SNAP-25 regulates spine formation through postsynaptic binding to p140Cap

Abstract

Synaptosomal-associated protein of 25 kDa (SNAP-25) is a member of the Soluble N-ethylmaleimide-sensitive-factor attachment protein receptors (SNARE) protein family, required for exocytosis of synaptic vesicles and regulation of diverse ion channels. Here, we show that acute reduction of SNAP-25 expression leads to an immature phenotype of dendritic spines that are, consistently, less functional. Conversely, over-expression of SNAP-25 results in an increase in the density of mature, Postsynaptic Density protein 95 (PSD-95)-positive spines. The regulation of spine morphogenesis by SNAP-25 depends on the protein's ability to bind both the plasma membrane and the adaptor protein p140Cap, a key protein regulating actin cytoskeleton and spine formation. We propose that SNAP-25 allows the organization of the molecular apparatus needed for spine formation by recruiting and stabilizing p140Cap.

ARTICLE

Received 20 Dec 2012 | Accepted 12 Jun 2013 | Published 19 Jul 2013

Romana Tomasoni1,2, Daniele Repetto3,w, Raffaella Morini1,2, Chiara Elia1,4, Fabrizio Gardoni5, Monica Di Luca5, Emilia Turco3, Paola Delippi3 & Michela Matteoli1,2

Synaptosomal-associated protein of 25 kDa (SNAP-25) is a member of the Soluble N-ethylmaleimide-sensitive-factor attachment protein receptors (SNARE) protein family, required for exocytosis of synaptic vesicles and regulation of diverse ion channels. Here, we show that acute reduction of SNAP-25 expression leads to an immature phenotype of dendritic spines that are, consistently, less functional. Conversely, over-expression of SNAP-25 results in an increase in the density of mature, Postsynaptic Density protein 95 (PSD-95)-positive spines. The regulation of spine morphogenesis by SNAP-25 depends on the proteins ability to bind both the plasma membrane and the adaptor protein p140Cap, a key protein regulating actin cytoskeleton and spine formation. We propose that SNAP-25 allows the organization of the molecular apparatus needed for spine formation by recruiting and stabilizing p140Cap.

DOI: 10.1038/ncomms3136

SNAP-25 regulates spine formation through postsynaptic binding to p140Cap

1 Department of Biotechnology and Translational Medicine, University of Milan, V Vanvitelli 32, Milano 20129, Italy. 2 Humanitas Clinical and Research Center, V Manzoni 56, Rozzano, Milano 20089 Italy. 3 Department of Molecular Biotechnology and Health Sciences, University of Turin, V Nizza 52, Turin 10126, Italy. 4 CNR, Institute of Neuroscience, V Vanvitelli 32, Milano 20129, Italy. 5 Department of Pharmacological and Biomolecular Sciences, University of Milan, V Balzaretti 9, Milan 20133, Italy. w Present address: Institute of Anatomy and Molecular Neurobiology, Westfalische Wilhelms-University Mnster, Mnster,

Germany. Correspondence and requests for materials should be addressed to M.M. (email: mailto:[email protected]

Web End [email protected] ).

NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 1

& 2013 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136

Synaptosomal-associated protein of 25 kDa (SNAP-25) is a member of the SNARE protein family that comprises synaptobrevin/Vesicle-associated membrane protein

(VAMP), syntaxin and SNAP-25, which are essential for the exocytosis of synaptic vesicles13. SNAP-25 is associated to cell membranes through palmitoylated cysteines that are located at the center of the protein4,5. SNAP-25 not only regulates exocytosis, but also negatively modulates different ion channels, including voltage-gated calcium channels (VGCCs) of N-type, P/Q-type and L-type6. Although SNAP-25 has a crucial role at the presynaptic level, a possible postsynaptic role of the protein has been proposed in the regulation of N-methyl-D-aspartate (NMDA) and kainate receptor (KAR) trafcking7,8. SNAP-25 has also been demonstrated to bind to p140Cap9, a 140-kDa protein mainly present in brain, testis and epithelial-rich tissues. In breast cancer cells, p140Cap negatively regulates cell spreading, motility, growth10 and invasion11, affecting tumour cell properties. In neurons, p140Cap is localized in both the preand post-synaptic compartments12,13 and its silencing leads to a decrease in the number of mature mushroom spines, thus providing evidence that p140Cap has a key role in the control of synaptic remodelling.

Rearrangements of the actin cytoskeleton are believed to be of fundamental importance for changes in the morphology of dendritic spines14,15. Interestingly, spine formation and maintenance have been recently found to be controlled by genes involved in energy metabolism16. Spines can vary signicantly in size and shape, from long lopodial spines to stubby and mushroom mature spines17,18. Several evidences correlate the size of the spine with the strength of the synapse, hinting at a possible structural mechanism at the basis of learning and memory1921. Consistently, abnormal spine morphology and density has been described in a number of psychiatric diseases18,22,23, thus clearly indicating that proteins regulating spine remodelling and dynamics are fundamental molecular players in different pathologies of the nervous system.

The SNAP-25 gene has been associated to different neuropsychiatric diseases, including schizophrenia, attention decit hyperactivity disorder and bipolar disorder2427, and defective SNAP-25 function has been shown to be responsible for neurodegeneration in cysteine-string protein (CSP)-alpha KO mice28. We therefore investigated whether SNAP-25 may have a role in the regulation of spine morphology through its binding to p140Cap. We demonstrate that SNAP-25 can recruit p140Cap and regulate density, morphology and functionality of dendritic spines. These data unveil an unexpected key role of SNAP-25 in the morphogenesis of the postsynaptic compartment.

ResultsSNAP-25 regulates dendritic spine density and function. We have previously shown that transfection of rat hippocampal neurons with a pSuper vector containing nucleotides 321339 of rat SNAP-25 reduces SNAP-25 expression by B60% at 12 days after transfection29,30. Acute downregulation of SNAP-25 by siRNA resulted in an unexpected morphological dendrite alteration. Figure 1ac shows the quantitative analysis of 20 days in vitro (DIV) primary rat hippocampal cultures, co-transfected at 17 DIV with SNAP-25 siRNA and green uorescent protein (GFP), and stained for the postsynaptic marker PSD95. A signicant decrease in the number of mushroom and stubby spines could be detected upon the reduction of SNAP-25 expression. Conversely, a strong increase in the number of lopodia was observed (Fig. 1a and c). The decrease in the number of mature spines in the silenced neurons was mirrored by the reduced density of PSD95 (Fig. 1a,b), while over-expression of SNAP-25-GFP (ref. 29) in 17 DIV hippocampal neurons resulted in an increase in the number of mature spines and of PSD95 puncta (Fig. 1ac), further indicating a role for SNAP-25 in the maturation of dendritic spines in primary cultures. To evaluate whether the decrease in mature spines in the absence of SNAP-25 could be rescued by protein re-expression, mouse SNAP-25-GFP, which is not knocked down by the rat siRNA construct, was transfected in hippocampal neurons in which endogenous SNAP-25 was simultaneously silenced. Over-expression of SNAP-25 in these cells led to the rescue of the silenced phenotype by decreasing the number of lopodial spines and increasing the number of mushroom and stubby spines as well as of PSD95 puncta (Fig. 1ac).

Electrophysiological analysis of SNAP-25 silenced cultures revealed that both the frequency and the amplitude of miniature excitatory postsynaptic currents (mEPSCs) were signicantly reduced (Fig. 1d,e). Conversely, over-expression of SNAP-25 did not lead to increase of mEPCS frequency or amplitude (Fig. 1d,e).

