A random six-phase switch regulates pneumococcal virulence via global epigenetic changes

Abstract

Streptococcus pneumoniae (the pneumococcus) is the world's foremost bacterial pathogen in both morbidity and mortality. Switching between phenotypic forms (or 'phases') that favour asymptomatic carriage or invasive disease was first reported in 1933. Here, we show that the underlying mechanism for such phase variation consists of genetic rearrangements in a Type I restriction-modification system (SpnD39III). The rearrangements generate six alternative specificities with distinct methylation patterns, as defined by single-molecule, real-time (SMRT) methylomics. The SpnD39III variants have distinct gene expression profiles. We demonstrate distinct virulence in experimental infection and in vivo selection for switching between SpnD39III variants. SpnD39III is ubiquitous in pneumococci, indicating an essential role in its biology. Future studies must recognize the potential for switching between these heretofore undetectable, differentiated pneumococcal subpopulations in vitro and in vivo. Similar systems exist in other bacterial genera, indicating the potential for broad exploitation of epigenetic gene regulation.

ARTICLE

Received 19 Mar 2014 | Accepted 21 Aug 2014 | Published 30 Sep 2014

DOI: 10.1038/ncomms6055 OPEN

A random six-phase switch regulates pneumococcal virulence via global epigenetic changes

Ana Sousa Manso1,2, Melissa H. Chai3, John M. Atack4, Leonardo Furi1,2, Megan De Ste Croix1,Richard Haigh1, Claudia Trappetti3, Abiodun D. Ogunniyi3, Lucy K. Shewell4, Matthew Boitano5,Tyson A. Clark5, Jonas Korlach5, Matthew Blades6, Evgeny Mirkes7, Alexander N. Gorban7, James C. Paton3, Michael P. Jennings4,* & Marco R. Oggioni1,2,*

Streptococcus pneumoniae (the pneumococcus) is the worlds foremost bacterial pathogen in both morbidity and mortality. Switching between phenotypic forms (or phases) that favour asymptomatic carriage or invasive disease was rst reported in 1933. Here, we show that the underlying mechanism for such phase variation consists of genetic rearrangements in a Type I restriction-modication system (SpnD39III). The rearrangements generate six alternative specicities with distinct methylation patterns, as dened by single-molecule, real-time (SMRT) methylomics. The SpnD39III variants have distinct gene expression proles. We demonstrate distinct virulence in experimental infection and in vivo selection for switching between SpnD39III variants. SpnD39III is ubiquitous in pneumococci, indicating an essential role in its biology. Future studies must recognize the potential for switching between these heretofore undetectable, differentiated pneumococcal subpopulations in vitro and in vivo. Similar systems exist in other bacterial genera, indicating the potential for broad exploitation of epigenetic gene regulation.

1 Department of Genetics, University of Leicester, Leicester LE1 7RH, UK. 2 Dipartimento di Biotechnologie Mediche, Universit di Siena, 53100 Siena, Italy.

3 Research Centre for Infectious Diseases, School of Molecular and Biomedical Science, University of Adelaide, Adelaide, South Australia 5005, Australia. 4 Institute for Glycomics, Grifth University, Southport, Queensland 4215, Australia. 5 Pacic Biosciences, Menlo Park, California 94025, USA.

6 Bioinformatics and Biostatistics Analysis Support Hub, University of Leicester, Leicester LE1 7RH, UK. 7 Department of Mathematics, University of Leicester, Leicester LE1 7RH, UK. * These authors contributed equally to this work. Correspondence and requests for materials should be addressed to M.P.J. (email: mailto:[email protected]

Web End [email protected] ) or to M.R.O. (email: mailto:[email protected]

Web End [email protected] ).

NATURE COMMUNICATIONS | 5:5055 | DOI: 10.1038/ncomms6055 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 1

& 2014 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6055

hsdS creX

hsdS

hsdS hsdM hsdR

The importance of Streptococcus pneumoniae as a human pathogen has prompted intense investigation in the post genomics era, with more genome sequences available than

for most other species1. In spite of this, much remains to be elucidated regarding the molecular basis of critical virulence attributes, including the phenomenon of opacity phase variation (high frequency, reversible switching of expression)2,3. Examination of multiple genomes has failed to identify nucleotide polymorphisms or accessory regions that could be consistently associated with virulence phenotypes; however, such studies have ignored the potential of restriction-modication (RM) systems to mediate gene regulation via epigenetic changes4,5. The S. pneumoniae genome contains two Type I, three Type II and one Type IV RM systems6,7; of these, only the DpnI Type II RM system has been described in detail in the past8. One of the Type I RM systems, which we propose to name SpnD39III according to REBASE criteria, contains three co-transcribed genes: hsdR, hsdM and hsdS (coding for SpnD39III,M.SpnD39III and S3.SpnD39III); there is also a separately transcribed Cre tryrosine DNA recombinase gene and two truncated hsdS genes (S1.SpnD39III and S2.SpnD39III) downstream5,9. The actively transcribed hsdS gene contains two variable regions that encode the two target recognition domains (TRD) of S.SpnD39III, and it shares inverted repeats with the truncated hsdS genes; these truncated genes encode additional, separate alleles for both TRDs, but lack consensus hsdS 50 ends, ribosomal binding sites and promoters. The series of inverted repeat regions in the hsdS genes had been shown to enable recombination, thought to be facilitated by the CreX recombinase, potentially generating alternative hsdS variants encoding enzymes with different target specicities6,10. Similar phase variable Type I RM systems have been described in Bacteroides fragilis and Mycoplasma pulmonis11,12.

Here, we show that recombination between hsdS genes confers six different target specicities to the Type I SpnD39III RM system and that this has signicant impact on gene expression and virulence of pneumococci.

ResultsCharacterization of the SpnD39III RM system. To characterize the SpnD39III RM enzyme, we constructed mutants in the virulent pneumococcal strain D39 each expressing only one of the six possible hsdS variants (Fig. 1, Table 1). The strains are designated SpnD39IIIA-F and are characterized by a single S.SpnD39IIIA-F variant, respectively, referred to as locked strains (Fig. 1, Table 1). Mutants were constructed by deleting the truncated hsdS genes downstream of the actively transcribed locus and selecting at least one strain with a locked s.spnD39III allele for each of the six possible variants. Absence of any other mutation was conrmed by whole-genome sequencing. Single-molecule real-time (SMRT) sequencing and methylome analysis13 identied distinct N6-adenine methylation targets for each SpnD39IIIA-E variant (Table 1, Supplementary Fig. 1). Methylome data of the locked strains showed methylation in both strands of over 99% of the target sites (Table 1, Supplementary Fig. 1). On the basis of these results, each target recognition domain can be assigned to a specic sequence that it is responsible for recognizing: the amino-terminal (N-terminal) TRDs of SpnD39IIIA, IIIB and IIIE (TRD1.1) recognize CRAA; the N-terminal TRDs of IIIC and IIID (TRD1.2) recognize CAC; the carboxyl-terminal (C-terminal) TRDs of IIIA and IIID (TRD2.1) recognize CTG; the C-terminal TRDs of IIIB and IIIC (TRD2.2) recognize TTC; and the C-terminal TRDs of IIIE (TRD2.3) recognize CTT (Table 1, Fig. 1). Given the target specicities identied for SpnD39IIIA-E, we could infer the target specicity also for SpnD39IIIFP, where

the P stands for putative10. Thus, by recombination between these ve different TRDs (TRD1.1 or 1.2 and TRD2.1, 2.2 or 2.3), six different methylation specicities are possible. Three of these bipartite target sites, a distinct feature of Type I enzymes, were experimentally conrmed with restriction inhibition assays using plasmid DNA isolated from D39 strains containing lockedS.SpnD39IIIA, B or C enzymes (Supplementary Fig. 2ac). The SMRT methylome analysis of S. pneumoniae D39 also identied two active Type II RM systems (SpnD39ITCTAG[m6A]; and SpnD39IITCG[m6A]C). D39 contains a second Type I system which is non-functional through truncation of the SpnD39ORF782P gene (Table 1). However, methylome analysis of S. pneumoniae clinical isolates WCH16 and WCH43 (ref. 14) has allowed us to identify the equivalent Type I RM system with two allelic variants of which also showing a potentially phase variable methylase. This system contains variants A and B that were found to methylate the sequences G(m6A)YN6TATC and TG(m6A)N7TATC, respectively (Table 1). Examination of all available bacterial genome sequences reveals similar arrangements of hsdS genes in other genera, thus potentially allowing for similar reversible switching in other species (Supplementary Table 1)11,12.

