACTCGAAGCT, reverse: AAACCTGCCAACCTCGCCGG; Slit (GB19929) forward: AGGCATCACGCGGAGAACGC, reverse: CGGCGGGCAACCGAGTATCC; α-glucosidase (GB19017) forward: TTGCTGCCAGGTGTTGCCGT, reverse: TTGGAATGGCGTTCTCGCGGG; eIF3-S8 (GB12747) forward: TGAGTGTCTGCTATGGATTGC, reverse: TCGCGGCTCGTGGTA from [97]. Results were consistent with the microarray results (Figure S1).

Enzyme Activity Analysis

The enzymatic activity of superoxide dismutase, glutathione reductase, glutathione peroxydase, glutathione-S-transferase and alkaline phosphatase was measured at day 7 post infection. Measures were carried out on honey bee midguts that were dissected and stored at -80°C until analysis. All analysis were done with 3 replicates/treatment and using 4 pools of 3 midguts per replicate. The effect of N. ceranae parasitism on enzyme activities was assayed using Mann-Whitney U tests.

Enzyme extraction.

Samples were homogenized at 4°C with a TissuLyser (Qiagen) (5×10 s at 30 Hz) in phosphate buffer pH 7.4 (40 mM sodium phosphate, 10 mM NaCl, 1% (w/v) Triton X-100, containing a mixture of 2 mg/ml of antipain, leupeptin and pepstatin A, 25 units/ml of aprotinin and 0.1 mg/ml of trypsin inhibitor) to make a 10% (w/v) extract. The homogenates were then centrifuged at 15,000 g for 20 min at 4°C and resulting supernatants were used for further analysis of enzymatic activities and protein contents.

Superoxide dismutase.

SOD activity was measured indirectly as the rate of reduction of nitroblue tetrazolium when superoxide anion radical was generated during oxidation of xanthine by xanthine oxidase as described by Boldyrev et al. [98]. The reaction mixture contained 50 mM sodium carbonate dissolved in 50 mM phosphate K/Na buffer (pH 7.8 at 25°C), 0.1 mM EDTA, 0.1 mM xanthine, 0.0833 U/ml xanthine oxidase and 0.025 mM nitroblue tetrazolium. The enzyme activity was assayed at 560 nm for 5 min at 25°C.

Glutathione reductase.

Glutathione reductase activity was measured in a reaction mixture containing 50 mM Phosphate Na/K buffer (pH 7.4 at 25°C), 1 mM EDTA, 0.16 mM NADPH and 0.8 mM oxidized glutathione (substrate) as described by Boldyrev et al. [98]. The enzyme activity was assayed at 340 nm for 5 min at 25°C.

Glutathione peroxidase.

Glutathione peroxidase activity was monitored as described by Boldyrev et al. [98] at 340 nm in a reaction mixture containing 50 mM phosphate K/Na buffer (pH 7.8), 1 mM EDTA, 0.12 mM NADPH, 0.85 mM reduced glutathione as a substrate, 0.5 unit/ml glutathione reductase and 0.2 mM tert-butyl hydroperoxide. The reaction was followed for 10 min at 25°C.

Glutathione-S-transferase.

Glutathione-S-transferase activity was monitored by following the conjugation of reduced glutathione to 1-chloro-2,4-dinitrobenzene using a method adapted from Habig et al. [99]. GST activity was measured by adding enzymatic extract to the reaction mixture containing 1 mM EDTA, 2.5 mM reduced glutathione, 1 mM 1-chloro-2,4-dinitrobenzene and 100 mM Na/K-phosphate pH 7.4. GST activity was followed spectrophotometrically at 340 nm during 5 min at 25°C.

Alkaline phosphatase.

AP activity was monitored at 410 nm in a medium containing 20 µM of MgCl2, 2 mM of p-nitrophenyl phosphate as a substrate and 100 mM Tris-HCl pH 8.5 [100]. The enzyme activity was assayed for 5 min at 25°C.

Histology

We also checked the tissue integrity of 2 bees per replicate and treatment, giving a total of n = 6 bees per treatment. Midguts from infected and non-infected honey bees were fixed in formalin-acetic-alcohol 70° (5/5/90) for 24 hrs at 5–6°C, then rinsed 3×1 hr in water, dehydrated in ethanol and stored in butanol. Tissues were embedded in paraffin (Histowax, Histolab - Products AB) and sectioned at 7 µm thickness with a microtome (Leitz 1512). The following sections were stained with Hematoxylin-Eosin and photographed using a light microscope VWR (TR500 High End Tri).

Supporting Information

[Figure omitted. See PDF.]

Figure S1.

Validation of microarray results with qPCRs. Expression level of 3 genes chosen among the set of genes differentially transcribed between control (black bars) and N. ceranae-infected bees (white bars). Data are normalized to expression levels of eIF3-S8. Means±SE are shown for 6 pools of 4 bees per treatment (24 bees total/treatment). Significant differences were determined using Mann-Whitney U tests (Hairy: p = 0.041, Slit: p = 0.002, α-glucosidase: p = 0.004). * and ** denote significant differences at p<0.05 and p<0.01, respectively.

https://doi.org/10.1371/journal.pone.0037017.s001

(TIFF)

Table S1.

List of honey bee genes differentially expressed after N. ceranae parasitism. The M-value- log2 fold change and the q-value are given for each gene. Corresponding honey bee genes and Drosophila orthologs are shown.

https://doi.org/10.1371/journal.pone.0037017.s002

(XLSX)

Table S2.

List of genes associated with each Gene Ontology category (see Table 1). GB accession number, fly orthologs and M-and q-values are shown.

https://doi.org/10.1371/journal.pone.0037017.s003

(XLSX)

Table S3.

List of genes integrated within the gene network downregulated by N. ceranae parasitism (see Figure 4). GB accession number, fly orthologs and M-and q-values are shown.

https://doi.org/10.1371/journal.pone.0037017.s004

(XLSX)

Table S4.