SNAP-25 membrane binding is required for spine formation. It has been previously shown that SNAP-25, acting as a SNARE in the postsynaptic compartment, regulates the insertion and removal of postsynaptic NMDA and KARs7,8. We therefore reasoned that SNAP-25 could contribute to spine formation by mediating the insertion of postsynaptic components into the dendritic membrane. To directly test this possibility, we took advantage of the C-terminal deletion mutants SNAP-25D198206,

the fragment generated by botulinum neurotoxin/A (BoNT/A) action, or SNAP-25D181206, the fragment generated by

botulinum neurotoxin/E (BoNT/E) action, that do not sustain exocytosis31,32 (Fig. 2a). Both constructs, fused to HA, were

Figure 1 | Effect of SNAP-25 silencing or over-expression on spine morphology and function. (a) PSD-95 immunocytochemical staining of20 DIV old rat hippocampal cultures silenced for SNAP-25 and transfected with GFP; transfected with SNAP-25-GFP and RFP; and silenced for SNAP-25 (rat construct) and transfected for SNAP-25-GFP (mouse construct) and RFP; Scale bar 10 mm (scale bar inset 2.5 mm). (b) Quantitative analysis of PSD95 immunoreactivity. Scramble: n 4 independent experiments, neurons 49, siRNA SNAP-25: n 3, neurons 47, RFP: n 6,

neurons 45, SNAP-25: n 3, neurons 34, siRNA SNAP-25 SNAP-25 n 3, neurons 40. Values are means.e.m. Statistical test: **** and

####Pr0.0001; one-way ANOVA was followed by Bonferroni multiple-comparison post hoc tests. (c) Quantitative analysis of spine density and lopodial length. Scramble: n 4 independent experiments, neurons 46, siRNA SNAP-25: n 3, neurons 60, RFP: n 9, neurons 85, SNAP-25: n 5,

neurons 51, siRNA SNAP-25 SNAP-25 n 3, neurons 40. Values are means.e.m. Statistical test: **** or ####Pr0.0001, **Pr0.01; one-way

ANOVA followed by Bonferroni multiple-comparison post hoc tests. (d) Representative traces of mEPSC recordings in neurons silenced for SNAP-25 or transfected with SNAP-25-GFP. (e) Top panel: mEPSC frequency. Scramble: n 4 independent experiments, neurons 13, siRNA SNAP-25: n 4,

neurons 11, Pr0.05; RFP: n 4, neurons 11 versus SNAP-25: n 4, neurons 12. Values are means.e.m. *Pr0.05; statistical test: Mann-Whitney

t-test. Middle and bottom panels: cumulative distribution of mEPSC amplitude (scramble: n 4 independent experiments, neurons 13 versus

siRNA SNAP-25: n 4, neurons 11, Pr0.05; RFP: n 4, neurons 11 versus SNAP-25 n 4, neurons 12, ns. Statistical test: Two-sample

KolmogorovSmirnov test).

2 NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136 ARTICLE

visualized by double immunouorescence with a FITC-secondary antibody. Over-expression of either SNAP-25D181206 or SNAP-

25D198206 led to a phenotype similar to that induced by

full-length SNAP-25, that is, increase in stubby and mushroom spines (Fig. 2b,c). To exclude that endogenous SNAP-25 could

contribute a SNARE function, co-transfection of SNAP-25D198206

in cells silenced for SNAP-25 was carried out, resulting again in an increase in stubby and mushroom spines compared to control neurons (Fig. 2b,c). Conversely, over-expression of the SNAP-25 mutant SNAP-25D86120 (Fig. 2a), which is devoid of the

a Merge Fluorochrome PSD95

GFP

Scramble+GFP

GFP

siRNA SNAP-25+GFP

siRNA SNAP-25+

RFP

RFP

RFP

RFP

SNAP-25-GFP+RFP

SNAP-25-GRP+RFP

b e

0.7

8

0

0.6

****

****

****

****

Number of PSD95

puncta per um

RFP

0.5

6

0.4

Scramble

siRNA SNAP-25

4

*

0.3

0.2

####

SNAP-25-GFP

2

0.1

siRNA SNAP-25+SNAP-25-GFP

mEPSC frequency (Hz)

0.0

0

c

#### ####

0.25

2.0

0.00

100

0

Number of filopodial

spines per um

Cumulative probabilityCumulative probability

Length of filopodial (um)

0.20

1.5

80

0.15

60

Scramble

1.0

0.10

40

siRNA SNAP-25

0.05

0.5

20

0.00

0.0

Amplitude (pA)

0.14

Number of mushroom

spines per um

****

****

**

100

0.5

0.12

0.3

Number of stubby

spines per um

80

0.4

0.10

0.08

60

RFP

0.2

0.06

40

0.04

0.1

#### ####

0.02

20

SNAP-25-GFP

Amplitude (pA)

0.0

d

Scramble+GFP

RFP

siRNA SNAP-25+GFP SNAP-25-GFP+RFP

10 pA1 s

NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 3

& 2013 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136

a b

SNAP-25-GFP

Palmitoylation sites

Palmitoylation sites

BoNT-A/E cleavage sites

BoNT-A/E cleavage sites

CCCC

CCCC

Palmitoylation sites

CCCC

C

E A

Coiled coil forming

Coiled coil forming

Coiled coil forming

RFP

1 28 82 149 206

1 28 82 149 180

1 28 82 149 197

1 28 82 149 206

120

SNAP-25181206 +RFP

BoNT-E cleavage sites

BoNT-A cleavage sites

SNAP-25181206

E

E A

Coiled coil forming

SNAP-25198206 +RFP

SNAP-25198206

Coiled coil forming

Coiled coil forming

siRNA SNAP-25+ SNAP-25198206+RFP

SNAP-2586120 SNAP-2586120+RFP

E A

Coiled coil forming

Coiled coil forming

c

0.5

0.0

****

2.5

****

Number of filopodial

spines per um

spines per um Length of filopodia (um)

0.4

2.0

0.3

1.5

0.2

1.0

0.1

0.5

0.0

0.0

0.000

****

****

0.100

0.5

**** **** ****

Number of mushroom

spines per um

****

Number of stubby

0.4

0.075

0.3

0.050

0.2

0.025

0.1

****

****

RFP

siRNA SNAP-25+SNAP-25198206

SNAP-25181206

SNAP-25198206

SNAP-2586120

Figure 2 | SNAP-25 binding to the membrane is required for its effect on spine morphology. (a) Schematic representation of the constructs used in these experiments (SNAP-25D198206 and SNAP-25D181206, lacking the SNARE function and SNAP-25D86120 lacking the ability to interact with the plasma

membrane). (b) Immunocytochemical staining of 20 DIV rat hippocampal neurons transfected with RFP or co-transfected with SNAP-25D198206 or with

SNAP-25D181206 fused to a HA tag (subsequently labelled for HA) and RFP or with SNAP-25D86120 fused to GFP and RFP. Scale bar 10 mm.(c) Quantitative analysis of lopodial, stubby and mushroom spine density and of lopodial spines length in 20 DIV rat hippocampal neurons transfected as above. RFP: n 9 independent experiments, neurons 85; SNAP-25D

181206: n 3 independent experiments, neurons 41; SNAP-25D

198206: n 3

independent experiments, neurons 42; siRNA SNAP-25 SNAP-25D

198206: n 3 independent experiments, neurons 27; SNAP-25D

86120: n 3

independent experiments, neurons 41. Values are means.e.m. Statistical test: ****Pr0.0001; one-way ANOVA followed by Bonferroni

multiple-comparison post hoc tests.

inter-helical domain of the protein controlling its localization at the plasma membrane5 (see also Supplementary Fig. S1), produced an increase in the number of lopodial spines and decrease in stubby and mushroom protrusions (Fig. 2b,c). Therefore, the effect of SNAP-25 on spine morphology relies on its ability to bind to the plasma membrane.

p140Cap regulates spine density and function. Given the SNARE function of the protein does not seem to be required for spine morphogenesis, we hypothesized that SNAP-25 may be required as a scaffolding protein to control the plasma membrane localization of protein complexes controlling spine formation. Among these proteins, p140Cap, which localizes to synapses and

4 NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136 ARTICLE

is required for spine maintenance12,13,33, is known to interact with SNAP-259. Consistently, SNAP-25 and p140Cap coimmunoprecipitated upon transfection in Human Embryonic Kidney-293 (HEK-293) cells (Supplementary Fig. S2); on the other hand, co-transfection of p140Cap and SNAP-25D141, a

SNAP-25 mutant construct lacking the N-terminal region required for binding to p140Cap9, resulted in B85% reduction of co-immunoprecipitation (Supplementary Fig. S2). When overexpressed in neuronal cultures, SNAP-25-GFP, similarly to p140Cap-GFP, was partially detectable in dendritic spines (Supplementary Fig. S3a). To investigate the possible endogenous localization of the protein in the dendritic compartment (Supplementary Fig. S3b), we used the IMARIS reconstruction (Supplementary Fig. S3c) or ground state depletion (GSD) technique (Supplementary Fig. S3d), focusing on neuronal regions receiving low axonal inputs, where SNAP-25 is predominantly localized34. Consistently, and differently from presynaptic proteins such as synaptophysin and the calcium subunit alpha 1a/CaV2.1 (ref. 35), SNAP-25 was also detected, together with p140Cap and a small amount of the SNARE Syntaxin1, in a highly puried post-synaptic density fraction (PSD) from adult rat hippocampus (Supplementary Fig. S3e)36. Staining of hippocampal neurons with SNAP-25 and p140Cap showed that the two proteins are sporadically detectable at the level of the same dendritic protrusion (Supplementary Fig. S3f). Consistently, and in line with the known interaction between SNAP-25 and p140Cap (ref. 9), coimmunoprecipitation experiments in rodent brain revealed that p140Cap and SNAP-25 are part of the same molecular complex, which also comprises PSD-95 (Supplementary Fig. S3g).

