ARTICLE
Received 11 Mar 2014 | Accepted 26 Sep 2014 | Published 7 Nov 2014
William H. Hudson1,2, Mark R. Pickard3, Ian Mitchelle S. de Vera4, Emily G. Kuiper1,Mirna Mourtada-Maarabouni3, Graeme L. Conn1, Douglas J. Kojetin4, