About the Authors:
Liqin Du
Contributed equally to this work with: Liqin Du, Hao Pang
Affiliation: State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Guangxi University, Nanning, Guangxi, China
Hao Pang
Contributed equally to this work with: Liqin Du, Hao Pang
Affiliation: National Engineering Research Center for Non-Food Biorefinery, Guangxi Academy of Sciences, Nanning, Guangxi, China
Zilong Wang
Affiliation: State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Guangxi University, Nanning, Guangxi, China
Jian Lu
Affiliation: State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Guangxi University, Nanning, Guangxi, China
Yutuo Wei
Affiliation: State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Guangxi University, Nanning, Guangxi, China
Ribo Huang
* E-mail: [email protected]
Affiliations State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Guangxi University, Nanning, Guangxi, China, National Engineering Research Center for Non-Food Biorefinery, Guangxi Academy of Sciences, Nanning, Guangxi, China
Introduction
β-Fructofuranosidases (EC 3.2.1.26) are enzymes that are capable of hydrolyzing substrates with terminal fructosyl. Most β-fructofuranosidases have been shown to hydrolyze sucrose to release glucose and fructose and to possess fructosyltransferase activity for the synthesis of short-chain fructooligosaccharides [1]. Based on the hydrolysis substrates, β-fructofuranosidases can be given different names, invertase for sucrose hydrolysis, and inulinase and β-fructosidase for inulin hydrolysis [2]. The ratios of β-fructofuranosidase activities for sucrose and inulin vary widely, it has been shown that β-fructofuranosidase from some Bifidobacteria could hydrolyze fructooligosaccharides faster than sucrose [2].
Invertase activity catalyzes the hydrolysis of sucrose to produce a mixture of fructose and glucose (inverted sugar syrup). Invertase is important for the industrial hydrolysis of sucrose, which is a sustainable carbohydrate resource used in food and fermentation process. In the food industry, the use of invertases ensures that the confectionery products remain fresh and soft after a long period of storage [3]. Invert sugar, the invertase hydrolysed product of sucrose, consists of an equimolar mixture of glucose and fructose. It is sweeter than sucrose and has a lower crystallinity than sucrose at higher concentrations [4]. This mixture has similar properties to high fructose syrup from starch sources, and can be used as an alternative to the same. For these reasons, invertases are used widely in various industrial food applications. In the alcohol industry, invertase activity is used in the fermentation of cane molasses into ethanol where it is required for its ability to hydrolyze sucrose under the inhibitor conditions existing in molasses [5]. Other uses of these enzymes include the production of plasticizing agents in cosmetics, drug and paper industries, and as enzyme electrodes in bioelectronic applications [6], [7]. Recently, enzyme electrode sensors have been the target of intense research, and new methods allow this technology to be used more broadly [7], [8]. In enzyme biosensors, the sucrose hydrolysis activity of invertase is used as a signal, and it is preferable that this enzyme is catalytically active under neutral pH conditions and does not participate in adverse or side reactions such as transferase activity [9].
To date, the most well studied and readily available invertase is the acid invertases derived from Saccharomyces cerevisiae. The neutral invertases, which are mainly found in plants, have neutral pH activity and many appear to use sucrose as their sole substrate [10]. Not very much is known about neutral/alkaline invertases at the native protein level due to difficulties in their purification and their low, unstable enzymatic activities [11], although some studies have cloned and expressed neutral invertases in Escherichia coli [10], [12], [13]. Using immobilized enzyme technologies the stabilization of the invertase has been achieved under extreme conditions [14]. Such technologies may help to shift the optimum pH of the invertase and prevent the formation of oligosaccharides by the transferase activity that is often also associated with the soluble enzyme [15].
We previously constructed a metagenomic library from sucrose rich soils and screened for sucrose-degrading enzymes [16]. In the previous work, invertase uninv was found and characterized, it had an optimum pH of 6.5 and an optimum temperature of 50°C toward sucrose substrate. In the present study, an invertase gene was subcloned and characterized from this metagenomic library. This recombinant invertase showed a strong activity and pH stability. Furthermore, we engineered this gene to adjust the optimum pH of the invertase from acidic to near neutral pH.
Materials and Methods
Bacterial Strains and Materials
E. coli strain XL1-blue and EPI300 were purchased from Takara Bio Inc. (Dalian, China), and Epicentre Inc. (Madison, WI), respectively. Vector pCC1FOS was purchased from Epicentre Inc., vector pUC19 and pSE380 were purchased from Invitrogen Inc. (San Diego, CA). The chemicals were purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO). The enzymes including restriction endonucleases and DNA ligase, and PCR primers were purchased from Takara Bio Inc.