Transfection of DIV 17 rat hippocampal neurons with a cDNA coding mouse p140Cap-GFP (bearing GFP at the C-terminal)10, or a cDNA coding mouse p140Cap-NterGFP (bearing GFP at the N-terminal)13 or with pSuper Retro-p140 encoding for specic rat p140Cap shRNA37 conrmed previous results13: similarly to SNAP-25, p140Cap silencing led to a decrease in the number of stubby and mushroom spines and of PSD95 puncta13 (Fig. 3ac), while over-expression of the protein led to an increase of stubby and mushroom spines (Fig. 3a,c and Supplementary Fig. S4), as well as of PSD95 puncta (Fig. 3a,b). As a control, over-expression of human p140Cap, which is not knocked down by the rat shRNA, in neurons silenced for the endogenous protein, led to the rescue of the spine phenotype (Fig. 3ac). Electrophysiological recording showed that p140Cap knockdown recordings reduced mEPSCs frequency but had no effect on mEPSCs amplitude (Fig. 3d,e). Similarly to SNAP-25, p140Cap over-expression did not result in signicant changes in either amplitude or frequency of mEPSCs (Fig. 3d,e).

Spine remodelling requires SNAP-25 and p140Cap association. Over-expression of p140Cap in cells silenced for SNAP-25 (Fig. 4) or over-expression of SNAP-25 in cells silenced for p140Cap (Fig. 5) led to an immature spine phenotype, characterized by increased lopodial spines number and a decrease in mushroom and stubby spine numbers (Fig. 5). These data suggest that SNAP-25 and p140Cap are both necessary for the regulation of dendritic spine morphology, possibly through proteinprotein interactions.

To univocally demonstrate this possibility, we transfected primary hippocampal neurons with a p140Cap construct deleted of amino acids (aa) 649696, which are essential for binding to SNAP-25 (ref. 9) (p140CapD649696) (Fig. 4a). An increase in the

number of lopodial spines and a decrease in the number of stubby and mushroom spines were observed after transfection with p140CapD649696 (Fig. 4b,c). Transfection of hippocampal

neurons with SNAP-25D141 (Fig. 5a), a SNAP-25 mutant construct lacking the N-terminal region required for binding to p140Cap (ref. 9), led to an increase in the number of lopodial spines and a decrease of stubby and mushroom spines (Fig. 5b,c). The inability of SNAP-25D141 to bind p140Cap was demon

strated by co-immunoprecipitation assays in HEK-293 cells (Supplementary Fig. S2). These results indicate that SNAP-25 and p140Cap need to associate in order to drive a cooperative regulation of spine morphology.

p140Cap localization requires membrane binding of SNAP-25. To investigate whether SNAP-25 and p140Cap control their reciprocal localization, we carried out transfection of different constructs in Hela cells (Supplementary Fig. S1). While SNAP-25-GFP over-expressed in Hela cells colocalized with subcortical actin bres38 (Supplementary Fig. S1a, see also high magnication insert), SNAP-25D86120, which lacks the region

required for binding to the plasmamembrane, was clearly delocalized from the cell surface (Supplementary Fig. S1b, see also high magnication insert). p140Cap-myc, visualized by staining with anti myc antibodies, was concentrated around the perinuclear, putative Golgi, area (Supplementary Fig. S1c). Notably, co-transfection of SNAP-25-GFP resulted in the delocalization of p140Cap-myc from the Golgi area, leading to a more diffuse distribution of the protein (Supplementary Fig. S1d). Conversely, co-transfection of p140Cap-myc and SNAP-25D141, which lacks the p140Cap interaction domain,

did not lead to delocalization of p140Cap, which maintained instead its distribution around the nucleus (Supplementary Fig. S1e). Similar results were obtained upon co-transfection of SNAP-25 with p140Cap lacking the SNAP-25 interacting domain (Supplementary Fig. S1f). Quantitative analysis (Supplementary Fig. S1g) conrmed that, when coexpressed with SNAP-25 lacking either the plasmamembrane- or the p140Cap-interacting regions, p140Cap displayed a signicantly lower colocalization with subcortical actin. Consistently, the p140 construct lacking the SNAP-25 interacting domain displayed a reduced colocalization with subcortical actin, even if coexpressed with wt SNAP-25 (Supplementary Fig. S1g).

To investigate whether SNAP-25 controls the localization of p140Cap also in neuronal cells, the p140Cap-NterGFP (Supplementary Fig. S4) was transfected with SNAP-25 scramble or siRNA-transfected neurons (Fig. 6). Over-expression of p140Cap-NterGFP together with the SNAP-25 scramble pSuper vector construct showed the typical enrichment of p140Cap at the head of the dendritic spines13 (Fig. 6a). Conversely, over-expression of p140Cap-NterGFP in SNAP-25-silenced neurons resulted in a different localization of p140Cap, which appeared diffuse and not concentrated at the tip of the protrusions (Fig. 6b). The reduction of p140Cap localization at dendritic spines in the absence of SNAP-25 was conrmed by a quantication of the intensity of p140Cap in spines versus the dendritic shaft (Fig. 6c). Similar results were obtained when assessing the impact of SNAP-25 downregulation on the localization of endogenous p140Cap (Fig. 6df).

To further prove SNAP-25 role in the localization of p140Cap, uorescence recovery after photobleaching (FRAP) experiments were carried out (Fig. 7ac). Neurons co-transfected with p140Cap-NterGFP and silenced for SNAP-25 showed a higher mobile fraction of p140Cap, compared to controls (Fig. 7b). The higher mobility of p140Cap in neurons lacking SNAP-25 was also conrmed by examining the recovery of uorescence of p140Cap-NterGFP (Fig. 7c). Indeed, p140Cap uorescence recovers in a greater extent when p140Cap-NterGFP is transfected in cells silenced for SNAP-25 compared to cells co-transfected with a

NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 5

& 2013 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136

scramble pSuper vector construct (Fig. 7c). These results indicate a role for SNAP-25 in the formation of mature spines by localizing p140Cap.

DiscussionDendritic spines are small neuronal protrusions that regulate synaptic strength. Spines can be classied in three main types: lopodia-like protrusions (the more immature kind of spines),

stubby spines that do not present a well-dened neck and mushroom spines (the mature dendritic spines) that are characterized by a large bulbous head and a constricted neck39. Hippocampal neurons present thousands of these spines on their dendrites40.