List of N. ceranae probes significantly expressed. The M-value- log2 fold change and the q-value are given for each probe. Pfam and BLAST data on Encephalitozoon cuniculi genome originated from Cornman et al. [66].

https://doi.org/10.1371/journal.pone.0037017.s005

(XLSX)

Table S5.

Tiling array summary.

https://doi.org/10.1371/journal.pone.0037017.s006

(XLSX)

Acknowledgments

We thank Javier Almagro, Jesús García for their assistance with bee rearing; Almudena Cepero, Virginia Albendea, Carmen Abascal, Carmen Rogerio and Teresa Corrales for assistance in laboratory experiments, and members of the INRA lab for comments that improve the manuscript. We also thank Jay Evans (USDA-ARS Bee Research Lab), Daniel Weaver (Bee Power, LP) and Kimberly Walker (Roche NimbleGen Inc.) for guidance on the tiling microarray design.

Author Contributions

Conceived and designed the experiments: CD YLC CA. Performed the experiments: CD JLB MH JL RMH CB MC MB. Analyzed the data: CD JLB JKC JHC CM CA. Contributed reagents/materials/analysis tools: MH JKC LPB YLC. Wrote the paper: CD JLB RFAM YLC CA.

Citation: Dussaubat C, Brunet J-L, Higes M, Colbourne JK, Lopez J, Choi J-H, et al. (2012) Gut Pathology and Responses to the Microsporidium Nosema ceranae in the Honey Bee Apis mellifera. PLoS ONE7(5): e37017. https://doi.org/10.1371/journal.pone.0037017

References

1. Becnel JJ, Andreadis TG (1999) Microsporidia in insect. In: Wittner M, Weiss LM, editors. The Microsporidia and Microsporidiosis. Washington, DC: ASM Press. pp. 447–501.JJ BecnelTG Andreadis1999Microsporidia in insect.M. WittnerLM WeissThe Microsporidia and MicrosporidiosisWashington, DCASM Press447501

2. Higes M, Garcia-Palencia P, Martin-Hernandez R, Meana A (2007) Experimental infection of Apis mellifera honeybees with Nosema ceranae (Microsporidia). J Invertebr Pathol 94: 211–217.M. HigesP. Garcia-PalenciaR. Martin-HernandezA. Meana2007Experimental infection of Apis mellifera honeybees with Nosema ceranae (Microsporidia).J Invertebr Pathol94211217

3. Zander E (1909) Tierische Parasiten als Krankenheitserreger bei der Biene. Münchener Bienenzeitung 31: 196–204.E. Zander1909Tierische Parasiten als Krankenheitserreger bei der Biene.Münchener Bienenzeitung31196204

4. Fries I, Feng F, Da Silva A, Slemeda SB, Pieniazek NJ (1996) Nosema ceranae n. sp. (Microspora, Nosematidae), morphological and molecular characterization of a microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera, Apidae). Eur J Protistol 32: 356–365.I. FriesF. FengA. Da SilvaSB SlemedaNJ Pieniazek1996Nosema ceranae n. sp. (Microspora, Nosematidae), morphological and molecular characterization of a microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera, Apidae).Eur J Protistol32356365

5. Fries I (2010) Nosema ceranae in European honey bees (Apis mellifera). J Invertebr Pathol 103: S73–S79.I. Fries2010Nosema ceranae in European honey bees (Apis mellifera).J Invertebr Pathol103S73S79

6. Higes M, Martin-Hernandez R, Meana A (2010) Nosema ceranae in Europe: an emergent type C nosemosis. Apidologie 41: 375–392.M. HigesR. Martin-HernandezA. Meana2010Nosema ceranae in Europe: an emergent type C nosemosis.Apidologie41375392

7. Paxton RJ (2010) Does infection by Nosema ceranae cause “Colony Collapse Disorder” in honey bees (Apis mellifera)? J Apicult Res 49: 80–84.RJ Paxton2010Does infection by Nosema ceranae cause “Colony Collapse Disorder” in honey bees (Apis mellifera)?J Apicult Res498084

8. Klee J, Besana AM, Genersch E, Gisder S, Nanetti A, et al. (2007) Widespread dispersal of the microsporidian Nosema ceranae, an emergent pathogen of the western honey bee, Apis mellifera. J Invertebr Pathol 96: 1–10.J. KleeAM BesanaE. GenerschS. GisderA. Nanetti2007Widespread dispersal of the microsporidian Nosema ceranae, an emergent pathogen of the western honey bee, Apis mellifera.J Invertebr Pathol96110

9. Antúnez K, Martín-Hernández R, Prieto L, Meana A, Zunino P, et al. (2009) Immune suppression in the honey bee (Apis mellifera) following infection by Nosema ceranae (Microsporidia). Environ Microbiol 11: 2284–2290.K. AntúnezR. Martín-HernándezL. PrietoA. MeanaP. Zunino2009Immune suppression in the honey bee (Apis mellifera) following infection by Nosema ceranae (Microsporidia).Environ Microbiol1122842290

10. Paxton RJ, Klee J, Korpela S, Fries I (2007) Nosema ceranae has infected Apis mellifera in Europe since at least 1998 and may be more virulent than Nosema apis. Apidologie 38: 558–565.RJ PaxtonJ. KleeS. KorpelaI. Fries2007Nosema ceranae has infected Apis mellifera in Europe since at least 1998 and may be more virulent than Nosema apis.Apidologie38558565

11. Mayack C, Naug D (2009) Energetic stress in the honeybee Apis mellifera from Nosema ceranae infection. J Invertebr Pathol 100: 185–188.C. MayackD. Naug2009Energetic stress in the honeybee Apis mellifera from Nosema ceranae infection.J Invertebr Pathol100185188