SpnD39III target site distribution. Natural switching between the six distinct S.SpnD39III variants resulted in different numbers, positions and types of methylation sites in the D39 genome; they ranged in number from 424 sites (SpnD39IIID) to 1,029 sites (SpnD39IIIB). The expected numbers of sites, based on the

IR2L IR3L

IR1L IR3R IR2R IR1R

1.2 2.1

2.2

2.3

1.1

1.2 1.1

2.1

2.2

s.spnD39IIIA (TRD1.1, TRD2.1)

s.spnD39IIIB (TRD1.1, TRD2.2)

s.spnD39IIIC (TRD1.2, TRD2.2)

s.spnD39IIID (TRD1.2, TRD2.1)

s.spnD39IIIE (TRD1.1, TRD2.3)

s.spnD39IIIF (TRD1.2, TRD2.3)

2.3

2.2

1.1

2.2

1.2

2.1

1.2

2.3

1.1

2.3

1.2

Figure 1 | Schematic map of the SpnD39III locus and of the six alternative hsdS genes. In strain D39, the Type I RM system SpnD39III locus (upper row from right to left) includes hsdR (locus_tag SPD_0455; GenBank protein database accession code ABJ53942; REBASE SpnD39ORF782P), hsdM (SPD_0454; ABJ54850; M.SpnD39ORF454P) and hsdS (SPD_0453; ABJ53819; S3.SpnD39ORF454P), a Cre recombinase (SPD_0452; ABJ54057), a truncated hsdS0 gene with only one variable domain (SPD_0450; ABJ55250; S2.SpnD39ORF454P) and a further truncated hsdS00 gene with two variable domains (SPD_0451; ABJ54176;

S1.SpnD39ORF454P). Three series of inverted repeats (IR1 to IR3) allow for recombination. These rearrangements, exemplied by crosses between the IRs, allow formation of six different variant hsdS alleles encoding different HsdS proteins SpnD39IIIA-F. Inverted repeats are of 85 (IR1, striped), 333 (IR2, dotted) and 15 bp (IR3). The six recombinant s.spnD39IIIA-F alleles (Genbank nucleotide database accession codes KJ955483, KJ955484, KJ955485, KJ955486, KJ398403 and KJ398404) are shown below with their TRDs numbered according to Table 1.

2 NATURE COMMUNICATIONS | 5:5055 | DOI: 10.1038/ncomms6055 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2014 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6055 ARTICLE

Table 1 | RM systems of pneumococcal strain D39.

RM system name Type ORFs* Specicityw TRD Modied base

Number of sites*

Predicted no. of sites*

Difference (%)

Strand specicity (%)z

SpnD39ORF1631P (DpnI)

Type II SPD_1630-1 50-GATC-30 30-CTAG-50

7,164 7,324 2

SpnD39I (SpnD39ORF1260P)

Type II SPD_1259-60 50-TCTAGA-30 30-AGATCT-50 m6A 644 438 47y

SpnD39II|| (SpnD39ORF1079AP)

Type II SPD_1079-80 50-TCGAG-30 30-AGCTG-50 m6A 1,509 1454 4

SpnD39IIIA (SpnD39ORF454P)

Type I SPD_0450-5 50-CRAAN8CTG-30

30-GYTTN8GAC-50

1.1, 2.1 m6A 720 438 64y 66y

SpnD39IIIB Type I SPD_0450-5 50-CRAAN9TTC-30

30-GYTTN9AAG-50

1.1, 2.2 m6A 1,029 665 55y 64y

SpnD39IIIC Type I SPD_0450-5 50-CACN8TTC-30

30-GTGN8AAG-50

1.2, 2.2 m6A 641 876 27y 66y

SpnD39IIID Type I SPD_0450-5 50-CACN7CTG-30

30-GTGN7GAC-50

1.2, 2.1 m6A 428 577 26y 67y

SpnD39IIIE Type I SPD_0450-5 50-CRAAN8CTT-30

30-GYTTN8GAA-50

1.1, 2.3 m6A 1,028 665 55y 63y

SpnD39IIIFP Type I SPD_0450-5 50-CACN7CTT-30

30-GTGN7GAA-50

1.2, 2.3 m6A 796 876 9y 64y

SpnD39ORF782P Type I SPD_0782-4z not active; see below SpnD39McrBCP Type IV SPD_1108-9 not known

ORF, open reading frame; RM, restriction-modication system; TRD, target recognition domain.

Using strains WCH16 and WCH43 (ref. 14), we identied the target sites of the two possible variants of this Type I RM system to be 50-G(m6A)YN TATC-30 and 30-CTRN (m6A)TAG-50 for

S.SpnWCH16IVA (GenBank nucleotide database accession code KM030255) and 50-TG(m6A)N TATC-30 and 30-ACTN (m6A)TAG-50 for S. SpnWCH43IVB (GenBank code KM030256).

*Open reading frame (ORF) numbering and calculations are done for strain D39 (GenBank nucleotide database accession code CP000410.1).

wMethylated adenine in bold underlined.

zPercentage of sites mapping to the lagging strand of the genome (30-50 strand from start to 1,047,526 and 50-30 from 1,047,527 to end).

yDifferences were analysed by w2 analysis and found to be signicant for all values (Po0.001).

||The target site TCG(m6A)G could be associated to Spn39II due to absence of both this locus and TCG(m6A)G methylation in strain WCH43 (ref. 14).

zThe gene encoding S.SpnD39ORF782P is truncated in D39 and no methylation was detected.

nucleotide base occurrence in the D39 genome, differed signicantly from those observed, with SpnD39IIIA, SpnD39IIIB and SpnD39IIIE showing 50% more sites than predicted, and SpnD39IIIC, SpnD39IIID and SpnD39IIIF being under-represented (Table 1). Being non-palindromic, the SpnD39III sites could be mapped to one of the two strands of the genome, where the localization to one strand does not refer to the position of the site but rather to the orientation of site and RM enzyme complex. Intriguingly, we observed not only a marked preference for all SpnD39III variants to be on the lagging strand (Pearsons w2-test, Po0.001) (Supplementary Fig. 3), but also that the deviation seen between expected and observed sites mapped only to one strand of the genome, that is, overrepresented sites were overrepresented on the lagging strand and underrepresented sites were underrepresented on the leading strand (Supplementary Table 2). Furthermore, reciprocal positioning of the sites on the leading and lagging strands of the genome showed a non-random pattern for all SpnD39III sites except SpnD39IIIE (Supplementary Tables 3 and 4). These observations were not explained by the GC skew of the genome and were not observed when testing classical representatives of Type I RM families AC such as EcoK1, EcoAI and EcoR124I (Supplementary Tables 24). Interestingly, the target sites of Type III RM systems EcoP1I and EcoP15I (shown to be most active in the presence of non-co-directional, head-to-head oriented target sites)15 also showed signicant non-random distribution between strands in the genome, when tested either by nearest neighbour distribution using the ClarkEvans test, or by target site pair distribution using the KolmogorovSmirnov test (Supplementary Tables 24). Although these calculations did not allow us to draw direct conclusions on functionality, they indicated that the SpnD39III site distribution pattern had more in common with Type III RM systems, which have directional activity, than with the classical

Type I systems. An alternative conclusion could be that the observed genome-wide asymmetric localization of nucleotide signatures is associated with a functional role in replication or transcription16. Bioinformatics analysis showed no obvious association of the methylation target sites with promoters, small RNAs, genes or operons. Out of the six variants, SpnD39IIIA, SpnD39IIIB, SpnD39IIID and SpnD39IIIF showed reduced occurrence in non-coding regions (Pearsons w2-test, Po0.001).

Evaluation of SpnD39III methylation and restriction activity. To evaluate the mechanism of restriction by SpnD39III, we extracted differently methylated forms of the shuttle vector pDP28 from the locked SpnD39III strains (Supplementary Fig. 4) and retransformed these plasmids into the different locked SpnD39III strains (equivalent phage infection experiments are currently not possible due to the lack of phage capable of infecting encapsulated pneumococci). Reduced transformation efciencies, indicating restriction of incoming plasmid DNA, were only observed when transforming heterologously methylated plasmids into the SpnD39IIIB or SpnD39IIIC strains (Fig. 2ad). Importantly, the SpnD39IIIB and SpnD39IIIC sites of pDP28 are non-co-directional unlike the SpnD39IIIA and SpnD39IIID sites (Supplementary Fig. 4). These ndings add further to the novel nature of this system as the importance of non-co-directional positioning of target sites has previously only been reported for Type III RM systems4. We hypothesize that this novel observation (directional restriction activity of a Type I RM system) may be related to the peculiarity of our model test system, which is based on the integration of non-methylated single-stranded DNA into a resident rolling circle replicating plasmid during natural transformation (see also the legend of

NATURE COMMUNICATIONS | 5:5055 | DOI: 10.1038/ncomms6055 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 3

& 2014 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6055

Supplementary Fig. 4). Indeed, no restriction could be observed when transforming linear DNA with differently positioned SpnD39IIIA sites into the chromosome (Supplementary Fig. 2f), an observation that is more in line with what is expected during natural transformation17. To further test our ndings, we constructed recombinant pDP28 derivatives containing either:(i) non-co-directional SpnD39IIIA or SpnD39IIID sites, (ii) a unique SpnD39IIIB site or (iii) co-directional SpnD39IIIC sites (Supplementary Fig. 4bd). Transformation of these plasmids conrmed that, in our specic model system at least, two non-co-directional sites are needed for restriction (Fig. 2eh). It is possible therefore that the preferential co-directional site distribution in the genome (see above) could indicate a selective advantage in reducing risks of self-cleavage following switching between SpnD39III alleles.

SpnD39III-dependent changes in gene expression. To determine the global impact of the altered genomic methylation patterns that result from switching between the alternate SpnD39III specicities, we examined gene expression by RNA-seq in four of the variants (SpnD39IIIA-D). In all locked strains, changes in gene expression could be observed (the RNA-seq data have been deposited in the NCBI GEO database with accession code GSE55182). The most striking change was a downregulation (relative to all other variants) of the capsule operon in SpnD39IIIB. The polysaccharide capsule is a major pneumococcal virulence determinant18. In addition, the dexB, luxS and SPD_310 genes, which are all located close to the capsule operon in the genome, were also downregulated in SpnD39IIIB (Table 2). The reduced production of LuxS and capsular polysaccharide in the SpnD39IIIB strain were conrmed by quantitative Western blot

a b c d

Recipient SpnIIIA

Recipient SpnIIIB Recipient SpnIIIC Recipient SpnIIID

***

*** *** ***

Transformants (c.f.u. ml1 )

Transformants (c.f.u. ml1 )

103

***

103

***

103

102

Transformants (c.f.u. ml1 )

Transformants (c.f.u. ml1 )

102

Transformants (c.f.u. ml1 )

103

102

Transformants (c.f.u. ml1 )

102

101

101

101

101

SpnIIIA SpnIIIB SpnIIIC SpnIIID

pDP28 methylation

SpnIIIA SpnIIIB SpnIIIC SpnIIID

pDP28 methylation

SpnIIIA SpnIIIB SpnIIIC SpnIIID

pDP28 methylation

SpnIIIA SpnIIIB

SpnIIIA SpnIIIB

SpnIIIC SpnIIID

pDP28 methylation

pMRO1 methylation

e f g h

Recipient SpnIIIA Recipient SpnIIIB Recipient SpnIIIC Recipient SpnIIID

104 *** ***

Transformants (c.f.u. ml1 )

103

104

104

Transformants (c.f.u. ml1 )

103

103

103

102

102

102

102

101

101

101

101

SpnIIIA SpnIIIB

pMRO1 methylation

SpnIIIB SpnIIIC

pMRO3 methylation

SpnIIIB SpnIIID

pMRO2 methylation

Figure 2 | SpnD39III restriction. (ah) Restriction by SpnD39III was demonstrated by transformation of differently methylated pDP28 plasmids into strains expressing only one SpnD39III variant. Restriction was evident in strains expressing variant SpnD39IIIB (b) and SpnD39IIIC (c), which have non-co-directional target sites on pDP28 (Supplementary Fig. 4), whereas restriction was not evident in strains expressing variants SpnD39IIIA (a) or SpnD39IIID (d), which have co-directional target sites on pDP28. Graphs indicate s.d. of three independent replicates. Statistically signicant differences found using an analysis of variance Tukey test are shown. When utilizing recombinant pDP28 derivatives with two non-co-directional target sites for SpnD39IIIA (e) or SpnD39IIID (h) restriction could also be observed for these sites, whereas no restriction was observed when transforming a recombinant pDP28 with only one SpnD39IIIB site (f) or two co-directional SpnD39IIIC sites (g). ***Po0.001.

Table 2 | Differential expression in the SpnD39IIIB variant strain relative to the other SpnD39III variants*.

D39 ORF Gene Description SpnIIIA SpnIIIC SpnIIID SPD_0309 luxS LuxS S-ribosylhomocysteine lyase 4.9 4.2 3.8

SPD_0310 (unnamed) Uncharacterized protein 4.5 4.1 4.0

SPD_0311 dexB Glucan 1,6-alpha-glucosidase 3.4 4.6 4.5

SPD_0315 cps2A LCP capsule anchoring protein 4.0 4.3 4.2

SPD_0316 cps2B Tyrosine-protein phosphatase 3.1 3.2 3.1

SPD_0317 cps2C Polysaccharide transport protein 2.5 2.7 2.6

SPD_0318 cps2D Tyrosine-protein kinase 2.1 2.6 2.5

SPD_0321 cps2F Glycosyl transferase 2.3 2.7 2.6

SPD_0322 cps2G Glycosyl transferase 2.4 2.8 3.3

SPD_0323 csp2H Polysaccharide polymerase 2.2 2.6 2.9

SPD_0325 cps2J Membrane protein 2.9 3.0 3.9

SPD_0326 cps2K UDP-glucose 6-dehydrogenase 2.9 2.7 3.0

SPD_0327 cps2P UDP-galactopyranose mutase 2.6 3.3 3.9

SPD_0328 cps2L Glucose-1-P thymidylyltransferase 2.3 3.2 4.0

SPD_0330 rfbB dTDP-glucose 4,6-dehydratase 2.1 3.3 4.1

SPD_0331 rfbD dTDP-4-dehydrorhamnose reductase 2.1 3.0 3.7

SPD_0332 (unnamed) Uncharacterized protein 2.5 3.4 3.5 *Log2 fold change in gene expression as assessed by RNA-seq. Data are deposited in the NCBI GEO database with accession code GSE55182.