Library Screening and Gene Cloning
We previously constructed a metagenomic library from sucrose rich soils [16]. Clones of the fosmid DNA library were screened on M9 basic medium containing 10 mg l−1 yeast extract, with 10 g l−1 sucrose as the sole carbon source. The library, grown on Luria agar (LA) medium, was transferred to the M9 plate and incubated at 37°C for 50 h. The clones that grew most rapidly were selected for further enzyme activity assessment. The chosen clones were lysed by sonication and the sucrose hydrolysis activity of the lysate was examined using 3′,5′-dinitrosalicylic acid (DNS) [17]. The plasmid that harbored the positive clone was extracted, digested with BamHI, and the fragments were subcloned into a pUC19 vector. The sub-cloned fragments were then sequenced from both ends by Takara Bio Inc.
Sequence Analysis of Uninv2
Sequence similarity searches were performed using BLAST tools from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov). The signal peptide was predicted using signalP (http://www.cbs.dtu.dk/services/SignalP/). Protein domain analysis was performed with the Simple Modular Architecture Research Tool (SMART) on the SMART server (http://smart.embl-heidelberg.de). Alignment analysis was performed with MUSCLE (http://www.ebi.ac.uk/Tools/muscle/), and Fig. 1 was produced with BOXSHADE (http://www.ch.embnet.org/software/BOX_form.html).
[Figure omitted. See PDF.]
Figure 1. Sequences alignment of uninv2, the invertase from T. maritima and the invertase2 from C. gingivalis.
The sequences were identified as follows: uninv2 (HQ267532), invTHM, invertase from T. maritima (CAA04518), invCAG, invertase2 from C. gingivalis (EEK13630). The boxes (I–III) indicate the conserved NDPNG, FRDP and ECP motifs of the glycoside hydrolase family 32 invertases. * mark the catalytic active residues and general acid/base. The alignment was performed with MUSCLE and the figure was produced with BOXSHADE.
https://doi.org/10.1371/journal.pone.0062306.g001
Cloning and Expression of the uninv2 Gene
First, uninv2 was amplified with the following primers: sense primer F1, 5′ -CACTCATGATGCACCACCACCACCACCACAATAGACAGATGAATCCAGGTC -3′ (containing a PagI site and a 6×His tag at the 5′ end) and anti-sense primer R1, 5′ - CACCTGCAGACGATGATTTCACAGATGCAAGC -3′ (containing a PstI site at the 5′ end) by PCR. Amplified DNA was digested with PagI and PstI and sub-cloned into a pSE380 expression vector (Invitrogen) digested with NcoI and PstI. The expression construct was transformed into E. coli XL1-blue. The transformants were incubated at 37°C until an OD600 of 0.6 was reached. Then 1 mM IPTG was added to the broth and incubation was continued at 37°C for a further 10 h to induce expression of the enzyme. The recombinant protein was purified with nickel-nitrilotriacetic acid chromatography (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The purified protein was then passed through a 30 kDa ultra-filter membrane (Whatman, Kent, UK) to dialysis the protein. The purified protein was analyzed with sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and matrix assisted laser desorption ionization mass spectrometry (MALDI-MS). The MALDI-MS analysis was performed on the Bruker Autoflex II MALDI-TOF/TOF System (Bruker, Bremen, Germany).
Truncation of Uninv2
Uninv2 was truncated to delete the DNA encoding the 100 amino acids N-terminal domain by PCR with the sense primer F2 5′- CACTCATGATGCACCACCACCACCACCACTTTCGACCTGGATTTCATTTC-3′ (containing a PagI site and a 6×His tag at the 5′ end, this primer started from nucleotide 361 in the uninv2 gene, relative to the ATG start codon), and anti-sense primer R1. The truncated uninv2 gene was sequenced three times to confirm that the sequence was correct. The truncated uninv2 was named M-inv2, and the M-inv2 protein was expressed and purified as described above.