12. Martin-Hernandez R, Botias C, Barrios L, Martinez-Salvador A, Meana A, et al. (2011) Comparison of the energetic stress associated with experimental Nosema ceranae and Nosema apis infection of honeybees (Apis mellifera). Parasitol Res 109: 605–612.R. Martin-HernandezC. BotiasL. BarriosA. Martinez-SalvadorA. Meana2011Comparison of the energetic stress associated with experimental Nosema ceranae and Nosema apis infection of honeybees (Apis mellifera).Parasitol Res109605612

13. Forsgren E, Fries I (2010) Comparative virulence of Nosema ceranae and Nosema apis in individual European honey bees. Vet Parasitol 170: 212–217.E. ForsgrenI. Fries2010Comparative virulence of Nosema ceranae and Nosema apis in individual European honey bees.Vet Parasitol170212217

14. Williams GR, Shafer AB, Rogers RE, Shutler D, Stewart DT (2008) First detection of Nosema ceranae, a microsporidian parasite of European honey bees (Apis mellifera), in Canada and central USA. J Invertebr Pathol 97: 189–192.GR WilliamsAB ShaferRE RogersD. ShutlerDT Stewart2008First detection of Nosema ceranae, a microsporidian parasite of European honey bees (Apis mellifera), in Canada and central USA.J Invertebr Pathol97189192

15. Huang WF, Bocquet M, Lee KC, Sung IH, Jiang JH, et al. (2008) The comparison of rDNA spacer regions of Nosema ceranae isolates from different hosts and locations. J Invertebr Pathol 97: 9–13.WF HuangM. BocquetKC LeeIH SungJH Jiang2008The comparison of rDNA spacer regions of Nosema ceranae isolates from different hosts and locations.J Invertebr Pathol97913

16. Higes M, Martin-Hernandez R, Botias C, Bailon EG, Gonzalez-Porto AV, et al. (2008) How natural infection by Nosema ceranae causes honeybee colony collapse. Environ Microbiol 10: 2659–2669.M. HigesR. Martin-HernandezC. BotiasEG BailonAV Gonzalez-Porto2008How natural infection by Nosema ceranae causes honeybee colony collapse.Environ Microbiol1026592669

17. Cox-Foster DL, Conlan S, Holmes EC, Palacios G, Evans JD, et al. (2007) A metagenomic survey of microbes in honey bee colony collapse disorder. Science 318: 283–287.DL Cox-FosterS. ConlanEC HolmesG. PalaciosJD Evans2007A metagenomic survey of microbes in honey bee colony collapse disorder.Science318283287

18. van Engelsdorp D, Evans JD, Saegerman C, Mullin C, Haubruge E, et al. (2009) Colony Collapse Disorder: A Descriptive Study. PLoS One 4: e6481.D. van EngelsdorpJD EvansC. SaegermanC. MullinE. Haubruge2009Colony Collapse Disorder: A Descriptive Study.PLoS One4e6481

19. Genersch E, von der Ohe W, Kaatz H, Schroeder A, Otten C, et al. (2010) The German bee monitoring project: a long term study to understand periodically high winter losses of honey bee colonies. Apidologie 41: 332–352.E. GenerschW. von der OheH. KaatzA. SchroederC. Otten2010The German bee monitoring project: a long term study to understand periodically high winter losses of honey bee colonies.Apidologie41332352

20. Gisder S, Hedtke K, Mockel N, Frielitz MC, Linde A, et al. (2010) Five-year cohort study of Nosema spp. in Germany: does climate shape virulence and assertiveness of Nosema ceranae? Appl Environ Microbiol 76: 3032–3038.S. GisderK. HedtkeN. MockelMC FrielitzA. Linde2010Five-year cohort study of Nosema spp. in Germany: does climate shape virulence and assertiveness of Nosema ceranae?Appl Environ Microbiol7630323038

21. Fenoy S, Rueda C, Higes M, Martin-Hernandez R, del Aguila C (2009) High-level resistance of Nosema ceranae, a parasite of the honeybee, to temperature and desiccation. Appl Environ Microbiol 75: 6886–6889.S. FenoyC. RuedaM. HigesR. Martin-HernandezC. del Aguila2009High-level resistance of Nosema ceranae, a parasite of the honeybee, to temperature and desiccation.Appl Environ Microbiol7568866889

22. Martin-Hernandez R, Meana A, Garcia-Palencia P, Marin P, Botias C, et al. (2009) Effect of temperature on the biotic potential of honeybee microsporidia. Appl Environ Microbiol 75: 2554–2557.R. Martin-HernandezA. MeanaP. Garcia-PalenciaP. MarinC. Botias2009Effect of temperature on the biotic potential of honeybee microsporidia.Appl Environ Microbiol7525542557

23. Pettis JS, Vanengelsdorp D, Johnson J, Dively G (2012) Pesticide exposure in honey bees results in increased levels of the gut pathogen Nosema. Naturwissenschaften 99: 153–158.JS PettisD. VanengelsdorpJ. JohnsonG. Dively2012Pesticide exposure in honey bees results in increased levels of the gut pathogen Nosema.Naturwissenschaften99153158

24. Wu JY, Smart MD, Anelli CM, Sheppard WS (2012) Honey bees (Apis mellifera) reared in brood combs containing high levels of pesticide residues exhibit increased susceptibility to Nosema (Microsporidia) infection. J Invertebr Pathol 109: 326–329.JY WuMD SmartCM AnelliWS Sheppard2012Honey bees (Apis mellifera) reared in brood combs containing high levels of pesticide residues exhibit increased susceptibility to Nosema (Microsporidia) infection.J Invertebr Pathol109326329