4 NATURE COMMUNICATIONS | 5:5055 | DOI: 10.1038/ncomms6055 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2014 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6055 ARTICLE

and capsule assay, respectively (Fig. 3b,c). In SpnD39IIIA, the blpY-SPD_0475 operon19, the sucrose regulator, and the fucose operon were signicantly downregulated, and a series of genes, including psaABC and dnaK, were upregulated relative to the other three variants tested (Table 3). SpnD39IIIC and SpnD39IIID strains did not show signicant differential regulation of any other genes with respect to the other variants under these assay conditions. No SpnD39III sites could be identied in the promoter or regulatory regions of any of the differentially regulated genes, so the exact method by which differential methylation affects gene regulation patterns in the pneumococcus remains to be elucidated (Tables 2 and 3). These data do, however, show that genetic recombination at the spnD39III locus results in a signicant impact on global gene expression patterns via epigenetic mechanisms thereby

differentiating the pneumococcus into distinct cellular phenotypes.

Phenotypic impact of SpnD39III phase variation. Certain SpnD39III alleles also impacted on colony opacity. This morphological feature is known to undergo reversible phase variation between opaque (OP) and transparent (TP) phenotypes via an unknown mechanism; the OP phenotype is preferentially associated with invasive disease and TP with carriage3. The SpnD39III-locked variant strains differed considerably in their opacity: SpnD39IIIA and SpnD39IIIE strains yielded 100% OP colonies; SpnD39IIIB 7% OP colonies; SpnD39IIIC 25% OP colonies; SpnD39IIID 59% OP colonies; and SpnD39IIIF 96% OP colonies (Supplementary Fig. 2d,e). The impact of the

a b c

*** **

***

***

* ***

150

150

Intracellular bacteria (c.f.u. ml1 )

4,000

3,000

2,000

1,000

*

LuxS production (%)

Absorbance (520 nm) (%)

100

100

50

50

0

0

0

SpnIIIA

SpnIIIB

SpnIIIC

SpnIIID

SpnIIIA

SpnIIIB

SpnIIIC

SpnIIID

SpnIIIE

SpnIIIF

SpnIIIA

SpnIIIB

SpnIIIC

SpnIIID

SpnIIIE

SpnIIIF

wt

wt

Strains Strains

wt

Strains

Figure 3 | In vitro phenotypes of SpnD39IIIA-F variant strains. (a) Phagocytosis of pneumococci by RAW 264.7 macrophages. Mean values of three independent replicates and s.d. are shown. (b) LuxS expression was assayed by quantitative western blot and the mean of quadruplicate samples are shown (in case of SpnD39E-F including two technical replicates). (c) The production of the type 2 polysaccharide capsule was quantied using an uronic acid assay and the mean and s.d. of quadruplicate samples are shown (in case of SpnD39E-F including two technical replicates). Statistical analysis of in vitro experiments (ac) was performed using one-way analysis of variance and a Tukey post-comparison test. *Po0.05, **Po0.01, ***Po0.001.

Table 3 | Differential expression in the SpnD39IIIA variant strain*.

D39 ORF Gene Description SpnIIIB SpnIIIC SpnIIID SPD_0257 Uncharacterized protein 2.4 2.2 2.6

SPD_0286 Glutathione peroxidase 2.4 2.7 2.2 SPD_0460 dnaKw Chaperone protein DnaK 2.8 2.5 2.7 SPD_0473 blpY Immunity protein BlpY 5.0 4.6 3.3

SPD_0474 Uncharacterized protein 5.6 4.8 3.1

SPD_0475 CAAX protease 5.3 4.5 2.9

SPD_0675 Uncharacterized protein 3.6 2.9 2.1

SPD_0708 Haloacid dehalogenase-like hydrolase 2.0 2.6 2.5

SPD_1256 Peptidase, U32 family protein 3.4 3.0 3.9

SPD_1307 w Uncharacterized protein 2.0 2.2 2.2

SPD_1415 Pyrimidine nucleotide sulte reductase 2.3 2.7 3.6 SPD_1452 Uncharacterized protein 2.4 2.3 2.4

SPD_1461 psaB Manganese ABC transporter, ATP binding 2.8 2.9 2.6 SPD_1462 psaC Manganese ABC transporter, permease 3.0 3.0 2.7 SPD_1463 psaA Manganese, substrate-binding lipoprotein 2.6 2.9 2.7 SPD_1535 scrR Sucrose operon repressor 2.2 2.1 2.4

SPD_1992 PTS system, IIA component 2.7 2.6 2.4

SPD_1993 fucU L-fuculose transport protein 2.2 2.6 2.2

SPD_1994 fucA L-fuculose phosphate aldolase 2.2 2.5 2.0

SPD_1995 fucK L-fuculose kinase FucK 2.4 2.6 2.4

sRNA_F26 RNA downstream livJ 2.4 2.2 2.3 sRNA_SN46 RNA upstream pcpA 2.4 3.5 2.5

Data are deposited in the NCBI GEO database with accession code GSE55182.

*Log2 fold change in gene expression as assessed by RNA-seq.

wA SpnD39IIIA site maps in a non-coding RNA preceding the gene.

NATURE COMMUNICATIONS | 5:5055 | DOI: 10.1038/ncomms6055 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 5

& 2014 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6055

distinct SpnD39III variant methylation patterns was therefore investigated in murine models of nasopharyngeal colonization and invasive disease. The locked SpnD39IIIA, unlike the other variants or the D39 wild type, was unable to stably colonize the nasopharynx (Fig. 4ac; Supplementary Fig. 5). In contrast, during invasive infection, those mice infected with the locked SpnD39IIIB had lower bacterial counts in their blood at both 4 and 30 h after challenge than mice infected with the strains expressing the other SpnD39III variants (Fig. 4d,e). At a later time-point, the locked SpnD39IIIE and SpnD39IIIF strains also showed lower virulence in this model (Fig. 4d,e). The lower virulence of SpnD39IIIB is consistent with the lower capsule expression seen in the gene expression studies (Table 2 and

Fig. 3c). Strains expressing SpnD39IIIB also showed an increased susceptibility to phagocytosis by macrophages (Fig. 3a). Animals challenged with SpnD39IIIA yielded almost exclusively OP colonies when bacteria were isolated 30 h post challenge, while animals challenged with SpnD39IIIB yielded mostly TP colonies under the same conditions (Fig. 4f). Thus, differences in opacity can be correlated with specic SpnD39III-locked-allele type; SpnD39IIIA yielded mainly opaque colonies, showed high virulence and therefore poor colonization capacity, whereas SpnD39IIIB yielded mainly transparent colonies and had low systemic virulence. It can therefore be concluded that SpnD39III-mediated epigenetic modication signicantly impacts on both opacity phenotype and virulence.

a b c

1 Day

3 Days

7 Days

*

*

*

*** *

104

104

104

* *

***

Carriage (c.f.u. per lavage)

Carriage (c.f.u. per lavage)

103

103

103

102

Carriage (c.f.u. per lavage)

102

102

101

101

101

10 wt SpnIIIA SpnIIIB SpnIIIC SpnIIID

0

100

100

wt SpnIIIA SpnIIIB SpnIIIC SpnIIID

Strains

wt SpnIIIA SpnIIIB SpnIIIC SpnIIID

Strains

Strains

d e f

4 h

Strains

30 h

***

108 *

1012 * * *

100

Opaque colonies in blood (%)

1010

Bactermeia (c.f.u. ml1 )

Bactermeia (c.f.u. ml1 )

106

75

108

104

106

50

104

102

25

102

0

100

100

SpnIIIA

SpnIIIB

wt

wt

wt

SpnIIIC

SpnIIID

SpnIIIE

SpnIIIF

SpnIIIA

SpnIIIB

SpnIIIC

SpnIIID

SpnIIIE

SpnIIIF

SpnIIIA

SpnIIIB

SpnIIIC

SpnIIID

SpnIIIE

SpnIIIF

Strains

Strains

g h

100

100

***

75

75

***

Prevalence (%)

50

Prevalence (%)

50

25

25

0

0

SpnIIIA

SpnIIIB

SpnIIIC

SpnIIID

SpnIIIE

SpnIIIF

SpnIIIA

SpnIIIB

SpnIIIC

SpnIIID

SpnIIIE

SpnIIIF

Allele

Allele

Figure 4 | In vivo phenotypes of SpnD39IIIA-F variant strains. D39 wt or derivatives expressing only a locked SpnD39IIIA to SpnD39IIIF variant were used in these experiments. Carriage experiments were performed by intranasal inoculation of 5 104 pneumococci into BALB/c mice, which are

resistant to invasive infection. (ac) The extent of carriage was evaluated by nasal lavage at day 1 (a), day 3 (b) and day 7 (c). (d,e) In the invasive disease model, susceptible CD1 mice received an intravenous challenge of 1 105 pneumococci, and blood samples were taken at 4 and 30 h post challenge.