In this study, we describe a post-synaptic role for SNAP-25 in modulating spine morphology and function. In particular, we show that reduction of SNAP-25 expression leads to a morphologically immature phenotype of dendritic spines

a

Empty vector+GFP

Merge Fluorochrome PSD95

GFP

GFP

RFP

RFP

RFP

siRNA p140Cap+GFP

RFP

p140Cap-GFP+RFP

siRNA p140Cap+ p140Cap-GFP+RFP

b

e

Cumulative probability mEPSC frequency (Hz)

Cumulative probability

**** ****

****

8

Number of PSD95

puncta per um

0.6

0.4

0.2

0.0

RFP

6

*

Empty vector

4

siRNA p140Cap

p140Cap-GFP

2

# # # #

# # # #

# # # #

siRNA p140Cap+p140Cap-GFP

0

c

spines per um Length of filopodia (um)

# # # #

100

0

0.4

0.0

2.0

Number of filopodial

spines per um

80

0.3

1.5

**

60

Empty vector

RFP

0.2

1.0

40

siRNA p140Cap

0.1

0.5

20

0.0

0.0

0

Amplitude (pA)

Amplitude (pA)

10 pA

1 s

0.14

****

****

Number of mushroom

spines per um

0.5

****

100

0.12

80

0.3

Number of stubby

0.4

0.10

0.08

60

0.2

0.06

40

p140Cap-GFP

0.04

0.1

20

0.02

# # # #

0.00

d

Empty vector+GFP

siRNA p140Cap+GFP

RFP

p140Cap-GFP+RFP

6 NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136 ARTICLE

that are, consistently, less functional. Over-expression of SNAP-25 results instead in an increase in the density of mushroom spines as well as of PSD95 puncta. The localization of SNAP-25 at the plasma membrane is essential for the protein role in controlling spine morphogenesis, thus suggesting that the protein acts as a scaffold protein that brings and/or retains other interactors to the membrane. Consistently, we demonstrate that SNAP-25 acts on spine morphology through the adaptor protein p140Cap10,37, a key protein involved in the regulation of spine morphogenesis13.

SNAP-25 has a crucial role at the presynaptic level, where it mediates synaptic vesicles fusion3,4143. Despite its key presynaptic function, the protein lacks a selective presynaptic distribution, being instead more diffusely localized throughout the neuronal plasma membrane34. Notably, a previous proteomic study demonstrated that SNAP-25 co-puries with PSD-9544. Although not univocally excluding that the presence of SNAP-25 in the PSD structure could be due to contamination from the pre-synapse, these data hint at a plausible post-synaptic localization for the protein. In line with being present also at the somatodendritic level, SNAP-25 controls calcium dynamics in the soma of cultured neurons29,45. In addition, SNAP-25 coimmunoprecipitates with the KAR subunits GluK5 and has a role in the removal of KARs from the postsynaptic membrane8. SNAP-25 phosphorylation by Protein Kinase C (PKC) is of fundamental importance for the insertion of NMDA receptors in neuronal plasma membrane7. In line with the SNARE role in postsynaptic function, amplitude of mEPSCs was reported to be reduced in the absence of SNAP-2546,47, while exogenous expression of either SNAP-25a or SNAP-25b rescued the amplitude value47. Finally, a recent report showed that down-regulation of the protein impairs potentiation phenomena48. By three-dimensional (3D) reconstruction, virtual slicing of dendritic spines in low-density cultures and GSD, which allows protein localization with a precision of up to 20 nm, we show that SNAP-25 immunoreactivity can be occasionally detected, although it is not specically enriched, in dendritic protrusions of cultured hippocampal neurons.

Our results are in line with the possibility that SNAP-25, present at the plasma membrane of nascent dendritic spines, favors p140Cap relocalization at a site where, in the presence of the appropriate molecular milieu necessary for spine formation, the process of spine morphogenesis may start. Interestingly, while lower mEPSC frequency and amplitude were recorded upon reduction of SNAP-25 expression, a signicant reduction of mEPSC frequency but not amplitude occurred in neurons in which p140Cap was downregulated. These data suggest that while reduced SNAP-25 levels impact both synaptic number and function, downregulation of p140Cap decreases the number of synapses without having major changes in the function or

maturational state of the remaining ones, as already described for other postsynaptic proteins49,50. Conversely, the lack of changes in mEPCS frequency or amplitude recorded upon either SNAP-25 or p140Cap over-expression suggests that the morphogenetic role of the two proteins may be not accompanied, at least under acute over-expression conditions, by functional effects.

SNAP-25/p140Cap may converge on different pathways to regulate spine morphology. p140Cap, which binds to the plus end of dynamic microtubules13, could promote the local reorganization of spines controlling the levels of active RhoA by decreasing Src-dependent tyrosine phosphorylation of the RhoA-specic GTPase activating protein p190RhoGAP. Through inhibiting the activity of Src kinases at dendritic spines, p140Cap may reduce the phosphorylation of critical substrates such as Cortactin13. Cortactin is a protein that is able to stabilize branched actin lament network in spines, thus leading to the formation of mature mushroom spines. Notably, cortactin activates the Actin-related protein 2/3 (Arp2/3) complex, which controls the nucleation of new actin laments, thus allowing the formation of a branched cytoskeletal network, which is necessary for spine head enlargement (reviewed by Menna et al.51, Fig. 7d). In the absence of SNAP-25, the higher mobility of p140Cap, detected by FRAP experiments, may impair p140Cap ability to organize the molecular apparatus needed for the formation of the spine. This impairment might impact the occurrence of downstream events, including inhibition of Src kinase activity, which is known to lead to spine formation13. The possibility that p140Cap controls spine head growth through Src kinase activity and regulation of cortactin and Arp2/3 complex is worthy of further investigation. It is however expected that, besides SNAP-25, additional proteins may cooperate to the local recruitment of the spine complex or compensate for it in the chronic absence of SNAP-25.

Changes in spine morphology and number have a fundamental role in cognitive functions and, indeed, several neurological disorders such as autism spectrum disorders, schizophrenia and Alzheimers disease are linked to aberrant shape and number of dendritic spines52. SNAP-25 has been associated with psychiatric diseases such as attention decit hyperactivity disorder, bipolar disorder and schizophrenia24,25,36. In addition to the role of SNAP-25 in these disorders, a decrease in SNAP-25 levels in mice decient for the synaptic vesicle protein cysteine-string protein-a (CSPa) causes a massive neurodegeneration28. Our results open therefore the possibility that SNAP-25 can have a role in these synaptopathies not only by virtue of its presynaptic function, but also by directly acting at the post-synaptic level and controlling formation and maintenance of proper spine number and morphology. Further investigations in mice models displaying reduced SNAP-25 levels will clarify this point.

Figure 3 | Effect of p140Cap silencing and over-expression on spine morphology and function. (a) PSD-95 immunocytochemical staining of 20 DIV-old rat hippocampal cultures silenced for p140Cap and transfected with GFP; transfected with p140-GFP and RFP; and silenced for rat p140 and transfected with human p140Cap-GFP and RFP; scale bar: 10 mm (scale bar insert: 2.5 mm). (b) Quantitative analysis of PSD95 puncta in 20 DIV neurons. Empty vector: n 3 independent experiments, neurons 30; siRNA p140Cap: n 3, neurons 45; RFP: n 6, neurons 45; p140Cap-GFP: n 3, neurons 32; siRNA

p140Cap p140Cap n 3, neurons 41. Values are means.e.m. Statistical test: **** and ####Pr0.0001; one-way ANOVA followed by Bonferroni

multiple-comparison post hoc tests. (c) Quantitative analysis of spine density and of lopodial spine length. Empty vector: n 4 independent experiments,

neurons 40; siRNA p140Cap: n 5, neurons 75; RFP: n 9, neurons 85; p140Cap: n 4, neurons 42; siRNA p140Cap p140Cap: n 4,

neurons 41. Values are means.e.m. Statistical test: **** and ####Pr0.0001, **Pr0.01; one-way ANOVA followed by Bonferroni multiple-comparison

post hoc tests. (d) Representative traces of mEPSC recordings from 20 DIV rat hippocampal neurons silenced for p140Cap or transfected with p140Cap. (e) Top panel: average mEPSC frequency. Empty: n 4 independent experiments, neurons 10, siRNA p140Cap: n 4, neurons 10, RFP: n 4,

neurons 11; p140Cap: n 4, neurons 15. Values are means.e.m. *Pr0.05 Statistical test: MannWhitney t-test. Middle and bottom panels:

cumulative distribution of mEPSC amplitude (empty: n 4 independent experiments, neurons 10 versus siRNA p140Cap: n 4, neurons 10, ns.

RFP: n 4, neurons 11 versus p140Cap: n 4, neurons 15, ns. Statistical test: Two-sample KolmogorovSmirnov test.).

NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 7

& 2013 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136

a b

RFP

p140Cap-GFP

Tyrosine rich region

Pro1 Coiled coil

forming 1

Pro1 CH1 Pro2 CH2

CH1 Pro2 CH2

Coiled coil forming 1

Coiled coil forming 2

p140Cap-GFP+RFP

aa

649

696

p140Cap649696 siRNA SNAP-25+

p140Cap-GFP+RFP

Tyrosine rich region

p140Cap649696+RFP

c

****

2.5

0.6

0.0

0.0

****

spines per um Length of filopodia (um)

Number of filopodial

spines per um

2.0

****

0.5

0.4

1.5

0.3

****

1.0

0.2

0.1

0.5

0.0

RFP

****

****

0.5

0.10

p140Cap-GFP

Number of mushroom

spines per um

Number of stubby

siRNA SNAP-25+p140Cap-GFP

p140Cap

0.4

0.08

0.3

0.06

0.2

0.04

0.1

0.02

**** ****

**** ****

0.00

Figure 4 | p140Cap needs SNAP-25 to affect spine morphology. (a) Schematic representation of the constructs used in these experiments (p140CapD649696 lacking the region necessary for interaction with SNAP-25). (b) Immunocytochemistry of 20 DIV rat hippocampal neurons transfected with RFP or co-transfected with RFP and p140Cap-GFP, with RFP and p140Cap-GFP and silenced for SNAP-25 or with RFP and p140CapD649696.

Scale bar: 10 mm. (c) Quantitative analysis of lopodial, stubby and mushroom spine density and of lopodial spine length in 20 DIV rat hippocampal neurons. RFP: n 9 independent experiments, neurons 85; siRNA SNAP-25 p140Cap: n 3 independent experiments, neurons 41; p140CapD

649696:

n 3 independent experiments, neurons 30. Values are means.e.m. Statistical test: ****Pr0.0001; one-way ANOVA followed by Bonferroni

multiple-comparison post hoc tests.

Methods

Ethics statement. All the experimental procedures followed the guidelines established by the Italian Council on Animal Care and were approved by the Italian Government decree No. 27/2010.

Cell cultures. Rat hippocampal neurons were established from the hippocampi of embryonic stage E18 foetal rats. The dissociated cells were plated onto glass coverslips coated with poly-L-lysine at densities of 95 cells per mm2. The cells were maintained in Neurobasal medium (Invitrogen) with B27 supplement and antibiotics, 2 mM glutamine, and glutamate (neuronal medium).

Plasmids. SNAP-25D86120 construct was generated as follows: the sequence coding for rst 84 aa with primer forward 50-ATAAGAATGCGGCCGCATGGCC GAGGACGCAGAC-30 containing the Not1 restriction site, and reverse 50-TTTGA CGGACCTAGGAAAATTCGAATTCCG-30 containing the Ecor1 site. The second fragment starting from the 121 aa until GFP tag at the C terminus of protein, was generated by amplication with primer forward 50-CGGAATTCGTGGATGAACG

GGAGCAGA-30 containing the Ecor1 site, and reverse primer 50-CAAATAATAA GGATCCAGATCTGCTG-30 containing BamHI site. After digestion, the two

fragments were inserted into modied p-EGFPN1 vector cut with Not1 and BamHI.

SNAP-25D141 was generated by cloning into the modied p-EGFPN1 vector the fragments amplied from mouse SNAP-25 cDNA with the following primers: forward 50-ATAAGAATGCGGCCGCATGGCTGGCATCAGGACTTTG-30 and reverse 50-CAAATAATAAGGATCCAGATCTGCTG-30.p140Cap-GFP tagged construct was obtained as in the study by Di Stefano et al.10 SNAP-25-GFP tagged construct was obtained as in the study by Verderioet al.29.p140CapD649696 construct was generated as follows: the rst fragment coding 1672 aa was obtained digesting the mouse p140Cap cDNA in p-EGFPN3 with HindIII and Sfb1. The second coding 730- to the end of p140Cap was obtained by digesting mouse p140Cap cDNA in p-EGFPN3with Sph1 and Sal1. The two fragments were cloned into p-EGFPN3 vector. SNAP-25D181206 and SNAP-25D198206 HA-tagged construct were obtained

as in the study by Verderio et al.29.p140Cap-Cterm GFP was generated by cloning human p140Cap cDNA10

into GFP-tagged pGW1.

Acute downregulation of SNAP-25 and p140Cap expression. Silencing of SNAP-25 was achieved via transfection of a pSUPER construct29. A nonspecic

8 NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136 ARTICLE

a

b

BoNT-A/E cleavage sites

SNAP-25-GFP

Palmitoylation sites

CCCC

E A

Coiled coil forming

Coiled coil forming

1 28 82 149 206

42 82 149 206

RFP

SNAP-25-GFP+RFP

Palmitoylation sites

BoNT-E cleavage sites

CCCC

E A

SNAP-25141

siRNA p140Cap+ SNAP-25-GFP+RFP

Coiled coil forming

Coiled coil forming

SNAP-25141+RFP

**** ****

****

c

0.5

0.0

0.0

2.5

Number of filopodial

spines per um

0.1

Length of filopodia (um)

****

0.4

2.0

0.3

1.5

0.2

1.0

0.5

0.0

****

0.100

****

Number of mushroom

spines per um

0.4

RFP

siRNA p140Cap+SNAP-25-GFP

0.075

SNAP-25-GFP

0.3

0.2

Number of stubby

spines per um

0.050

SNAP-25141

0.1

0.025

**** ****

Figure 5 | SNAP-25 needs p140Cap to affect spine morphology. (a) Schematic representation of the constructs used in these experiments (SNAP-25D141 lacking the region required for interaction with p140Cap). (b) Immunocytochemistry of 20 DIV rat hippocampal neurons transfected with RFP or co-transfected with RFP and SNAP-25-GFP, with RFP and SNAP-25-GFP and silenced for p140Cap or with RFP and SNAP-25D141. Scale bar

10 mm. (c) Quantitative analysis of lopodial, stubby and mushroom spine density and of lopodial spine length in 20 DIV rat hippocampal neurons. RFP: n 9 independent experiments, neurons 85; siRNA p140Cap SNAP-25: n 3 independent experiments, neurons 41; SNAP-25D141: n 4 independent experiments, neurons 53. Values are means.e.m. Statistical test: ****Pr0.0001; one-way ANOVA followed by Bonferroni

multiple-comparison post hoc tests.

**** ****

0.000

siRNA duplex of the same nucleotides, but in an irregular sequence (scrambled iSNAP-25 siRNA), was prepared using oligonucleotides 50-GATCCCCGAGGAG

TTATGCGATAGTATTCAAGAGAATGATAGCGTATTGAGGAGTTTTTGGA AA-30 and 50-AGCTTTTCCAAAAACTCCTCAATACGCTATCATTCTCTTGAA

TACTATCGCATAACTCCTCGGG-30 that were annealed and ligated into the pSuper vector as described previously29.

Silencing of p140Cap was achieved via transfection of a pSUPER construct. p140Cap-shRNA sequence (50-CAGCCGAAACAGACTTCAG-30) targeting rat p140Cap mRNA (nucleotides 2,7712,789) was designed based on the experimentally veried human p140Cap-shRNA sequence37. The complementary oligonucleotides were annealed and inserted into pSuper vector53.

Transfection. Neurons were transfected using Lipofectamine 2000 (Invitrogen) at DIV 1718. Cultures were analysed at DIV 2021.

Dendritic spines analysis. Images of primary hippocampal cultures were acquired with a 63 oil immersion lens (1,024 1,024 pixels). Each image consisted of a

stack of images taken through the z-plane of the cell. Confocal microscope settings were kept the same for all scans in each experiment. For spine size, the maximal length was measured with the ImageJ software programme by manually drawing a vertical line from the base of the neck to the furthest point on the spine head. On the basis of morphology, spines were classied into the following categories: (1) Thin: spines with a long neck and a visible small head; (2) Mushroom: big spines with a well-dened neck and a very voluminous head; and (3) Stubby: very short spines without a distinguishable neck and stubby appearance5456.

Colocalization analysis. Images of Hela cells were acquired with a 63 oil

immersion lens (1,024 1,024 pixels). Colocalization analysis was performed

using Imaris analysis software. For the analysis, Manders colocalization coefcient was used. This coefcient has the advantage of providing two components:the fraction of A with B and the fraction of B with A. This is quite relevant for our analysis given that our probes distribute to different kinds of cellular components.