25. Alaux C, Brunet JL, Dussaubat C, Mondet F, Tchamitchan S, et al. (2010) Interactions between Nosema microspores and a neonicotinoid weaken honeybees (Apis mellifera). Environ Microbiol 12: 774–782.C. AlauxJL BrunetC. DussaubatF. MondetS. Tchamitchan2010Interactions between Nosema microspores and a neonicotinoid weaken honeybees (Apis mellifera).Environ Microbiol12774782

26. Vidau C, Diogon M, Aufauvre J, Fontbonne R, Viguès B, et al. (2011) Exposure to Sublethal Doses of Fipronil and Thiacloprid Highly Increases Mortality of Honeybees Previously Infected by Nosema ceranae. PLoS One 6: e21550.C. VidauM. DiogonJ. AufauvreR. FontbonneB. Viguès2011Exposure to Sublethal Doses of Fipronil and Thiacloprid Highly Increases Mortality of Honeybees Previously Infected by Nosema ceranae.PLoS One6e21550

27. Honey Bee Genome Sequencing Consortium (2006) Insights into social insects from the genome of the honeybee Apis mellifera. Nature 443: 931–949.Consortium Honey Bee Genome Sequencing2006Insights into social insects from the genome of the honeybee Apis mellifera.Nature443931949

28. Medzhitov R, Janeway CA (1997) Innate immunity: the virtues of a nonclonal system of recognition. Cell 91: 295–298.R. MedzhitovJaneway CA Jr1997Innate immunity: the virtues of a nonclonal system of recognition.Cell91295298

29. Cohn LA, Kinnula VL, Adler KB (1994) Antioxidant properties of guinea pig tracheal epithelial cells in vitro. Am J Physiol 266: L397–404.LA CohnVL KinnulaKB Adler1994Antioxidant properties of guinea pig tracheal epithelial cells in vitro.Am J Physiol266L397404

30. Geiszt M, Witta J, Baffi J, Lekstrom K, Leto TL (2003) Dual oxidases represent novel hydrogen peroxide sources supporting mucosal surface host defense. Faseb J 17: 1502–1504.M. GeisztJ. WittaJ. BaffiK. LekstromTL Leto2003Dual oxidases represent novel hydrogen peroxide sources supporting mucosal surface host defense.Faseb J1715021504

31. Hoffmann JA (2003) The immune response of Drosophila. Nature 426: 33–38.JA Hoffmann2003The immune response of Drosophila.Nature4263338

32. Buchon N, Broderick NA, Poidevin M, Pradervand S, Lemaitre B (2009) Drosophila intestinal response to bacterial infection: activation of host defense and stem cell proliferation. Cell Host Microbe 5: 200–211.N. BuchonNA BroderickM. PoidevinS. PradervandB. Lemaitre2009Drosophila intestinal response to bacterial infection: activation of host defense and stem cell proliferation.Cell Host Microbe5200211

33. Ha EM, Lee KA, Seo YY, Kim SH, Lim JH, et al. (2009) Coordination of multiple dual oxidase-regulatory pathways in responses to commensal and infectious microbes in drosophila gut. Nat Immunol 10: 949–957.EM HaKA LeeYY SeoSH KimJH Lim2009Coordination of multiple dual oxidase-regulatory pathways in responses to commensal and infectious microbes in drosophila gut.Nat Immunol10949957

34. Ha EM, Oh CT, Bae YS, Lee WJ (2005) A direct role for dual oxidase in Drosophila gut immunity. Science 310: 847–850.EM HaCT OhYS BaeWJ Lee2005A direct role for dual oxidase in Drosophila gut immunity.Science310847850

35. Ha EM, Oh CT, Ryu JH, Bae YS, Kang SW, et al. (2005) An antioxidant system required for host protection against gut infection in Drosophila. Dev Cell 8: 125–132.EM HaCT OhJH RyuYS BaeSW Kang2005An antioxidant system required for host protection against gut infection in Drosophila.Dev Cell8125132

36. Sies H (1997) Oxidative stress: Oxidants and antioxidants. Exp Physiol 82: 291–295.H. Sies1997Oxidative stress: Oxidants and antioxidants.Exp Physiol82291295

37. Eguchi M (1995) Alkaline phosphatase isozymes in insects and comparison with mammalian enzyme. Comp Biochem Physiol B Biochem Mol Biol 111: 151–162.M. Eguchi1995Alkaline phosphatase isozymes in insects and comparison with mammalian enzyme.Comp Biochem Physiol B Biochem Mol Biol111151162

38. Lalles JP (2010) Intestinal alkaline phosphatase: multiple biological roles in maintenance of intestinal homeostasis and modulation by diet. Nutr Rev 68: 323–332.JP Lalles2010Intestinal alkaline phosphatase: multiple biological roles in maintenance of intestinal homeostasis and modulation by diet.Nutr Rev68323332

39. Valanne S, Myllymaki H, Kallio J, Schmid MR, Kleino A, et al. (2010) Genome-wide RNA interference in Drosophila cells identifies G protein-coupled receptor kinase 2 as a conserved regulator of NF-kappaB signaling. J Immunol 184: 6188–6198.S. ValanneH. MyllymakiJ. KallioMR SchmidA. Kleino2010Genome-wide RNA interference in Drosophila cells identifies G protein-coupled receptor kinase 2 as a conserved regulator of NF-kappaB signaling.J Immunol18461886198

40. Huang Q, Kryger P, Le Conte Y, Mortiz RF (2012) Survival and immune response of drones of a Nosemosis tolerant honey bee strain towards N. ceranae infections. J Invertebr Pathol 109: 297–302.Q. HuangP. KrygerY. Le ConteRF Mortiz2012Survival and immune response of drones of a Nosemosis tolerant honey bee strain towards N. ceranae infections.J Invertebr Pathol109297302

41. Evans JD, Aronstein K, Chen YP, Hetru C, Imler JL, et al. (2006) Immune pathways and defence mechanisms in honey bees Apis mellifera. Insect Mol Biol 15: 645–656.JD EvansK. AronsteinYP ChenC. HetruJL Imler2006Immune pathways and defence mechanisms in honey bees Apis mellifera.Insect Mol Biol15645656

42. Kinnula VL, Adler KB, Ackley NJ, Crapo JD (1992) Release of reactive oxygen species by guinea pig tracheal epithelial cells in vitro. Am J Physiol 262: L708–712.VL KinnulaKB AdlerNJ AckleyJD Crapo1992Release of reactive oxygen species by guinea pig tracheal epithelial cells in vitro.Am J Physiol262L708712

43. Ryu JH, Ha EM, Lee WJ (2010) Innate immunity and gut-microbe mutualism in Drosophila. Dev Comp Immunol 34: 369–376.JH RyuEM HaWJ Lee2010Innate immunity and gut-microbe mutualism in Drosophila.Dev Comp Immunol34369376

44. Mao W, Rupasinghe SG, Johnson RM, Zangerl AR, Schuler MA, et al. (2009) Quercetin-metabolizing CYP6AS enzymes of the pollinator Apis mellifera (Hymenoptera: Apidae). Comp Biochem Physiol B Biochem Mol Biol 154: 427–434.W. MaoSG RupasingheRM JohnsonAR ZangerlMA Schuler2009Quercetin-metabolizing CYP6AS enzymes of the pollinator Apis mellifera (Hymenoptera: Apidae).Comp Biochem Physiol B Biochem Mol Biol154427434

45. Alaux C, Folschweiller M, McDonnell C, Beslay D, Cousin M, et al. (2011) Pathological effects of the microsporidium Nosema ceranae on honey bee queen physiology (Apis mellifera). J Invertebr Pathol 106: 380–385.C. AlauxM. FolschweillerC. McDonnellD. BeslayM. Cousin2011Pathological effects of the microsporidium Nosema ceranae on honey bee queen physiology (Apis mellifera).J Invertebr Pathol106380385

46. Cohen P (2001) The role of protein phosphorylation in human health and disease. The Sir Hans Krebs Medal Lecture. Eur J Biochem 268: 5001–5010.P. Cohen2001The role of protein phosphorylation in human health and disease. The Sir Hans Krebs Medal Lecture.Eur J Biochem26850015010

47. Lin G, Xu N, Xi R (2008) Paracrine Wingless signalling controls self-renewal of Drosophila intestinal stem cells. Nature 455: 1119–1123.G. LinN. XuR. Xi2008Paracrine Wingless signalling controls self-renewal of Drosophila intestinal stem cells.Nature45511191123

48. Wang P, Hou SX (2010) Regulation of intestinal stem cells in mammals and Drosophila. J Cell Physiol 222: 33–37.P. WangSX Hou2010Regulation of intestinal stem cells in mammals and Drosophila.J Cell Physiol2223337

49. Scanlon M, Shaw AP, Zhou CJ, Visvesvara GS, Leitch GJ (2000) Infection by microsporidia disrupts the host cell cycle. J Eukaryot Microbiol 47: 525–531.M. ScanlonAP ShawCJ ZhouGS VisvesvaraGJ Leitch2000Infection by microsporidia disrupts the host cell cycle.J Eukaryot Microbiol47525531

50. Warde-Farley D, Donaldson SL, Comes O, Zuberi K, Badrawi R, et al. (2010) The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function. Nucleic Acids Res 38: W214–220.D. Warde-FarleySL DonaldsonO. ComesK. ZuberiR. Badrawi2010The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function.Nucleic Acids Res38W214220

51. Copenhaver PF (2007) How to innervate a simple gut: Familiar themes and unique aspects in the formation of the insect enteric nervous system. Dev Dynam 236: 1841–1864.PF Copenhaver2007How to innervate a simple gut: Familiar themes and unique aspects in the formation of the insect enteric nervous system.Dev Dynam23618411864

52. Palladino MJ, Bower JE, Kreber R, Ganetzky B (2003) Neural dysfunction and neurodegeneration in Drosophila Na+/K+ ATPase alpha subunit mutants. J Neurosci 23: 1276–1286.MJ PalladinoJE BowerR. KreberB. Ganetzky2003Neural dysfunction and neurodegeneration in Drosophila Na+/K+ ATPase alpha subunit mutants.J Neurosci2312761286

53. Atwood HL, Karunanithi S, Georgiou J, Charlton MP (1997) Strength of synaptic transmission at neuromuscular junctions of crustaceans and insects in relation to calcium entry. Invert Neurosci 3: 81–87.HL AtwoodS. KarunanithiJ. GeorgiouMP Charlton1997Strength of synaptic transmission at neuromuscular junctions of crustaceans and insects in relation to calcium entry.Invert Neurosci38187

54. Fergestad T, Ganetzky B, Palladino MJ (2006) Neuropathology in Drosophila membrane excitability mutants. Genetics 172: 1031–1042.T. FergestadB. GanetzkyMJ Palladino2006Neuropathology in Drosophila membrane excitability mutants.Genetics17210311042

55. Huising MO, Flik G (2005) The remarkable conservation of corticotropin-releasing hormone (CRH)-binding protein in the honeybee (Apis mellifera) dates the CRH system to a common ancestor of insects and vertebrates. Endocrinology 146: 2165–2170.MO HuisingG. Flik2005The remarkable conservation of corticotropin-releasing hormone (CRH)-binding protein in the honeybee (Apis mellifera) dates the CRH system to a common ancestor of insects and vertebrates.Endocrinology14621652170

56. Stengel A, Tache Y (2009) Neuroendocrine control of the gut during stress: corticotropin-releasing factor signaling pathways in the spotlight. Annu Rev Physiol 71: 219–239.A. StengelY. Tache2009Neuroendocrine control of the gut during stress: corticotropin-releasing factor signaling pathways in the spotlight.Annu Rev Physiol71219239