Statistical signicance of differing bacterial load in D39 wt or SpnD39III variant infected mice was calculated on log-transformed data using the unpaired (two-tailed) t-test. (f) Blood samples plated directly onto catalase agar plates were examined and the percentage of opaque colonies observed for each SpnD39III variant strain. (g,h) Allele quantication in D39 wt was performed on DNA extracted from the nasal lavages of the carriage experiment (see also Supplementary Table 5) or on DNA extracted from colonies grown from blood samples in the invasive disease experiment and SpnD39III variant percentages for each are represented respectively in g (inoculum black, 1 day grey, 3 days white, and 7 days striped) and h (inoculum black, 4 h grey and 30 h white). *Po0.05, **Po0.01, ***Po0.001.

6 NATURE COMMUNICATIONS | 5:5055 | DOI: 10.1038/ncomms6055 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2014 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6055 ARTICLE

Quantication of SpnD39III subpopulations. To determine whether genetic switching at the spnD39III locus and the consequent differential epigenetic modication was selected for in vivo, we analysed the frequencies of the various spnD39III alleles in wild-type pneumococci during infection using a wild-type D39 strain in which the SpnD39III locus is free to switch between the six different allele variants. We developed a uorescent GeneScan assay (fragment length analysis) using PCR followed by restriction digest of the products, specically for this purpose, which allows the simultaneous identication and quantication of all six alleles within the bacterial population (an example of the methodology, and exemplar results are shown in Supplementary Fig. 6ac; verication of this method is shown in Supplementary Fig. 6d,e). The D39 inoculum that was used to challenge mice intravenously (Fig. 4d,e) was found to be predominantly spnD39IIIE (12% spnD39IIIA, 13% spnD39IIIB, 4% spnD39IIID and 71% spnD39IIIE; Fig. 4h). In contrast, the pneumococci reisolated from mice showed a clear change in their SpnIIID39 allele type, with samples at 4 and 30 h after challenge having changed to a predominantly SpnD39IIIA state (Fig. 4h), clearly indicating selection for specic spnD39III alleles during infection20. Most striking was the change away from SpnIIID39E to SpnIIID39A in all of the blood samples from mice infected with the SpnD39IIIE-dominated inoculum. This suggests a denitive selection for the SpnD39IIIA allele in blood even as early as 4 h after challenge. Variations in allele frequency compared with inoculum were not detected in nasopharyngeal samples from the carriage experiment (Fig. 4g), indicating there is no such selection for alternate SpnD39III alleles in this environment. For these data, we conrmed that when allele quantication was performed directly on all nasal lavage samples, it yielded substantially the same allele composition as when testing rst passage bacterial colonies grown from these samples (Supplementary Table 5).

DiscussionHere, we have described a genetic switch that results in the presence of six different bacterial subpopulations each with distinct Type I RM target specicities and distinct epigenetic proles. Such switchable Type I systems have previously been described, but these reports did not provide evidence for differential methylation or for phenotypic impact6,11,12. The SpnD39III system is distinct from the absolute ON/OFF switching of the Type III RM regulatory systems described in Gram-negative bacterial pathogens that switch between methylated and unmethylated states21; however, it does t the denition of a phase variable regulon (phasevarion)4,22. Importantly, the pneumococcal subpopulations identied in the present study exhibit phenotypic changes, including opacity phase variation differences, which have a major impact on bacterial virulence. This system provides a contingency mechanism for adaptation to changing environments21, such as those that are encountered during progression from asymptomatic colonization to invasive pneumococcal disease. Indeed, the SpnD39III system appears to be a central regulatory mechanism governing the tness of the pneumococcus in distinct host niches. Since the spnD39III allele composition of a pneumococcal population signicantly inuences important phenotypes, and can also change rapidly, it is essential that all previous and future in vitro and in vivo studies should be interpreted in the context of this potential for switching between these heretofore undetected and uncharacterized differentiated pneumococcal subpopulations. We believe these ndings represent a new paradigm in gene regulation in bacteria and therefore are of great signicance to the infectious disease eld.

Methods

Nomenclature of the RM systems identied. The well-described pneumococcal enzyme DpnI, originally clonded from a non-encapsulated D39 derivative23,24, will be named in this paper SpnD39ORF1631P (Table 1), to comply with current practice to use for each strain producing restriction enzymes an unique acronym. The other two Type II RM systems are annotated in the genome sequence ofS. pneumoniae strain R6 (GenBank nucleotide database accession code AE007317) as SpnI (Restriction Enzyme database (REBASE) annotation SpnD39ORF1260P) and SpnII (REBASE annotation SpnD39ORF1079AP)7. This led us to annotate the phase variable Type I RM system as SpnD39III (SpnD39ORF454P) (GenBank accession codes KJ955483-6 and KJ398403-4). Wherever possible, we have followed the nomenclature outlined in the REBASE for S. pneumoniae D39 (ref. 9). Recombinant variants of the specicity subunit S.SpnD39III will be referred to using the sufx AF. The second Type I RM system of D39 is not functional and since we have characterized it in strains WCH16 and WCH43, we have named the relevant variants S.SpnWCH16IVA (GenBank accession code KM030255) and SpnWCH43IVB (GenBank accession code KM030256). For the Type IV RM system, the only one currently without proven function, we have maintained the denomination SpnD39McrBCP already in REBASE9.

Ethics statement. Animal experiments performed in Italy were approved by the Comitato Etico dellAzienda Ospedaliera Universitaria Senese (Ethics Committee of the University Hospital of Siena, Siena, Italy). The animal experiments performed in Australia were approved by the University of Adelaide Animal Ethics Committee. The animal experiments performed in the UK were approved by the University of Leicester Ethics Committee in accordance with the U.K Home Ofce. All experiments were done in accordance with respective national and institutional guidelines.

Bacterial strains and growth conditions. All pneumococcal strains were derived from strain D39 (serotype 2) and were routinely cultured on Tryptic Soy Broth agar plates with 3% v/v debrinated horse blood at 37 C in a 5% CO2 incubator. For colony morphology, the analysis plates contained 200 U ml 1 of catalase (Sigma,

Germany) instead of blood. E. coli DH5a cells were grown according to standard protocols. The StreptococcusE. coli shuttle vector pDP28 (GenBank accession code KJ395591) (ref. 25) was selected in E. coli using 10 mg ml 1 of chloramphenicol (Sigma) and in pneumococci using 5 mg ml 1 of erythromycin (Sigma).

Construction of mutants. Recombinant D39 derivatives included a series of strains which stably expressed only one of the six spnD39III variants (spnD39IIIAF) with a deletion of the truncated hsdS genes (S1.SpnD39III and S2.SpnD39III). Strains carrying either pDP28 (GenBank accession code KJ395591) or its derivatives pMRO1, pMRO2, or pMRO3 (see below) were derived from the SpnD39IIIAD variant strains. All pneumococcal mutants were made following a multi-layer plating protocol for transformation as described elsewhere26. The SpnD39III variants were originated by transforming PCR generated fragments into naturally competent pneumococcal cells. In brief, anking segments of the gene to be deleted were amplied with primers having 20 bp tails complementary to an add9 spectinomycin resistance cassette. Reamplication of the anking fragments together with the resistance cassette allowed synthetic constructs to be produced by PCR. Following transformation, representative transformants, selected using200 mg ml 1 of spectinomycin (Sigma), were chosen. To construct pneumococcal mutants, the primers used included: 50-GCAGTCTAAGCCATCAAATAC-30 and 50-GATCCACTAGTTCTAGAGCTTTCTGCCTGTAATTGTTCATC-30 for the upstream anking segment; 50-GTATCGCTCTTGAAGGGAACACTTCGGCGAT TTTCTGA-30 and 50-CGTGCGGTGGAATTTCTAT-30 for the downstream anking segment for the spnD39IIIA and spnD39IIID variants; 50-GTATCGCTC TTGAAGGGAAGAGCATGTAGAAATCGGTTAT-30 and 50-TAATGCTTAAAT CGCCCTTCT-30 for the downstream anking segment for the spnD39IIIB and spnD39IIIC variants; 50-GGTGTTAGAATTATACGTGGTGG-30 and 50-GTATC GTCTTGAAGGGAACATTAAATAGTACCAGTATCTCCG-30 for the downstream anking segment for the spnD39IIIE and spnD39IIIF variants; 50-GTATCGCTCTTGAAGGGAAGCCATCGTTTGGTCTACTAAGATGT-30 and 50-AGCATATCGCTTACGAAGAATACTT-30 for the downstream anking segment for the SpnD39III deletion mutant; and 50-GCTCTAGAACTAGTGG ATC-30 and 50-TTCCCTTCAAGAGCGATAC-30 for the aad9 cassette. Constructs were conrmed by Sanger sequencing and in the case of the SpnD39IIIA-D variant strains also by whole-genome Illumina sequencing (Institute of Applied Genomics, Udine, Italy). The sequences of the spnD39III loci in the locked mutant strains have been deposited in the GenBank nucleotide database with accession codes KJ955483 to KJ955486, KJ398403 and KJ398404). For construction of pDP28 derivatives the plasmid was originally extracted from E. coli strain DH5a (HiSpeed Plasmid

Purication, Qiagen). Site-directed mutagenesis by inverted PCR was performed on pDP28 using primers 50-CACCAAATGTAGCACCTGAAAGCAAATTCGACCC

GGT-30 and 50-CAGGTGCTACATTTGGTGCCGCTTATTATCACTTATTC AGG-30 to construct pMRO1, primers 50-CACCACGGTCACACTGAAAGCAAA TTCGACCCGGT-30 and 50-CAGTGTGACCGTGGTGCCGCTTATTATCACTT ATTCAGG-30 to construct pMRO2 and primers 50-CCAGAACCTCTTACGTG GGTTCCAACTTTCACCATAATG-30 and 50-CACGTAAGAGGTTCTGGGCCG

NATURE COMMUNICATIONS | 5:5055 | DOI: 10.1038/ncomms6055 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 7

& 2014 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6055

ATCAACGTCTCATT-30 to construct pMRO3. The modied plasmids were then transformed into E. coli by standard methods.

Transformation of pneumococci. Transformation experiments to demonstrate methylation and restriction were performed using the same transformation protocol as above26. Plasmid pDP28 (extracted from E. coli DH5a as above) and its derivatives pMRO01, pMRO02 and pMRO03 (Supplementary Fig. 4) were transformed into pneumococcal variant strains SpnD39IIIA-D. Plasmids were then reextracted using an alkaline lysis protocol, as described elsewhere27, and each retransformed into the locked strains. The quantity of plasmid used for transformation was 10 ng of plasmid DNA for 100 ml of competent cells.

To test chromosomal insertion of linear PCR fragments during transformation (Supplementary Fig. 2f), the mutant gene SPD_0661 containing a kanamycin cassette (aphIII) (ref. 28) was amplied using the primers 50-CGGTAAGGCTTTG

ATGGTAGTTA-30 and 50-GGTTTACCTTCAAGACTTACTGTG-30. This fragment contained one SpnD39IIIA recognition site. Modied fragmentswere constructed with two SpnD39IIIA sites in all the possible orientations: co-directional, non-co-directional in tail-to-tail orientation and non-co-directional in head-to-head orientation. This mutagenesis was performed using the primers 50-CGAATGTAGCACCTGAGCTGGGGATCCGTTTGAT-30 and 50-CAGGT

GCTACATTCGTGAACCTGAGATAATCCCTACG-30 for co-directional site orientation, 50-CAGGTGCTACATTCGAGCTGGGGATCCGTTTGAT-30 and 50-CGAATGTAGCACCTGTGAACCTGAGATAATCCCTACG-30 for tail-to-tail sites and 50-CAGGTGCTACATTCGGCCTACGAGGAATTTGTATCTTC-30 and 50-CGAATGTAGCACCTGGCTCGGGACCCCTATCTAGCGA-30 for head-to-head oriented sites. The quantity of PCR DNA used for transformation was 100 ng of DNA for 100 ml of competent cells and transformants were selected with500 mg ml 1 of kanamycin.

Allele quantication. The variant alleles of hsdS in wild-type D39 were quantied utilizing an allele scan protocol (Supplementary Fig. 6). The whole hsdS locus was PCR amplied (4.2 kb) from extracted genomic DNA utilizing primers 50-

CCATTATCTATAGGCGTATTTTTACG30- and FAM50-GGAAACTGAGA TATTTCGTGGTG-30 (where FAM is 6-uorescein amidite). The PCR products were then digested with both DraI and PleI (New England Biolabs, MA, USA). This digestion was predicted to yield different sized FAM-labelled fragments for each of the variant forms. The pool of restriction fragments was run on an ABI prism Gene Analyser (Life Technologies). The area of the peak given by each labelled fragment, each corresponding to the prevalence of one of the variant forms, was quantied using Peak Scanner v1.0.

Genome and gene expression analysis. The genomic analysis that allowed the identication of the SpnD39III system was performed using Artemis Comparison Tool utilizing S. pneumoniae D39 (GenBank nucleotide database accession code NC_008533.1) and TIGR4 (accession code NC_003028.3) genome sequences. Whole-genome sequencing was performed for strains SpnD39IIIA-D (Institute of Applied Genomics, Udine, Italy) using an Illumina Genome Analyzer II platform (Illumina, San Diego, CA). Analysis of these sequences was performed using the programs FastQC for analysis of the quality of the reads, Trimmomatic (version0.30) DynamicTrim for quality improvements, Mosaik and SamTools for alignment and VarScan for detection of SNPs, insertions and deletions. For gene expression, pneumococcal strains were grown to mid-log phase (OD590 approximately 0.15). 2 ml of cells were harvested by centrifugation at 10,000 r.p.m. for 15 min and resuspended in 90 ml of TE with 10 ml of lysozyme. The NucleoS-pinRNA II kit (Macherey-Nagel, Germany) was used for RNA extraction following the manufacturers protocol. Frozen RNA samples were sent to the Institute of Applied Genomics (University of Udine, Italy) for RNA-seq analysis using an Illumina Genome Analyzer II platform (Illumina). RNA-Seq fastq les were trimmed using ERNE, read mapping to the reference genome D39 was performed using Tophat, and transcript abundance and differential expression analyses were carried out using Cufinks and the R package cummeRbund. Three independent replicas were used for each sample. The RNA-seq data were deposited in the NCBI GEO database with accession code GSE55182.

Methylome analysis. DNA was extracted from overnight cultures in TSB from each of the different variants using the High Pure PCR Template Preparation kit (Roche, Italy) and sent to Pacic Biosciences (Menlo Park, CA, USA) where methylome data was obtained by SMRT. SMRTbell libraries were prepared as previously described29. Briey, gDNA was sheared to an average length of approximately 10 kb using g-TUBEs (Covaris, Woburn, MA, USA), treated with DNA damage repair mix, end repaired and ligated to hairpin adapters. Incompletely formed SMRTbell templates were digested using Exonuclease III (New England Biolabs) and Exonuclease VII (Affymetrix, OH, USA). Sequencing was carried out on the PacBio RS II (Menlo Park, CA, USA) using standard protocols for long insert libraries. Methylation sites of variants SpnIIIA-C were experimentally conrmed by protection of pDP28 DNA from digestion by methylation sensitive enzymes with overlapping target specicity. Plasmid DNA for these experiments was extracted from strains expressing a single SpnD39III variant and shown by SMRT sequencing to methylate one single SpnD39III target.