Determination of Enzyme Activity and Kinetic Parameters
Sucrose hydrolysis reactions involved incubation at 45°C for 30 min of reaction mixtures containing the purified protein and 10 g l−1 sucrose in a volume of 0.5 ml at the optimal pH. The amount of proteins (uninv2 and M-inv2) used in a single reaction was 0.1 µg. The activity was quantified by measuring the reducing sugars generated (as d-glucose equivalents) with DNS reagent. One enzyme unit (U) corresponded to 1 µmol of glucose equivalent released from the reaction per min under the above conditions. The pH dependence of the enzymes’ activity was measured between pH 2.5 and 7.5 using 50 mM glycine-HCl buffer (pH 2.5–3.5), HAC-NaAC buffer (pH 3.5–6.0), or Na phosphate buffer (pH 6.0–8.0), at 37°C. The temperature dependence of the enzymes’ activity was measured between 20°C and 60°C at the optimal pH. For comparing the pH stability of the enzymes, the protein was placed at 37°C, and after different time intervals, aliquots were removed for enzyme activity assays. For determination of storage stability, the protein was placed at 4°C or 37°C, and the pH of the storage buffer was 6.0 for uninv [16], and 5.0 for uninv2 and M-inv2.
The activity of the enzymes for alternative substrates was also assayed. Sucrose, inulin, raffinose, 1-kestose and nystose were tested at 100 mM under the same conditions as those described above and the incubation time was 12 h, except that sucrose was only incubated for 5 min. The products formed were analyzed by high performance liquid chromatography (HPLC) using a 4.6 × 250 mm carbohydrate cartridge column on a Waters 2695 system equipped with an evaporative light scattering detector. Acetonitrile/water (70∶30) was used as the solvent with a flow rate of 1 ml min−1.
Results and Discussion
Library Screening and Gene Cloning
A Fosmid library containing about 100,000 clones was constructed with the soil sample from the sugar refinery as we described before [16]. A cluster of 5,000 clones from this library was screened for the target activity. Eight clones grew significantly faster on M9 (with sucrose) plates, one of which showed significant activity against sucrose in neutral pH buffer (pH 6.5–8.0, sodium-phosphate buffer) [16]. The other clones showed activity in the acid pH (<6.0) range. One clone showed the highest activity at acid pH (pH 4.5), and it was named 3–7. A subclone 3-7-s5 derived from 3–7 had activity toward sucrose. This subclone contained a 6,930 bp insert DNA, sequence analysis showed that there were three ORFs in the insert DNA: a putative transmembrane sugar transporter, a putative two-component system sensor histidine kinase/response regulator, and an enzyme that showed homology to an invertase 2 from Capnocytophaga gingivalis ATCC 33624 as described in GenBank (accession no. EEK13630). The third ORF, which was deemed to be the most likely sugar-degrading enzyme candidate, was chosen for further analysis. This ORF was named uninv2. The sequence of uninv2 was deposited in GenBank with the NCBI under accession number HQ267532.
Molecular Analysis of Uninv2
The putative protein encoded by uninv2, namely uninv2, contained 586 amino acids and the calculated molecular mass is 66.7 kDa. SignalP predicted that uninv2 contained a signal peptide at the N terminus. SMART analysis also showed that uninv2 contained a signal peptide (1–20 amino acids long), as well as a glycoside hydrolase family 32 domain (126 aa–549 aa).
Interestingly, uninv2 had a additional 120 amino acids domain present at the N-terminus comparing with invertase from Thermotoga maritima (Fig. 1). Only a few sucrose-hydrolyzsed enzymes contain an N-terminal domain of unknown function (Fig. S1). This N-terminal domain of uninv2 had no similarity to any known protein sequence in the GenBank. The remaining uninv2 sequence was most similar to invertase 2 from C. gingivalis ATCC 33624, according to BlastX analysis. Comparison of the uninv2 sequence with related glycoside hydrolase family 32 sucrose-degrading enzymes revealed the presence of several conserved regions in uninv2 (Fig. 1). The conserved NDPNG, FRDP and ECP motifs of the glycoside hydrolase family 32 invertases were all present in uninv2 [18]. This indicated that uninv2 was closely related to invertases from glycoside hydrolase family 32.
Expression and Purification of Uninv2
The recombinant protein was over-expressed in E. coli, and one-step purification was performed with Ni–NTA chromatography. The purified uninv2 was homogeneous, giving a single and clean band at approximately 65 kDa on an SDS–PAGE gel (Fig. 2a). The time of flight mass spectrometry (TOF-MS) analysis showed a 65 kDa peak which corresponded to the deduced molecular weight of the uninv2 gene product (Fig. 2b).
[Figure omitted. See PDF.]
Figure 2. Analysis of purified recombinant uninv2.