Immunocytochemical staining. Immunouorescence staining57 was carried out using the following antibodies: SNAP-25 (1:1,000; monoclonal, Sternberger Monoclonals), PSD95 (1:400; monoclonal; UC Davis/NIH NeuroMab Facility), p140Cap plyclonal antibody was generated as in the study by Di Stefano et al.10, Phalloidin (1:250, Alexa Fluor Phalloidin 555, Invitrogen). The counterstaining of nuclei was performed with DAPI (Sigma-Aldrich). Images were acquired using a Leica SPE confocal microscope.

Co-immunoprecipitation. Brain tissues were frozen in liquid nitrogen. Brain proteins were extracted with lysis buffer (1% NP40, 150 mM sodium chloride, 50 mM TrisHCl, pH 7.5, 5% glycerol, 1 mM MgCl2, protease inhibitors (Roche,

Basel, Switzerland) and 1 mM phenylmethylsulphonyl uoride, 1 mM Na3VO4,1 mM NaF, 1 mM DTT). For immunoprecipitation assays, 5 mg of total extract were precleared and incubated overnight at 4 C with 1 mg of crosslinked antibody per mg of total protein. IPs were washed ve times with lysis buffer. IPs and 50 mg of total brain extract were resolved by reducing SDSPAGE and transferred to PVDF lters, which were incubated with the indicated antibodies and developed by using the ECL system. The following antibodies were used: p140Cap plyclonal antibody was generated as in the study by Di Stefano et al.10, HSP90 (1:1,000,

NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 9

& 2013 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136

a

p140Cap-NterGFP+ Scramble+RFP

b c

p140Cap-NterGFP+ siRNA SNAP-25+RFP

Intesity spines versus shaft

2.5

2.0

Merge

RFP

GFP

Merge

p140Cap

GFP

1.5

1.0

****

****

0.5

0.0

p140Cap-NterGFP+

Scramble+RFP

p140Cap-NterGFP+ siRNA SNAP-25+RFP

f

2.0

Intesity p140Cap

spines versus shaft

d e

1.5

Scramble+GFP

siRNA SNAP-25+GFP

1.0

0.5

0.0

Scramble+GFP

siRNA SNAP-25+GFP

Figure 6 | SNAP-25 silencing delocalizes p140Cap. (a,b) Immunocytochemistry of 20 DIV rat hippocampal neurons co-transfected with RFP, p140Cap-NterGFP and scramble pSuper vector, or with RFP, p140Cap-NterGFP RFP and pSuper vector containing nucleotides 321339 (siRNA) of rat SNAP-25. While p140Cap is enriched in dendritic spines of control neurons transfected with the scramble construct (a), neurons silenced for SNAP-25 show delocalization of p140Cap (b); Scale bar 10 mm, bottom 5 mm. (c) quantication of p140Cap-NterGFP spine targeting through the evaluation of uorescence intensity in spines versus dendritic shafts of p140Cap-NterGFP in scramble or SNAP-25 siRNA-transfected neurons. p140Cap-NterGFP scramble: n 3

independent experiments, neurons 30; p140Cap-NterGFP siRNA SNAP-25: n 3 independent experiments, neurons 30. Values are means.e.m.

Statistical test: ****Pr0.0001; unpaired Students t-test. (d,e) Immunocytochemistry of rat hippocampal neurons co-transfected with GFP and scramble pSuper vector, or with GFP and pSuper vector containing nucleotides 321339 (siRNA) of rat SNAP-25. p140Cap is enriched in dendritic spines of control neurons (d), while in neurons silenced for SNAP-25, it is delocalized in the dendritic shaft (e). Scale bar: 10 mm. (f) Quantication of endogenous p140Cap through the evaluation of uorescence intensity in spines versus dendritic shafts in scramble or SNAP-25 siRNA transfected neurons. Scramble: n 3

independent experiments, neurons 28, siRNA; SNAP-25: n 3 independent experiments, neurons 30. Values are means.e.m. Statistical test:

****Pr0.0001; unpaired Students t-test.

monoclonal; BD Bioscience), SNAP-25 (1:1,000, monoclonal; Chemicon), PSD-95 (1:4,000, monoclonal; UC Davis/NIH NeuroMab Facility). GST: homemade monoclonal antibody was raised against Glutathione S-transferase protein. Antibodies crosslinking was performed as described in the study by Meixner et al.58.

Electrophysiology. Whole-cell patch-clamp recordings of miniature EPSCs were obtained from 2021 DIV transfected hippocampal-cultured neurons. During recordings, cells were bathed in an external solution containing (in mM): 125 NaCl,5 KCl, 1.2 MgSO4, 1.2 KH2PO4, 2 CaCl2, 6 glucose, and 25 HEPES-NaOH, pH 7.4.

Tetrodotoxin l mM, Bicuculline 20 mM and AP5 50 mM (Tocris). Recording pipettes were lled with the intracellular solution containing (in mM): 130 K-gluconate,10 KCl, 1 EGTA, 10 HEPES-NaOH, 2 MgCl2, 4 MgATP and 0.3 Tris-GTP.

Recordings were performed at room temperature in voltage clamp mode at holding potential of 70 mV using a Multiclamp 700B amplier (Molecular Devices) and

pClamp-10 software (Axon Instruments, Foster City, CA, USA). Series resistance ranged from 10 to 20 MO and was monitored for consistency during recordings.

Cells in culture with leak currents 4100 pA were excluded from the analysis. Signals were amplied, sampled at 10 kHz, ltered to 2 or 3 KHz, and analysed using pClamp-10.

GSD microscopy. GSD was performed on a Leica SR GSD system. Samples were xed and stained57. GSD is a super-resolution technique that allows single-molecule localization. The collection of overlapping uorophores in the diffraction-limited image is separated to permit the detection of single dyes. This allows building a high-resolution image. In order to achieve GSD, high-power lasers are

used to transfer uorophores into long-lived dark states, a non-uorescent molecule state. As soon as single uorophores return from the dark state, new photons are recorded and localized by the system. This process is stochastic. The positions of these signals are then used by the software to reconstruct a super-resolution image with a precision up to 20 nm.

Preparation of PSD fractions. To isolate PSDs from rat hippocampus, a modication of the method of Gardoni et al.59 was used. Animals were killed and hippocampi (from 15 animals) were rapidly dissected and pooled. Homogenization was carried out in a Teon glass homogenizer (700 r.p.m.) in 4 ml g 1 of cold0.32 M sucrose containing 1 mM HEPES, 1 mM MgCl2, 1 mM NaHCO3 and0.1 mM phenylmethylsulfonyl uoride (pH 7.4) in the presence of complete sets of protease and phosphatase inhibitors. The homogenized tissue was centrifuged at 1,000 g for 10 min. The resulting supernatant was centrifuged at 3,000 g for 15 min to obtain a P2-crude membrane fraction. The P2 pellet was resuspended in2.4 ml g 1 of 0.32 M sucrose containing 1 mM HEPES, 1 mM NaHCO3 and0.1 mM phenylmethylsulfonyl uoride, overlaid on a sucrose gradient (0.851.01.2 M), and centrifuged at 82,500 g for 2 h. The synaptosomal fraction (Syn) between 1.0 and 1.2 M sucrose was removed, diluted with an equal volume of 1% Triton X-100 in 0.32 M sucrose containing 1 mM HEPES and incubated for 15 min. This solution was then spun down at 82,500 g for 30 min. The pellet (triton-insoluble fraction) was resuspended, layered on a sucrose gradient (1.01.52.1 M), and centrifuged at 100,000 g at 4 C for 2 h. The fraction between 1.5 and 2.1 M was removed and diluted with an equal volume of 1% Triton X-100 and 150 mM KCl. PSDs were collected by centrifugation at 100,000 g at 4 C for 30 min and stored at

80 C. Protein content of the samples has been quantied by using Bio-Rad

10 NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136 ARTICLE

a c

Before

0 s 600 s

****

p140Cap-NterGFP+siRNA SNAP-25

p140Cap-NterGFP+scramble+RFP

p140Cap-NterGFP+scramble (not bleached)