When extracted from pneumococcal strains, a manual protocol of alkaline lysis was used. Plasmid pDP28 was originally extracted from an E. coli DH5a strain using the HiSpeed Plasmid Midi Kit from Qiagen (Italy). Enzymes used included AcuI (50-CTGAAG-30) whose target sites can overlapp SpnIIIA target sites; SfuI (50-TTCGAA-30), overlapping SpnIIIB; and BsaA1 (50-TACGTG-30), overlapping SpnIIIC (all from Fermentas, Germany). Protection from cleavage was visualized on ethidium bromide stained agarose gels.

Uronic acid quantication. Pneumococcal capsule samples were prepared as previously described30. In brief, deoxycolate-lysed pneumococci were treated by adding 100 U of mutanolysin (Sigma, Australia), 50 U DNaseI (Roche, Australia) and 50 mg RNaseA and incubating overnight at 37 C, followed by treatment with 100 mg of proteinase K at 56 C for 4 h. Uronic acid was then quantitated colourimetrically, as described previously30.

Quantitative western blot. Relative expression of LuxS was determined by quantitative western blot analysis of whole-cell lysates. The total protein in the lysates was determined using the BCA Protein Assay kit (Thermo Scientic, Australia). Bands on western blots were detected uisng anti-LuxS polyclonal murine antiserum at a dilution of 1:2,000 and donkey anti-mouse IRDye 800 CW secondary antibody (LI-COR Biosciences, USA) at a dilution of 1:50,000. The blot was scanned and LuxS expression was quantied using the Odyssey Infrared Imaging System (LI-COR Biosciences).

Macrophage phagocytosis. Standard phagocytosis assays were performed as previously described31. Spleen and bone marrow macrophages were isolated from mice using a modied protocol20. RAW 264.7 were cultured in RPMI medium (Dened Hyclone, Logan, UT, USA) supplemented with 10% heat inactivated fetal calf serum. At conuence of 90%, 0.1 ml of pneumococcus cultured to OD590 0.25 were added. After 45 min plates were washed and reincubated with 10 mg l 1 of penicillin and 200 mg ml 1 of gentamicin (Sigma, Germany) for 30 min. Intracellular bacteria were enumerated after lysis with saponin 1%.

Experimental infections. Carriage experiments for variants SpnD39IIIA-D were performed in Siena, Italy, with mice from Charles River (Italy). To evaluate nasopharyngeal carriage, 15 groups of ve female, 7 weeks old, BALB/c mice (resistant to systemic pneumococcal infection) were infected intranasally (5 104

c.f.u. in 10 ml PBS)32. Pneumococcal strains included the D39 wild type and the strains expressing a single SpnD39III variant (SpnD39IIIA, SpnD39IIIB, SpnD39IIIC or SpnD39IIID). At the time of killing (days 1, 3 and 7), nasal lavages were performed. An equivalent protocol was followed for variants SpnD39IIIE and F (using wild-type D39 as control), when performing intranasal infection at the University of Leicester, UK, using groups of ve female, 9 weeks old, BALB/c mice supplied by Harlan (Bicester, UK). For the invasive disease model, performed in Adelaide, Australia, female outbred 6-week-old CD-1 mice were inoculated intravenously with 1 105 c.f.u. of the same pneumococcal strains as above (100 ml

inoculum)33,34. Groups of 12 mice were inoculated for each strain and blood was collected by cheek bleeding at 4 and 30 h post infection. At 30 h, spleen, brain and liver samples were also taken. Statistical signicance was calculated on log-transformed data using the unpaired (two-tailed) t-test.

Mathematical analysis of target site distribution. Comparison of number of target sites (markers): by using nucleotide frequencies, we can estimate the expected number of each marker using the assumption that nucleotides are distributed independently (that is, the probability of nding a specic nucleotide in a specied position does not depend on nucleotides in other positions). We tested the signicance of the differences between expected and observed numbers for each marker site in both strands and in each strand separately by w2-test. To analyse the positional relationship between markers, we compared the empirical distribution of distances with the uniform distribution for relatively small distances (less than half of the average distance). For this comparison, we calculated the cumulative distribution function for distances at the selected scale and used the Kolmogorov Smirnov test35. For the distances between the markers situated in different strands, we used several samplings: the distances from the marker in the leading strand to the downstream marker in the lagging strand (tail-to-tail), the distances from the marker in the leading strand to the upstream marker in the lagging strand (head-to-head) and the distances between markers in different strands, for both tail-to-tail and head-to-head orientations (bidirectional). If the empirical cumulative density signicantly exceeded the corresponding uniform distribution at the selected scale, then we concluded that the markers demonstrated attraction over the short distance (prevalence of short distances). For additional validation of this test, we use direct simulation. We also applied the ClarkEvans test36 and compare the average distance to the nearest neighbours with the average for Poisson distribution (that is 1/(2r), where r is the density of markers) with the proper modication for oriented pairs of markers in different strands.

8 NATURE COMMUNICATIONS | 5:5055 | DOI: 10.1038/ncomms6055 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2014 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6055 ARTICLE

References

1. Donati, C. et al. Structure and dynamics of the pan-genome of Streptococcus pneumoniae and closely related species. Genome Biol. 11, R107 (2010).

2. Webster, L. T. & Clow, A. D. Intranasal virulence of pneumococci for mice.J. Exp. Med. 58, 465483 (1933).3. Weiser, J. N., Austrian, R., Sreenivasan, P. K. & Masure, H. R. Phase variation in pneumococcal opacity: relationship between colonial morphology and nasopharyngeal colonization. Infect. Immun. 62, 25822589 (1994).

4. Srikhanta, Y. N., Fox, K. L. & Jennings, M. P. The phasevarion: phase variation of type III DNA methyltransferases controls coordinated switching in multiple genes. Nat. Rev. Microbiol. 8, 196206 (2010).

5. Loenen, W. A., Dryden, D. T., Raleigh, E. A. & Wilson, G. G. Type I restriction enzymes and their relatives. Nucleic Acids Res. 42, 2044 (2014).6. Tettelin, H. et al. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293, 498506 (2001).

7. Hoskins, J. et al. Genome of the bacterium Streptococcus pneumoniae strain R6.J. Bacteriol. 183, 57095717 (2001).8. Lacks, S. A., Mannarelli, B. M., Springhorn, S. S. & Greenberg, B. Genetic basis of the complementary DpnI and DpnII restriction systems of S. pneumoniae: An intercellular cassette mechanism. Cell 46, 9931000 (1986).

9. Roberts, R. J., Vincze, T., Posfai, J. & Macelis, D. REBASE-a database for DNA restriction and modication: enzymes, genes and genomes. Nucleic Acids Res. 38, D234D236 (2010).

10. Fuller-Pace, F. V., Bullas, L. R., Delius, H. & Murray, N. E. Genetic recombination can generate altered restriction specicity. Proc. Natl Acad. Sci. USA 81, 60956099 (1984).

11. Cerdeno-Tarraga, A. M. et al. Extensive DNA inversions in the B. fragilis genome control variable gene expression. Science 307, 14631465 (2005).

12. Dybvig, K., Sitaraman, R. & French, C. T. A family of phase-variable restriction enzymes with differing specicities generated by high-frequency gene rearrangements. Proc. Natl Acad. Sci. USA 95, 1392313928 (1998).