(a) SDS–PAGE analysis of uninv2 protein stained with coomassie blue. Lane M, markers for molecular size (kDa); Lane P, protein sample. The uninv2 is at 65 kDa by SDS-PAGE. (b) MALDI MS analysis of recombinant uninv2, the arrows indicate the target protein peaks.
https://doi.org/10.1371/journal.pone.0062306.g002
Enzymatic Properties of Uninv2
Uninv2 was active at pH 2.5–7.5, with an optimum pH of 4.5. It retained 50% of its activity between pH 3.5 and 6.0 (Fig. 3a). Uninv2 was found to be catalytically active between 20°C and 60°C, and had an optimum temperature of 45°C (Fig. 3b).
[Figure omitted. See PDF.]
Figure 3. Effects of pH and temperature on the activity of recombinant uninv2 (dashed line) and M-inv2 (solid line).
(a) Effect of pH on enzymatic activity, measured in 50 mM glycine-HCl buffer (pH 2.5–3.5, closed circles), HAC-NaAC buffer (pH 3.5–6.0, open circles) and Na phosphate buffer (pH 6.0–8.0, triangles) at 37°C for 30 min, the sucrose was 10 g l−1 in a volume of 0.5 ml. Enzyme activity is shown as the specific activity: one unit represents 1 µmol of glucose released from the reaction per min per mg protein. (b) Effect of temperature on the activity of uninv2 (dashed line) and M-inv2 (solid line). The temperature dependence of the enzymes’ activity was measured between 20°C and 60°C under the optimum pH condition (pH 4.5 or 6.0 for uninv2 and M-inv2, respectively). The error bars represent the standard deviation of triplicate measurements.
https://doi.org/10.1371/journal.pone.0062306.g003
Uninv2 was found to be capable of hydrolyzing sucrose, 1-kestose, raffinose, nystose and inulin. Sucrose was hydrolyzed to fructose and glucose; 1-Kestose was hydrolyzed to fructose, glucose and sucrose; raffinose was hydrolyzed to fructose and melibiose; nystose was hydrolyzed to fructose, glucose, and sucrose; and inulin was hydrolyzed to fructose (Fig. 4). No transglycosylation activity was detected by HPLC analysis of the reaction mixtures.
[Figure omitted. See PDF.]
Figure 4. Substrate profiles of uninv2.
Substrates: 100 mM sucrose (a), 1-kestose (b), raffinose (c), nystose (d) and inulin (e) were hydrolyzed by uninv2. All the reactions were performed in a volume of 0.5 ml pH 4.5 HAC-NaAC buffer at 45°C for 12 h, except that sucrose was only incubated for 5 min. Peak numbers show the retention times for fructose (1), glucose (2), sucrose (3), melibiose (4), 1-kestose (5) and raffinose (6).
https://doi.org/10.1371/journal.pone.0062306.g004
The optimum pH of uninv2 was similar to most acid invertases that have been reported to date, which have activity in the range of pH 3.5 to 6.0 and an optimum near pH 4.5 [3], [4]. Therefore, uninv2 can be classified as an acid invertase.
Uninv2 can hydrolyze sucrose, 1-kestose, raffinose, nystose and inulin. The hydrolysis of low molecular weight fructose-containing oligosaccharides is characteristic of invertases of the GH 32 family [19]. Since uninv2 released fructose from fructose linked oligosaccharides, for example nystose, and it can hydrolyze inulin to release fructose, it can be concluded that uninv2 is an exo-glycosidase. In contrast to most invertases, uninv2 can hydrolyze inulin, which is a poor substrate for acid invertases of the GH32 family [10], [19].
Truncation of Uninv2: To Shift Optimum pH towards Neutral
Uninv2 has 120 amino acids at the N terminus that are not present in the invertase from T. maritima. This sequence contains a 20 amino acids signal peptide and a 100 amino acids domain of unknown function. PCR was used to delete amino acids 1–120 from uninv2. The PCR product was sequenced three times to confirm the deletion. The truncated protein was named M-inv2. M-inv2 was purified with Ni-NTA chromatography to give a single band by SDS-PAGE analysis (Fig. 5c) TOF-MS analysis showed the molecular weight as 54 kDa (Fig. 5d). The effects of pH on uninv2 and its truncated form, M-inv2, were compared. Interestingly, the loss of the N-terminal domain altered the optimum pH to a more neutral pH. M-inv2 had an optimum pH of 6.0 compared with pH 4.5 for uninv2. M-inv2 was active between pH 3.5 and 7.5, and retained 50% of its activity after incubation at pHs of between pH 4.5 and 6.5 (Fig. 3a). Thus, the deletion of the N-terminal domain of uninv2 shifted the enzyme’s optimum pH by 1.5 units towards neutral pH. Compared with uninv2, M-inv2 was found to be active over a narrower range of temperatures (25–55°C), and it retained 50% of its activity after incubation at temperatures of between 35°C and 47°C (Fig. 3b). However, the optimum temperature of the truncation did not change from that of wild type (45°C). The loss of the N-terminus did not affect the enzymatic activity of the protein against oligosaccharides.