57. Narisawa S, Huang L, Iwasaki A, Hasegawa H, Alpers DH, et al. (2003) Accelerated fat absorption in intestinal alkaline phosphatase knockout mice. Mol Cell Biol 23: 7525–7530.S. NarisawaL. HuangA. IwasakiH. HasegawaDH Alpers2003Accelerated fat absorption in intestinal alkaline phosphatase knockout mice.Mol Cell Biol2375257530

58. Koyama I, Matsunaga T, Harada T, Hokari S, Komoda T (2002) Alkaline phosphatases reduce toxicity of lipopolysaccharides in vivo and in vitro through dephosphorylation. Clin Biochem 35: 455–461.I. KoyamaT. MatsunagaT. HaradaS. HokariT. Komoda2002Alkaline phosphatases reduce toxicity of lipopolysaccharides in vivo and in vitro through dephosphorylation.Clin Biochem35455461

59. Goldberg RF, Austin WG , Zhang XHF, Munene G, Mostafa G, et al. (2008) Intestinal alkaline phosphatase is a gut mucosal defense factor maintained by enteral nutrition. Proc Natl Acad Sci U S A 105: 3551–3556.RF GoldbergAustin WG JrXHF ZhangG. MuneneG. Mostafa2008Intestinal alkaline phosphatase is a gut mucosal defense factor maintained by enteral nutrition.Proc Natl Acad Sci U S A10535513556

60. Sanchez de Medina F, Martinez-Augustin O, Gonzalez R, Ballester I, Nieto A, et al. (2004) Induction of alkaline phosphatase in the inflamed intestine: a novel pharmacological target for inflammatory bowel disease. Biochem Pharmacol 68: 2317–2326.F. Sanchez de MedinaO. Martinez-AugustinR. GonzalezI. BallesterA. Nieto2004Induction of alkaline phosphatase in the inflamed intestine: a novel pharmacological target for inflammatory bowel disease.Biochem Pharmacol6823172326

61. Ohashi K, Sawata M, Takeuchi H, Natori S, Kubo T (1996) Molecular cloning of cDNA and analysis of expression of the gene for alpha-glucosidase from the hypopharyngeal gland of the honeybee Apis mellifera L. Biochem Biophys Res Commun 221: 380–385.K. OhashiM. SawataH. TakeuchiS. NatoriT. Kubo1996Molecular cloning of cDNA and analysis of expression of the gene for alpha-glucosidase from the hypopharyngeal gland of the honeybee Apis mellifera L. Biochem Biophys Res Commun221380385

62. Kunieda T, Fujiyuki T, Kucharski R, Foret S, Ament SA, et al. (2006) Carbohydrate metabolism genes and pathways in insects: insights from the honey bee genome. Insect Mol Biol 15: 563–576.T. KuniedaT. FujiyukiR. KucharskiS. ForetSA Ament2006Carbohydrate metabolism genes and pathways in insects: insights from the honey bee genome.Insect Mol Biol15563576

63. Naug D, Gibbs A (2009) Behavioral changes mediated by hunger in honeybees infected with Nosema ceranae. Apidologie 40: 595–599.D. NaugA. Gibbs2009Behavioral changes mediated by hunger in honeybees infected with Nosema ceranae.Apidologie40595599

64. Martin-Hernandez R, Botias C, Barrios L, Martinez-Salvador A, Meana A, et al. (2011) Comparison of the energetic stress associated with experimental Nosema ceranae and Nosema apis infection of honeybees (Apis mellifera). Parasitol Res 109: 605–12.R. Martin-HernandezC. BotiasL. BarriosA. Martinez-SalvadorA. Meana2011Comparison of the energetic stress associated with experimental Nosema ceranae and Nosema apis infection of honeybees (Apis mellifera).Parasitol Res10960512

65. Keeling PJ, Fast NM (2002) Microsporidia: biology and evolution of highly reduced intracellular parasites. Annu Rev Microbiol 56: 93–116.PJ KeelingNM Fast2002Microsporidia: biology and evolution of highly reduced intracellular parasites.Annu Rev Microbiol5693116

66. Cornman RS, Chen YP, Schatz MC, Street C, Zhao Y, et al. (2009) Genomic analyses of the microsporidian Nosema ceranae, an emergent pathogen of honey bees. PLoS Pathog 5: e1000466.RS CornmanYP ChenMC SchatzC. StreetY. Zhao2009Genomic analyses of the microsporidian Nosema ceranae, an emergent pathogen of honey bees.PLoS Pathog5e1000466

67. Fries I (1988) Infectivity and multiplication of Nosema apis Z. in the ventriculus of the honey bee. Apidologie 19: 319–328.I. Fries1988Infectivity and multiplication of Nosema apis Z. in the ventriculus of the honey bee.Apidologie19319328

68. Gill EE, Becnel JJ, Fast NM (2008) ESTs from the microsporidian Edhazardia aedis. BMC Genomics 9: 296.EE GillJJ BecnelNM Fast2008ESTs from the microsporidian Edhazardia aedis.BMC Genomics9296

69. Gonzalez IL, Sylvester JE (1997) Incognito rRNA and rDNA in databases and libraries. Genome Res 7: 65–70.IL GonzalezJE Sylvester1997Incognito rRNA and rDNA in databases and libraries.Genome Res76570

70. Scharf ME, Wu-Scharf D, Zhou X, Pittendrigh BR, Bennett GW (2005) Gene expression profiles among immature and adult reproductive castes of the termite Reticulitermes flavipes. Insect Mol Biol 14: 31–44.ME ScharfD. Wu-ScharfX. ZhouBR PittendrighGW Bennett2005Gene expression profiles among immature and adult reproductive castes of the termite Reticulitermes flavipes.Insect Mol Biol143144