Time (s)

p140Cap-NterGFP+siRNA SNAP-25 (not bleached)

b

2.0 Immobile fraction

Mobile fraction

Contribution

150

1.5

100

Recovery

1.0

0.5

50

****

0.0

0 0 100 200 300 400 500 600

p140Cap-NterGFP+

Scramble+RFP

p140Cap-NterGFP+ siRNA SNAP-25+RFP

d

SNAP-25

SNAP-25

P

SNAP-25

PKC

Arp2,3

Cortactin

Actin

p140Cap

Capping proteins

KA-R

NMDA-R

Figure 7 | SNAP-25 impacts p140Cap motility. (a) Examples of the uorescence distribution and intensity of p140Cap-NterGFP before, directly after and 600 s after bleaching. (b) Average size of the mobile and immobile fractions of p140Cap-NterGFP measured by FRAP in neurons expressing SNAP-25 scramble or siRNA constructs. p140Cap-NterGFP scramble: n 3 independent experiments, neurons 30, p140Cap-NterGFP siRNA SNAP-25 n 3

independent experiments, neurons 30. Values are mean. Statistical test: ****Pr0.0001 Statistical test: two-way ANOVA followed by Bonferroni

multiple-comparison post hoc tests. (c) Averaged time traces of uorescence recovery after photobleaching for p140Cap-NterGFP in neurons transfected with scramble or SNAP-25 siRNA. Statistical test: two-way ANOVA. (d) The scheme depicts the mechanisms by which SNAP-25 contributes to postsynaptic function. SNAP-25 has a role in the removal of KARs8 and in the insertion of NMDA receptors in neuronal plasma membrane 7, both processes involving PKC. Furthermore, through the interaction with p140Cap, SNAP-25 may stabilize a postsynaptic complex including cortactin13,

Arp2,3, actin and actin capping proteins51,60, thus having a role in spine morphogenesis.

(Hercules, CA, USA) protein assay. Fifteen micrograms per sample were loaded in each lane. Western blot analysis was performed by using the following antibodies: PSD-95 (1:3,000, monoclonal; Neuromab), synaptophysin (1:3,000, monoclonal, Sigma-Aldrich), SNAP-25 (1:150,000; monoclonal, Sternberger Monoclonals), SNAP-25 (1:1,000, monoclonal; Chemicon), SNAP-25 (1:10,000, polyclonal; Synaptic Systems). p140Cap polyclonal antibody was generated as in the study by Di Stefano et al.10, alpha1A (1:500, polyclonal, Sigma-Aldrich), syntaxin 1 (1:1,000, monoclonal, Sigma-Aldrich). Western blotting was performed by means of Chemi-Doc system Image Lab software (Bio-Rad).

Fluorescence Recovery After Photobleaching. FRAP experiments were performed as in the study by Jaworski et al.13 using a FV1000-IX91 confocal microscope from Olympus. The 488-nm laser line was used for bleaching. Areas including the bleached spine were selected and the background was subtracted frame-by-frame by subtracting the average intensity of a not bleached area. Recovery was calculated using this formula: R (I (t) I (directly after

bleaching))/(I (before bleaching) I (directly after bleaching). I total spine

intensity, R recovery. Rnal the level at the end of the recording (590 s after

bleaching). Immobile fraction 1 Rnal.

NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 11

& 2013 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136

References

1. Sudhof, T. C. & Rothman, J. E. Membrane fusion: grappling with SNARE and SM proteins. Science 323, 474477 (2009).

2. Jahn, R. & Scheller, R. H. SNAREsengines for membrane fusion. Nat. Rev. Mol. Cell Biol. 7, 631643 (2006).

3. Washbourne, P. et al. Genetic ablation of the t-SNARE SNAP-25 distinguishes mechanisms of neuroexocytosis. Nat. Neurosci. 5, 1926 (2002).4. Hess, D. T., Slater, T. M., Wilson, M. C. & Skene, J. H. The 25 kDa synaptosomal-associated protein SNAP-25 is the major methionine-rich polypeptide in rapid axonal transport and a major substrate for palmitoylation in adult CNS. J. Neurosci. 12, 46344641 (1992).

5. Gonzalo, S., Greentree, W. K. & Linder, M. E. SNAP-25 is targeted to the plasma membrane through a novel membrane-binding domain. J. Biol. Chem. 274, 2131321318 (1999).

6. Catterall, W. A. & Few, A. P. Calcium channel regulation and presynaptic plasticity. Neuron 59, 882901 (2008).

7. Lau, C. G. et al. SNAP-25 is a target of protein kinase C phosphorylation critical to NMDA receptor trafcking. J. Neurosci. 30, 242254 (2010).

8. Selak, S. et al. A role for SNAP25 in internalization of kainate receptors and synaptic plasticity. Neuron 63, 357371 (2009).

9. Chin, L. S., Nugent, R. D., Raynor, M. C., Vavalle, J. P. & Li, L. SNIP, a novel SNAP-25-interacting protein implicated in regulated exocytosis. J. Biol. Chem. 275, 11911200 (2000).

10. Di Stefano, P. et al. P130Cas-associated protein (p140Cap) as a new tyrosinephosphorylated protein involved in cell spreading. Mol. Biol. Cell 15, 787800 (2004).

11. Damiano, L. et al. p140Cap suppresses the invasive properties of highly metastatic MTLn3-EGFR cells via impaired cortactin phosphorylation. Oncogene 31, 624633 (2012).

12. Ito, H. et al. Characterization of a multidomain adaptor protein, p140Cap, as part of a pre-synaptic complex. J. Neurochem. 107, 6172 (2008).

13. Jaworski, J. et al. Dynamic microtubules regulate dendritic spine morphology and synaptic plasticity. Neuron 61, 85100 (2009).

14. Ethell, I. M. & Pasquale, E. B. Molecular mechanisms of dendritic spine development and remodeling. Prog. Neurobiol. 75, 161205 (2005).

15. Tada, T. & Sheng, M. Molecular mechanisms of dendritic spine morphogenesis. Curr. Opin. Neurobiol. 16, 95101 (2006).

16. Cheng, A. et al. Involvement of PGC-1alpha in the formation and maintenance of neuronal dendritic spines. Nat. Commun. 3, 1250 (2012).

17. Harris, K. M. & Kater, S. B. Dendritic spines: cellular specializations imparting both stability and exibility to synaptic function. Annu. Rev. Neurosci. 17, 341371 (1994).

18. Hering, H. & Sheng, M. Dendritic spines: structure, dynamics and regulation. Nat. Rev. Neurosci. 2, 880888 (2001).

19. Kasai, H., Matsuzaki, M., Noguchi, J., Yasumatsu, N. & Nakahara, H. Structure-stability-function relationships of dendritic spines. Trends Neurosci. 26, 360368 (2003).

20. Lamprecht, R. & LeDoux, J. Structural plasticity and memory. Nat. Rev. Neurosci. 5, 4554 (2004).

21. Yuste, R. & Bonhoeffer, T. Morphological changes in dendritic spines associated with long-term synaptic plasticity. Annu. Rev. Neurosci. 24, 10711089 (2001).

22. Kaufmann, W. E. & Moser, H. W. Dendritic anomalies in disorders associated with mental retardation. Cereb. Cortex 10, 981991 (2000).

23. Newey, S. E., Velamoor, V., Govek, E. E. & Van Aelst, L. Rho GTPases, dendritic structure, and mental retardation. J. Neurobiol. 64, 5874 (2005).

24. Barr, C. L. et al. Identication of DNA variants in the SNAP-25 gene and linkage study of these polymorphisms and attention-decit hyperactivity disorder. Mol. Psychiatry 5, 405409 (2000).

25. Young, C. E. et al. SNAP-25 decit and hippocampal connectivity in schizophrenia. Cereb. Cortex 8, 261268 (1998).

26. Corradini, I., Verderio, C., Sala, M., Wilson, M. C. & Matteoli, M. SNAP-25 in neuropsychiatric disorders. Ann. NY Acad. Sci. 1152, 9399 (2009).

27. Etain, B. et al. A SNAP25 promoter variant is associated with early-onset bipolar disorder and a high expression level in brain. Mol. Psychiatry 15, 748755 (2010).

28. Sharma, M., Burre, J. & Sudhof, T. C. CSPalpha promotes SNARE-complex assembly by chaperoning SNAP-25 during synaptic activity. Nat. Cell Biol. 13, 3039 (2011).