[Figure omitted. See PDF.]
Figure 5. Analysis of purified recombinant M-inv2.
(a) SDS–PAGE analysis of M-inv2 protein stained with coomassie blue. Lane M, markers for molecular size (kDa); Lane P, protein sample. The M-inv2 is at 54 kDa by SDS-PAGE. (b) MALDI MS analysis of recombinant M-inv2, the arrows indicate the target protein peaks.
https://doi.org/10.1371/journal.pone.0062306.g005
A neutral pH optimum is valuable for industrial applications of invertases, such as in the production of invert sugars, and as enzyme electrodes for biosensors [7], [20]. To date, the most studied invertase was the acid invertase from S. cerevisiae which is active between pH 4–7 with an optimum activity at pH 5.0 [14]. Though, some neutral pH active invertases were reported [10], [12], [13], [21], there are no data about enzyme stability. The neutral invertases from plants typically have very low Kms to sucrose, but with slow hydrolysis speeds [22], [23]. M-inv2 showed a near neutral optimum pH and strong pH stability making it potentially useful as a biosensor.
Kinetic Parameters of Uninv2 and Truncation
When uninv2 and M-inv2 were incubated with a range of sucrose concentrations, typical Michaelis–Menten kinetics were observed (Fig. S2). A Vmax of 1302.2±16.6 µmol min−1 mg−1, a Km of 17.2±0. 7 mM and a kcat of 1447.6 s−1were measured for uninv2. The Vmax, Km and kcat for M-inv2 were 961.7±36.04 µmol min−1 mg−1, 32.5±2.4 mM and 868.2 s−1, respectively. Table 1 compares the properties of various invertases from a number of different sources. The enzyme with the highest activity is the invertase from S. cerevisiae, while the activity of uninv2 is lower than the invertase from T. maritima but is higher than the one from Bifidobaterium adolescentis. Uninv2 have a lower Km compared with invertase from S. cerevisiae and T. maritima, thus its catalytic efficiency is higher than that of invertase from T. maritima. M-inv2 have higher Km than uninv2 and its catalytic efficiency is lower than that of uninv2 and invertase from T. maritima. The neutral invertases from plants, such as Beta vulgaris and pea seeding, typically have very low Kms to sucrose, with slow hydrolysis speeds. Truncation of uninv2 results in a lower Vmax comparing with uninv2, though it is still higher than that of the invertase from B. adolescentis.
[Figure omitted. See PDF.]
Table 1. Kinetic parameters of invertases from various sources.
https://doi.org/10.1371/journal.pone.0062306.t001
pH Tolerance and Storage Stability of Uninv2 and M-inv2
The pH stability of the enzyme at 37°C was compared between uninv [16], uninv2 and M-inv2 (Fig. 6). Uninv and uninv2 were found from the same metagenomic DNA library. They have a 30% identities and 43% positives in amino acid sequences [16]. Uninv was a neutral invertase with hydrolysis activity towards sucrose in the pH range of 6.0–8.0 with an optimum pH of 6.5. At 37°C, uninv was only stable at pH 6.0 (lost 26% activity). It was unstable at other pHs, especially at pH 8.0, where it lost 75% activity at 30 min and 87% at 300 min (Fig. 6a). Uninv2 and M-inv2 were very stable at all the tested pHs (Fig. 6b and 6c).
[Figure omitted. See PDF.]
Figure 6. The pH stability of the enzyme at 37°C.
The pH stability of uninv (a), uninv2 (b) and M-inv2 (c) were tested at 37°C. The protein was incubated in pH 5.0 (closed cycles), pH 6.0 (open cycles), pH 7.0 (closed triangles) and pH 8.0 (open triangles) buffer at 37°C and was tested for residual activity under the optimum conditions at different intervals. The error bars represent the standard deviation of triplicate measurements.
https://doi.org/10.1371/journal.pone.0062306.g006
The storage stabilities of uninv, uninv2 and M-inv2 were compared in Fig. 7. When stored at 4°C, uninv became in-active after 10 days. It is worthy to note that uninv2 still retained 97% activity after 30 days, and M-inv2 retained 65% activity (Fig. 7a). When stored at 37°C, uninv showed no activity after 12 h, M-inv2 lost its activity after 24 h, and uninv2 stood for a long time, it lost all activity after 72 h (Fig. 7b).