71. Johnson RM, Evans JD, Robinson GE, Berenbaum MR (2009) Changes in transcript abundance relating to colony collapse disorder in honey bees (Apis mellifera). Proc Natl Acad Sci U S A 106: 14790–14795.RM JohnsonJD EvansGE RobinsonMR Berenbaum2009Changes in transcript abundance relating to colony collapse disorder in honey bees (Apis mellifera).Proc Natl Acad Sci U S A1061479014795

72. Slomovic S, Portnoy V, Liveanu V, Schuster G (2006) RNA polyadenylation in prokaryotes and organelles; Different tails tell different tales. Crit Rev Plant Sci 25: 65–77.S. SlomovicV. PortnoyV. LiveanuG. Schuster2006RNA polyadenylation in prokaryotes and organelles; Different tails tell different tales.Crit Rev Plant Sci256577

73. Slomovic S, Laufer D, Geiger D, Schuster G (2006) Polyadenylation of ribosomal RNA in human cells. Nucleic Acids Res 34: 2966–2975.S. SlomovicD. LauferD. GeigerG. Schuster2006Polyadenylation of ribosomal RNA in human cells.Nucleic Acids Res3429662975

74. Costa C, Tanner G, Lodesani M, Maistrello L, Neumann P (2011) Negative correlation between Nosema ceranae spore loads and deformed wing virus infection levels in adult honey bee workers. J Inverterbr Pathol 108: 224–225.C. CostaG. TannerM. LodesaniL. MaistrelloP. Neumann2011Negative correlation between Nosema ceranae spore loads and deformed wing virus infection levels in adult honey bee workers.J Inverterbr Pathol108224225

75. Fries I (1997) Protozoa. In: Morse RA, Flottum K, editors. Honey Bee Pests, Predators and Diseases, third ed. Medina, OH: A.I. Root Company. pp. 59–76.I. Fries1997Protozoa.RA MorseK. FlottumHoney Bee Pests, Predators and Diseases, third edMedina, OHA.I. Root Company5976

76. Fries I, Feng F (1995) Cross infectivity of Nosema apis in Apis mellifera and Apis cerana. Proceedings of the Apimondia 34th International Apicultural Congress. Bucharest, Romania. pp. 151–155.I. FriesF. Feng1995Cross infectivity of Nosema apis in Apis mellifera and Apis cerana.Proceedings of the Apimondia 34th International Apicultural CongressBucharest, Romania151155

77. Martin-Hernandez R, Meana A, Prieto L, Salvador AM, Garrido-Bailon E, et al. (2007) Outcome of colonization of Apis mellifera by Nosema ceranae. Appl Environ Microbiol 73: 6331–6338.R. Martin-HernandezA. MeanaL. PrietoAM SalvadorE. Garrido-Bailon2007Outcome of colonization of Apis mellifera by Nosema ceranae.Appl Environ Microbiol7363316338

78. Meana A, Martín-Hernández R, Higes M (2010) The reliability of spore counts to diagnose Nosema ceranae infections in honey bees. J Apicult Res 49: 212–214.A. MeanaR. Martín-HernándezM. Higes2010The reliability of spore counts to diagnose Nosema ceranae infections in honey bees.J Apicult Res49212214

79. Qin X, Evans JD, Aronstein KA, Murray KD, Weinstock GM (2006) Genome sequences of the honey bee pathogens Paenibacillus larvae and Ascosphaera apis. Insect Mol Biol 15: 715–718.X. QinJD EvansKA AronsteinKD MurrayGM Weinstock2006Genome sequences of the honey bee pathogens Paenibacillus larvae and Ascosphaera apis.Insect Mol Biol15715718

80. Ongus JR, Peters D, Bonmatin JM, Bengsch E, Vlak JM, et al. (2004) Complete sequence of a picorna-like virus of the genus Iflavirus replicating in the mite Varroa destructor. J Gen Virol 85: 3747–3755.JR OngusD. PetersJM BonmatinE. BengschJM Vlak2004Complete sequence of a picorna-like virus of the genus Iflavirus replicating in the mite Varroa destructor.J Gen Virol8537473755

81. Lanzi G, de Miranda JR, Boniotti MB, Cameron CE, Lavazza A, et al. (2006) Molecular and biological characterization of deformed wing virus of honeybees (Apis mellifera L.). J Virol 80: 4998–5009.G. LanziJR de MirandaMB BoniottiCE CameronA. Lavazza2006Molecular and biological characterization of deformed wing virus of honeybees (Apis mellifera L.).J Virol8049985009

82. Ghosh RC, Ball BV, Willcocks MM, Carter MJ (1999) The nucleotide sequence of sacbrood virus of the honey bee: an insect picorna-like virus. J Gen Virol 80: 1541–1549.RC GhoshBV BallMM WillcocksMJ Carter1999The nucleotide sequence of sacbrood virus of the honey bee: an insect picorna-like virus.J Gen Virol8015411549

83. Fujiyuki T, Ohka S, Takeuchi H, Ono M, Nomoto A, et al. (2006) Prevalence and phylogeny of Kakugo virus, a novel insect picorna-like virus that infects the honeybee (Apis mellifera L.), under various colony conditions. J Virol 80: 11528–11538.T. FujiyukiS. OhkaH. TakeuchiM. OnoA. Nomoto2006Prevalence and phylogeny of Kakugo virus, a novel insect picorna-like virus that infects the honeybee (Apis mellifera L.), under various colony conditions.J Virol801152811538

84. Olivier V, Blanchard P, Chaouch S, Lallemand P, Schurr F, et al. (2008) Molecular characterisation and phylogenetic analysis of Chronic bee paralysis virus, a honey bee virus. Virus Res 132: 59–68.V. OlivierP. BlanchardS. ChaouchP. LallemandF. Schurr2008Molecular characterisation and phylogenetic analysis of Chronic bee paralysis virus, a honey bee virus.Virus Res1325968