13. Fang, G. et al. Genome-wide mapping of methylated adenine residues in pathogenic Escherichia coli using single-molecule real-time sequencing. Nat. Biotechnol. 30, 12321239 (2012).

14. Mahdi, L. K., Ogunniyi, A. D., LeMessurier, K. S. & Paton, J. C. Pneumococcal virulence gene expression and host cytokine proles during pathogenesis of invasive disease. Infect. Immun. 76, 646657 (2008).

15. Meisel, A., Bickle, T. A., Kruger, D. H. & Schroeder, C. Type III restriction enzymes need two inversely oriented recognition sites for DNA cleavage. Nature 355, 467469 (1992).

16. Lobry, J. R. & Louarn, J. M. Polarisation of prokaryotic chromosomes. Curr. Opin. Microbiol. 6, 101108 (2003).

17. Johnston, C., Martin, B., Granadel, C., Polard, P. & Claverys, J. P. Programmed protection of foreign DNA from restriction allows pathogenicity island exchange during pneumococcal transformation. PLoS Pathog. 9, e1003178 (2013).

18. Avery, O. T. & Dubos, R. The protective action of a specic enzymeagainst type III pneumococcus infection in mice. J. Exp. Med. 54, 7389 (1931).

19. King, S. J. et al. Phase variable desialylation of host proteins that bind to Streptococcus pneumoniae in vivo and protect the airway. Mol. Microbiol. 54, 159171 (2004).

20. Gerlini, A. et al. The role of host and microbial factors in the pathogenesis of pneumococcal bacteraemia arising from a single bacterial cell bottleneck. PLoS Pathog. 10, e1004026 (2014).

21. Moxon, R., Bayliss, C. & Hood, D. Bacterial contingency loci: the role of simple sequence DNA repeats in bacterial adaptation. Annu. Rev. Genet. 40, 307333 (2006).

22. Srikhanta, Y. N., Maguire, T. L., Stacey, K. J., Grimmond, S. M. & Jennings, M.P. The phasevarion: a genetic system controlling coordinated, random switching of expression of multiple genes. Proc. Natl Acad. Sci. USA 102, 55475551 (2005).23. Lacks, S. A., Mannarelli, B. M., Springhorn, S. S. & Greenberg, B. Genetic basis of the complementary DpnI and DpnII restriction systems of Streptococcus pneumoniae - an intercellular cassette mechanism. Cell 46, 9931000 (1986).

24. de la Campa, A. G., Springhorn, S. S., Kale, P. & Lacks, S. A. Proteins encoded by the DpnI restriction gene cassette. Hyperproduction and characterization of the DpnI endonuclease. J. Biol. Chem. 263, 1469614702 (1988).

25. Oggioni, M. R., Iannelli, F. & Pozzi, G. Characterization of cryptic plasmids pDP1 and pSMB1 of Streptococcus pneumoniae. Plasmid 41, 7072 (1999).

26. Iannelli, F. & Pozzi, G. Method for introducing specic and unmarked mutations into the chromosome of Streptococcus pneumoniae. Mol. Biotechnol. 26, 8186 (2004).

27. Birnboim, H. C. A rapid alkaline extraction method for the isolation of plasmid DNA. Methods Enzymol. 100, 243255 (1983).

28. Bidossi, A. et al. A functional genomics approach to establish the complement of carbohydrate transporters in Streptococcus pneumoniae. PLoS ONE 7, e33320 (2012).

29. Clark, T. A. et al. Characterization of DNA methyltransferase specicities using single-molecule, real-time DNA sequencing. Nucleic Acids Res. 40, e29 (2012).

30. Morona, J. K., Morona, R. & Paton, J. C. Attachment of capsular polysaccharide to the cell wall of Streptococcus pneumoniae type 2 is required for invasive disease. Proc. Natl Acad. Sci. USA 103, 85058510 (2006).

31. Alatery, A. & Basta, S. An efcient culture method for generating large quantities of mature mouse splenic macrophages. J. Immunol. Methods 338, 4757 (2008).

32. Trappetti, C. et al. Sialic acid: a preventable signal for pneumococcal biolm, colonisation and invasion of the host. J. Infect. Dis. 199, 14971505 (2009).

33. Oggioni, M. R. et al. Antibacterial activity of a competence-stimulating peptide in experimental sepsis caused by Streptococcus pneumoniae. Antimicrob. Agents Chemother. 48, 47254732 (2004).

34. Oggioni, M. R. et al. Switch from planktonic to sessile life: a major event in pneumococcal pathogenesis. Mol. Microbiol. 61, 11961210 (2006).

35. Wilcox, R. Kolmogorov-Smirnov test. Encyclopedia of Biostat. 4, doi:10.1002/ 0470011815.b2a15064 (2005).

36. Clark, P. J. & Evans, F. C. Distance to nearest neighbor as a measure of spatial relationships in populations. Ecology 35, 445453 (1954).

Acknowledgements

We thank Alice Gerlini, Vitor Silva Entrudo Fernandes and Peter W. Andrew for help with the animal experimentation and Christopher Bayliss for helpful discussion, Roberto Semeraro, Carlos Gallina-Ramos and James Eales for bioinformatic analysis and Marie Luz Mohedano and Paloma Lopez for help with plasmid methodology. This work was supported by The FP7 Marie Curie ITN 238490 and PNEUMOPATH 222983 (to M.R.O.), Program Grant 565526 from the National Health and Medical Research Council of Australia (NHMRC) (to J.C.P. and M.P.J.) and NHMRC Project Grants 627142 (to J.C.P. and A.D.O.) and 1034401 (to M.P.J.); J.C.P. is a NHMRC Senior Principal Research Fellow, C.T. is an Australian Research Council DECRA Fellow. The data mining part was in part supported by the Wellcome Trust Institutional Strategic Support Fund WT097828/Z/11/Z (RM33G0255 and RM33G0335).

Author contributions

A.S.M., M.H.C., L.F., M.D.S.C., R.H., C.T., A.D.O., J.C.P. and M.R.O. constructed mutants, performed gene expression analysis and phenotypic testing; J.M.A., L.K.S. and M.P.J. designed allele quantication methodology; J.M.A., L.K.S., A.S.M., M.D.S.C., M.R.O. and M.P.J. performed allele quantication; M.B., T.A.C. and J.K. performed methylome analysis; M.B. performed bioinformatic analysis; E.M. and A.G. performed mathematical analysis; A.S.M., J.M.A., J.C.P., M.P.J. and M.R.O. wrote the manuscript and J.C.P., M.P.J. and M.R.O. designed the study.

Additional information

Accession codes: Gene expression (RNA-seq) data were deposited in the NCBI GEO database with accession code GSE55182. The sequences of the spnD39III loci in the locked mutant strains were deposited in the GenBank nucleotide database with accession codes KJ955483, KJ955484, KJ955485, KJ955486, KJ398403 and KJ398404.

Supplementary Information accompanies this paper at http://www.nature.com/naturecommunications

Web End =http://www.nature.com/ http://www.nature.com/naturecommunications

Web End =naturecommunications

Competing nancial interests: M.B., T.A.C. and J.K. are full-time employeesat Pacic Biosciences, a company commercializing single-molecule, real-time nucleic acid sequencing technologies. The remaining authors declare no competing nancial interests.

Reprints and permission information is available online at http://npg.nature.com/reprintsandpermissions/

Web End =http://npg.nature.com/ http://npg.nature.com/reprintsandpermissions/

Web End =reprintsandpermissions/

How to cite this article: Manso, A. S. et al. A random six-phase switch regulates pneumococcal virulence via global epigenetic changes. Nat. Commun. 5:5055doi: 10.1038/ncomms6055 (2014).

This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the articles Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Web End =http://creativecommons.org/licenses/by/4.0/

NATURE COMMUNICATIONS | 5:5055 | DOI: 10.1038/ncomms6055 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 9

& 2014 Macmillan Publishers Limited. All rights reserved.