[Figure omitted. See PDF.]
Figure 7. Storage stability at different temperatures.
The storage stability of uninv (closed cycles), uninv2 (open cycles) and M-inv2 (closed triangles) was performed at 4°C (a) and 37°C (b). Proteins were incubated in buffer at pH 6.0 for uninv and pH 5.0 for uninv2 and M-inv2, the incubation temperatures were 4°C and 37°C. Aliquots were withdrawn for activity measurement under the optimum conditions at different intervals. The error bars represent the standard deviation of triplicate measurements.
https://doi.org/10.1371/journal.pone.0062306.g007
The widely used invertase from S. cerevisiae lost 35% activity after a 300 min incubation at pH 5.0, and lost about 70% activity after the same time at pH 6.0 [15]. At pHs greater than 7.0, it was not stable even for 4 h [24]. The pH-dependent activity of enzymes is set primarily by the pKa values of one or a few key ionizable groups within its active site cleft [25]. Thus, the factors that establish the precise pKa values of these catalytically essential groups are important. Goetz and Roitsch shifted 0.6 units of the pH optimum of an invertase to more basic values (from pH 3.8 to 4.4) by substitution of the proline residue with valine in the conserved motif of this invertase [26]. It was also observed that substitution of single amino acid on Aspergillus kawachii xylanase C elevated its pH optimum from pH 2 to 5 [27]. Joshi et al. (2000) concluded that family 11 xylanases had a special electrostatic interactions between acid/base catalyst (Glu 172) and the substituted position (Asp 35), the strong hydrogen bonding interaction stabilized the transition state for glycosyl transfer at acid pH condition [28]. It is different for immobilized invertase, some authors have reported an increase in optimum pH and broadening of the pH profile after immobilization [29], it is concluded that strong interactions between enzyme and support will affect the intra-molecular forces responsible for maintaining the conformation of the enzyme that would lead to a change in activity [15]. The ability of uninv2 to be stored for a long period of time with the minimal activity loss was superior to invertase from S. cerevisiae, which lost all activity over 15 days at 5°C [15].The ability to stand for neutral pH condition and the long storage stability of uninv2 make it ideal for use in a variety of industrial applications. Besides of the food and alcohol fermentation application, it is also a suitable enzyme used in an enzyme biosensor which need strong stability enzymes.
Conclusions
Stability of an enzyme is important for its application in industry. In this study, invertase uninv2 with high pH tolerance and storage stability was reported. It has a broad pH tolerance, comparing with other invertases intolerant to neutral or alkaline environments. While deletion of its N-terminal 100 amino acids, uninv2 was truncated from an acid pH optimum invertase to a neutral pH optimum invertase, and the truncation still retained the high pH tolerance and storage stability of wild-type enzyme. These characteristics make them far superior to invertase from S. cerevisiae, which is a most used industrial enzyme. This suggests that uninv2 and its truncation have the potential for use in industry.
Supporting Information
[Figure omitted. See PDF.]
Figure S1.
Alignment of glycoside hydrolases from glycoside hydrolase family 32. The alignment showed the most similar proteins with uninv2 in the BlastP analysis. The sequences were identified as follows: Bai: protein from Bacteroides intestinalis DSM 17393 (EDV04068), Blh: protein from Blautia hansenii (ZP_03547458), Cag: protein from Capnocytophaga gingivalis ATCC 33624 (EEK13630), Clb: protein from Clostridium beijerinckii (YP_001310947), Cls: protein from Clostridium sp. L2–50 (ZP_02075141), Coe: protein from Coprococcus eutactus (ZP_02205360), Pad: protein from Parabacteroides distasonis ATCC 8503 (ABR45076), Rug: protein from Ruminococcus gnavus (ZP_02040442), Spl: protein from Spirosoma linguale DSM 74 (EEP01562), Thm: protein form Thermotoga maritima (AAD36485), Thp: protein from Thermoanaerobacter pseudethanolicus (ABY94292), Ths: protein from Thermoanaerobacter sp.X514 (ABY92416). Accession numbers (GenBank or Swissprot) of the enzymes were shown in parenthesis after each original strain. The alignment was performed with MUSCLE and the figure was produced with BOXSHADE.
https://doi.org/10.1371/journal.pone.0062306.s001
(TIF)
Figure S2.