85. de Miranda JR, Drebot M, Tyler S, Shen M, Cameron CE, et al. (2004) Complete nucleotide sequence of Kashmir bee virus and comparison with acute bee paralysis virus. J Gen Virol 85: 2263–2270.JR de MirandaM. DrebotS. TylerM. ShenCE Cameron2004Complete nucleotide sequence of Kashmir bee virus and comparison with acute bee paralysis virus.J Gen Virol8522632270

86. Leat N, Ball B, Govan V, Davison S (2000) Analysis of the complete genome sequence of black queen-cell virus, a picorna-like virus of honey bees. J Gen Virol 81: 2111–2119.N. LeatB. BallV. GovanS. Davison2000Analysis of the complete genome sequence of black queen-cell virus, a picorna-like virus of honey bees.J Gen Virol8121112119

87. Maori E, Lavi S, Mozes-Koch R, Gantman Y, Peretz Y, et al. (2007) Isolation and characterization of Israeli acute paralysis virus, a dicistrovirus affecting honeybees in Israel: evidence for diversity due to intra- and inter-species recombination. J Gen Virol 88: 3428–3438.E. MaoriS. LaviR. Mozes-KochY. GantmanY. Peretz2007Isolation and characterization of Israeli acute paralysis virus, a dicistrovirus affecting honeybees in Israel: evidence for diversity due to intra- and inter-species recombination.J Gen Virol8834283438

88. Govan VA, Leat N, Allsopp M, Davison S (2000) Analysis of the complete genome sequence of acute bee paralysis virus shows that it belongs to the novel group of insect-infecting RNA viruses. Virology 277: 457–463.VA GovanN. LeatM. AllsoppS. Davison2000Analysis of the complete genome sequence of acute bee paralysis virus shows that it belongs to the novel group of insect-infecting RNA viruses.Virology277457463

89. Bolstad BM, Irizarry RA, Astrand M, Speed TP (2003) A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19: 185–193.BM BolstadRA IrizarryM. AstrandTP Speed2003A comparison of normalization methods for high density oligonucleotide array data based on variance and bias.Bioinformatics19185193

90. Team RDC (2009) R: A language and environment for statistical computing. 1: Team RDC2009R: A language and environment for statistical computing.1Vienna, Austria: Available: http://www.R-project.org/. Accessed 2010 Jul. Vienna, Austria: Available: http://www.R-project.org/. Accessed 2010 Jul.

91. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, et al. (2004) Bioconductor: open software development for computational biology and bioinformatics. Genome Biol 5: R80.RC GentlemanVJ CareyDM BatesB. BolstadM. Dettling2004Bioconductor: open software development for computational biology and bioinformatics.Genome Biol5R80

92. Smyth GK (2004) Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat Appl Genet Mol Biol 3: Article3.GK Smyth2004Linear models and empirical bayes methods for assessing differential expression in microarray experiments.Stat Appl Genet Mol Biol3Article3

93. Huang DW, Sherman BT, Lempicki RA (2009) Systematic and integrative analysis of large gene lists using DAVID Bioinformatics Resources. Nat Protoc 4: 44–57.DW HuangBT ShermanRA Lempicki2009Systematic and integrative analysis of large gene lists using DAVID Bioinformatics Resources.Nat Protoc44457

94. Tsai C, Gergen P (1995) Pair-rule expression of the Drosophila fushi tarasu gene: a nuclear receptor response element mediates the opposing regulatory effects of runt and hairy. Development 121: 453–4662.C. TsaiP. Gergen1995Pair-rule expression of the Drosophila fushi tarasu gene: a nuclear receptor response element mediates the opposing regulatory effects of runt and hairy.Development1214534662

95. Mehta B, Bhat KM (2001) Slit signaling promotes the terminal asymmetric division of neural precursor cells in the Drosophila CNS. Development 128: 3161–3168.B. MehtaKM Bhat2001Slit signaling promotes the terminal asymmetric division of neural precursor cells in the Drosophila CNS.Development12831613168

96. Kubo T, Sasaki M, Nakamura J, Sasagawa H, Ohashi K, et al. (1996) Change in the expression of hypopharyngeal-gland proteins of the worker honeybees (Apis mellifera L.) with age and/or role. J Biochem 119: 291–295.T. KuboM. SasakiJ. NakamuraH. SasagawaK. Ohashi1996Change in the expression of hypopharyngeal-gland proteins of the worker honeybees (Apis mellifera L.) with age and/or role.J Biochem119291295

97. Fischer P, Grozinger CM (2008) Pheromonal regulation of starvation resistance in honey bee workers (Apis mellifera). Naturwissenschaften 95: 723–729.P. FischerCM Grozinger2008Pheromonal regulation of starvation resistance in honey bee workers (Apis mellifera).Naturwissenschaften95723729

98. Boldyrev AA, Yuneva MO, Sorokina EV, Kramarenko GG, Fedorova TN, et al. (2001) Antioxidant systems in tissues of senescence accelerated mice. Biochemistry (Mosc) 66: 1157–1163.AA BoldyrevMO YunevaEV SorokinaGG KramarenkoTN Fedorova2001Antioxidant systems in tissues of senescence accelerated mice.Biochemistry (Mosc)6611571163

99. Habig WH, Pabst MJ, Jakoby WB (1974) Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J Biol Chem 249: 7130–7139.WH HabigMJ PabstWB Jakoby1974Glutathione S-transferases. The first enzymatic step in mercapturic acid formation.J Biol Chem24971307139

100. Bounias M, Kruk I, Nectoux M, Popeskovic D (1996) Toxicology of cupric salts on honeybees. V. Gluconate and sulfate action on gut alkaline and acid phosphatases. Ecotox environ safe 35: 67–76.M. BouniasI. KrukM. NectouxD. Popeskovic1996Toxicology of cupric salts on honeybees. V. Gluconate and sulfate action on gut alkaline and acid phosphatases.Ecotox environ safe356776