29. Verderio, C. et al. SNAP-25 modulation of calcium dynamics underlies differences in GABAergic and glutamatergic responsiveness to depolarization. Neuron 41, 599610 (2004).

30. Grumelli, C., Corradini, I., Matteoli, M. & Verderio, C. Intrinsic calcium dynamics control botulinum toxin A susceptibility in distinct neuronal populations. Cell Calcium 47, 419424 (2010).

31. Huang, X. et al. Truncated SNAP-25 (1-197), like botulinum neurotoxin A, can inhibit insulin secretion from HIT-T15 insulinoma cells. Mol. Endocrinol. 12, 10601070 (1998).

32. OSullivan, G. A., Mohammed, N., Foran, P. G., Lawrence, G. W. & Oliver Dolly, J. Rescue of exocytosis in botulinum toxin A-poisoned chromafn cells by expression of cleavage-resistant SNAP-25. Identication of the minimal essential C-terminal residues. J. Biol. Chem. 274, 3689736904 (1999).

33. Hayashi, K. et al. Maintenance of dendritic spine morphology by partitioning-defective 1b through regulation of microtubule growth. J. Neurosci. 31, 1209412103 (2011).

34. Garcia, E. P., McPherson, P. S., Chilcote, T. J., Takei, K. & De Camilli, P. rbSec1A and B colocalize with syntaxin 1 and SNAP-25 throughout the axon, but are not in a stable complex with syntaxin. J. Cell Biol. 129, 105120 (1995).

35. Holderith, N. et al. Release probability of hippocampal glutamatergic terminals scales with the size of the active zone. Nat. Neurosci. 15, 988997 (2012).

36. Ovsepian, S. V. & Dolly, J. O. Dendritic SNAREs add a new twist to the old neuron theory. Proc. Natl Acad. Sci. USA 108, 1911319120 (2011).37. Di Stefano, P. et al. p140Cap protein suppresses tumour cell properties, regulating Csk and Src kinase activity. EMBO J. 26, 28432855 (2007).

38. Torregrosa-Hetland, C. J. et al. Cortical F-actin affects the localization and dynamics of SNAP-25 membrane clusters in chromafn cells. Int. J. Biochem. Cell. Biol. 45, 583592 (2013).

39. Bourne, J. N. & Harris, K. M. Balancing structure and function at hippocampal dendritic spines. Annu. Rev. Neurosci. 31, 4767 (2008).

40. Sorra, K. E. & Harris, K. M. Overview on the structure, composition, function, development, and plasticity of hippocampal dendritic spines. Hippocampus 10, 501511 (2000).

41. Lang, T. & Jahn, R. Core proteins of the secretory machinery. Handb. Exp. Pharmacol. 107127 (2008).

42. Sorensen, J. B. SNARE complexes prepare for membrane fusion. Trends Neurosci. 28, 453455 (2005).

43. Kidokoro, Y. Roles of SNARE proteins and synaptotagmin I in synaptic transmission: studies at the Drosophila neuromuscular synapse. Neurosignals 12, 1330 (2003).

44. Peng, J. et al. Semiquantitative proteomic analysis of rat forebrain postsynaptic density fractions by mass spectrometry. J. Biol. Chem. 279, 2100321011 (2004).

45. Condliffe, S. B., Corradini, I., Pozzi, D., Verderio, C. & Matteoli, M. Endogenous SNAP-25 regulates native voltage-gated calcium channels in glutamatergic neurons. J. Biol. Chem. 285, 2496824976 (2010).

46. Bronk, P. et al. Differential effects of SNAP-25 deletion on Ca2 -dependent and

Ca2 -independent neurotransmission. J. Neurophysiol. 98, 794806 (2007).

47. Delgado-Martinez, I., Nehring, R. B. & Sorensen, J. B. Differential abilities of SNAP-25 homologs to support neuronal function. J. Neurosci. 27, 93809391 (2007).

48. Jurado, S. et al. LTP requires a unique postsynaptic SNARE fusion machinery. Neuron 77, 542558 (2013).

49. Verpelli, C. et al. Importance of Shank3 protein in regulating metabotropic glutamate receptor 5 (mGluR5) expression and signaling at synapses.J. Biol. Chem. 286, 3483934850 (2011).50. Pfeiffer, B. E. & Huber, K. M. Fragile X mental retardation protein induces synapse loss through acute postsynaptic translational regulation.J. Neurosci. 27, 31203130 (2007).51. Menna, E., Fossati, G., Scita, G. & Matteoli, M. From lopodia to synapses: the role of actin-capping and anti-capping proteins. Eur. J. Neurosci. 34, 16551662 (2011).

52. Penzes, P., Cahill, M., Jones, K., VanLeeuwen, J.-E. & Woolfrey, K. Dendritic spine pathology in neuropsychiatric disorders. Nat. Neurosci. 14, 285378 (2011).

53. Brummelkamp, T. R., Bernards, R. & Agami, R. A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550553 (2002).

54. Magarinos, A. M. et al. Effect of brain-derived neurotrophic factor haploinsufciency on stress-induced remodeling of hippocampal neurons. Hippocampus 21, 253264 (2011).

55. Harris, K. M. & Stevens, J. K. Dendritic spines of CA 1 pyramidal cells in the rat hippocampus: serial electron microscopy with reference to their biophysical characteristics. J. Neurosci. 9, 29822997 (1989).

56. Peters, A. & Kaiserman-Abramof, I. R. The small pyramidal neuron of the rat cerebral cortex. The perikaryon, dendrites and spines. Am. J. Anat. 127, 321355 (1970).

57. Verderio, C., Coco, S., Fumagalli, G. & Matteoli, M. Spatial changes in calcium signaling during the establishment of neuronal polarity and synaptogenesis.J. Cell Biol. 126, 15271536 (1994).58. Meixner, A. et al. A QUICK screen for Lrrk2 interaction partners--leucine-rich repeat kinase 2 is involved in actin cytoskeleton dynamics. Mol. Cell Proteomics 10, 001172 (2011).

59. Gardoni, F. et al. Calcium/calmodulin-dependent protein kinase II is associated with NR2A/B subunits of NMDA receptor in postsynaptic densities.J. Neurochem. 71, 17331741 (1998).60. Hotulainen, P. & Hoogenraad, C. C. Actin in dendritic spines: connecting dynamics to function. J. Cell Biol. 189, 619629 (2010).

12 NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms3136 ARTICLE

Acknowledgements

We wish to acknowledge Dr Simona Rodighiero (Fondazione Filarete, Milano) for assistance with GSD experiments and Dr Andrea Doni (Humanitas) for help with FRAP experiments. We also thank Dr E Menna for discussion. The research leading to these results has received funding from the European Union Seventh Framework Programme under grant agreement no HEALTH-F2-2009-241498 (EUROSPIN project), by the Italian Ministry of Health (RF-2009-1545998) and by PRIN 2011 to M.M. and by CARIPLO (2011-0540).

Author contributions

R.T. designed and performed the bulk of the experiments, analysed the data, and wrote the paper. D.R. performed co-immunoprecipitation experiments and generated part of the mutant constructs. R.M. performed electrophysiology experiments and analysed the data. C.E. contributed to transfection experiments. F.G. and M.D.L. performed P.S.D.

fractions experiments. E.T. and P.D. designed mutant constructs and edited the manuscript. M.M. conceived and supervised the study and wrote the paper.

Additional information

Supplementary Information accompanies this paper at http://www.nature.com/naturecommunications

Web End =http://www.nature.com/ http://www.nature.com/naturecommunications

Web End =naturecommunications

Competing nancial interests: The authors declare no competing nancial interests.

Reprints and permission information is available online at http://npg.nature.com/reprintsandpermissions/

Web End =http://npg.nature.com/ http://npg.nature.com/reprintsandpermissions/

Web End =reprintsandpermissions/

How to cite this article: Tomasoni, R. et al. Snap-25 regulates spine formation through postsynaptic binding to p140cap. Nat. Commun. 4:2136 doi: 10.1038/ncomms3136 (2013).

NATURE COMMUNICATIONS | 4:2136 | DOI: 10.1038/ncomms3136 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 13

& 2013 Macmillan Publishers Limited. All rights reserved.