Michaelis-Menten graph of uninv2 and M-inv2. Reactions were carried out in the optimum conditions using 0.1µg enzyme. The substrate concentrations were 2.9, 8.7, 14.6, 29.2, 58.5 and 146.2 mM. The figure showed one set of data. Inset showed the Lineweaver-Burk plot.
https://doi.org/10.1371/journal.pone.0062306.s002
(TIF)
Author Contributions
Conceived and designed the experiments: LQD HP RBH. Performed the experiments: LQD HP ZLW JL. Analyzed the data: LQD HP YTW RBH. Wrote the paper: LQD HP RBH.
Citation: Du L, Pang H, Wang Z, Lu J, Wei Y, Huang R (2013) Characterization of an Invertase with pH Tolerance and Truncation of Its N-Terminal to Shift Optimum Activity toward Neutral pH. PLoS ONE 8(4): e62306. https://doi.org/10.1371/journal.pone.0062306
1. Alvaro Benito M, de Abreu M, Fernandez Arrojo L, Plou FJ, Jimenez Barbero J, et al. (2007) Characterization of a beta-fructofuranosidase from Schwanniomyces occidentalis with transfructosylating activity yielding the prebiotic 6-kestose. J Biotechnol 132: 75–81.
2. Warchol M, Perrin S, Grill JP, Schneider F (2002) Characterization of a purified β-fructofuranosidase from Bifidobacterium infantis ATCC 15697. Lett Appl Microbiol 35: 462–467.
3. Rubio MC, Runco R, Navarro AR (2002) Invertase from a strain of Rhodotorula glutinis. Phytochemistry 61: 605–609.
4. Goosen C, Yuan XL, van Munster JM, Ram AF, van der Maarel MJ, et al. (2007) Molecular and biochemical characterization of a novel intracellular invertase from Aspergillus niger with transfructosylating activity. Eukaryot Cell 6: 674–681.
5. Takeshige K, Ouchi K (1995) Effects of yeast invertase on ethanol production in molasses. J Ferment Bioeng 79: 513–515.
6. Kotwal SM, Shankar V (2009) Immobilized invertase. Biotechnol Adv 27: 311–322.
7. Bagal-Kestwal D, Karve MS, Kakade B, Pillai VK (2008) Invertase inhibition based electrochemical sensor for the detection of heavy metal ions in aqueous system: Application of ultra-microelectrode to enhance sucrose biosensor’s sensitivity. Biosens Bioelectron 24: 657–664.
8. Xiang Y, Lu Y (2011) Using personal glucose meters and functional DNA sensors to quantify a variety of analytical targets. Nat Chem 3: 697–703.
9. Amine A, Mohammadi H, Bourais I, Palleschi G (2006) Enzyme inhibition-based biosensors for food safety and environmental monitoring. Biosens Bioelectron 21: 1405–1423.
10. Sturm A, Hess D, Lee H-S, Lienhard S (1999) Neutral invertase is a novel type of sucrose-cleaving enzyme. Physiologia Plantarum 107: 159–165.
11. Roitsch T, Gonzalez MC (2004) Function and regulation of plant invertases: sweet sensations. Trends Plant Sci 9: 606–613.
12. Xiang L, Le Roy K, Bolouri-Moghaddam MR, Vanhaecke M, Lammens W, et al. (2011) Exploring the neutral invertase-oxidative stress defence connection in Arabidopsis thaliana. J Exp Bot 62: 3849–3862.
13. Gallagher JA, Pollock CJ (1998) Isolation and characterization of a cDNA clone from Lolium temulentum L. encoding for a sucrose hydrolytic enzyme which shows alkaline/neutral invertase activity. J Exp Bot 49: 789–795.
14. Akgöl S, Kaçar Y, Denizli A, Arıca MY (2001) Hydrolysis of sucrose by invertase immobilized onto novel magnetic polyvinylalcohol microspheres. Food Chemistry 74: 281–288.
15. Sanjay G, Sugunan S (2006) Enhanced pH and thermal stabilities of invertase immobilized on montmorillonite K-10. Food Chemistry 94: 573–579.
16. Du L-Q, Pang H, Hu Y-Y, Wei Y-T, Huang R-B (2010) Expression and characterization in E. coli of a neutral invertase from a metagenomic library. World J Microbiol Biotechnol 26: 419–428.
17. Miller GL (1959) Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 31: 426–428.
18. Liebl W, Brem D, Gotschlich A (1998) Analysis of the gene for beta-fructosidase (invertase, inulinase) of the hyperthermophilic bacterium Thermotoga maritima, and characterisation of the enzyme expressed in Escherichia coli. Appl Microbiol Biotechnol 50: 55–64.
19. Ettalibi M, Baratti JC (1987) Purification, properties and comparison of invertase, exoinulinases and endoinulinases of Aspergillus ficuum. Appl Microbiol Biotechnol 26: 13–20.
20. Chaplin MF, Bucke C (1990) Enzyme technology. New York: Cambridge University Press. xvi, 264 p.
21. Omori T, Ueno K, Muramatsu K, Kikuchi M, Onodera S, et al. (2010) Characterization of recombinant beta-fructofuranosidase from Bifidobacterium adolescentis G1. Chem Cent J 4: 9.
22. Karuppiah N, Vadlamudi B, Kaufman PB (1989) Purification and characterization of soluble (cytosolic) and bound (cell wall) isoforms of invertases in barley (Hordeum vulgare) elongating stem tissue. Plant Physiol 91: 993–998.
23. Ross HA, McRae D, Davies HV (1996) Sucrolytic Enzyme Activities in Cotyledons of the Faba Bean (Developmental Changes and Purification of Alkaline Invertase). Plant Physiol 111: 329–338.
24. Schülke N, Schmid FX (1988) The stability of yeast invertase is not significantly influenced by glycosylation. J Biol Chem 263: 8827–8831.
25. Kim SH, Pokhrel S, Yoo YJ (2008) Mutation of non-conserved amino acids surrounding catalytic site to shift pH optimum of Bacillus circulans xylanase. J Mol Catal B: Enzym 55: 130–136.
26. Goetz M, Roitsch T (1999) The different pH optima and substrate specificities of extracellular and vacuolar invertases from plants are determined by a single amino-acid substitution. Plant J 20: 707–711.
27. Fushinobu S, Ito K, Konno M, Wakagi T, Matsuzawa H (1998) Crystallographic and mutational analyses of an extremely acidophilic and acid-stable xylanase: biased distribution of acidic residues and importance of Asp37 for catalysis at low pH. Protein Eng 11: 1121–1128.
28. Joshi MD, Sidhu G, Pot I, Brayer GD, Withers SG, et al. (2000) Hydrogen bonding and catalysis: a novel explanation for how a single amino acid substitution can change the pH optimum of a glycosidase. J Mol Biol 299: 255–279.
29. Arıca MY, Bayramoğlu G (2006) Invertase reversibly immobilized onto polyethylenimine-grafted poly(GMA–MMA) beads for sucrose hydrolysis. J Mol Catal B: Enzym 38: 131–138.
30. Reddy A, Maley F (1996) Studies on identifying the catalytic role of Glu-204 in the active site of yeast invertase. J Biol Chem 271: 13953–13957.
31. Kim D, Lee G, Chang M, Park J, Chung Y, et al. (2011) Purification and Biochemical Characterization of Insoluble Acid Invertase (INAC-INV) from Pea Seedlings. J Agric Food Chem 59: 11228–11233.
32. Silvius JE, Snyder FW (1979) Comparative Enzymic Studies of Sucrose Metabolism in the Taproots and Fibrous Roots of Beta vulgaris L. Plant Physiol. 64: 1070–1073.
33. Vujčić Z, Miloradović Z, Milovanović A, Božić N (2011) Cell wall invertase immobilisation within gelatin gel. Food Chemistry 126: 236–240.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2013 Du et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License: https://creativecommons.org/licenses/by/4.0/ (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Most invertases identified to date have optimal activity at acidic pH, and are intolerant to neutral or alkaline environments. Here, an acid invertase named uninv2 is described. Uninv2 contained 586 amino acids, with a 100 amino acids N-terminal domain, a catalytic domain and a C-terminal domain. With sucrose as the substrate, uninv2 activity was optimal at pH 4.5 and at 45°C. Removal of N-terminal domain of uninv2 has shifted the optimum pH to 6.0 while retaining its optimum temperaure at 45°C. Both uninv2 and the truncated enzyme retained highly stable at neutral pH at 37°C, and they were stable at their optimum pH at 4°C for as long as 30 days. These characteristics make them far superior to invertase from Saccharomyces cerevisiae, which is mostly used as industrial enzyme.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer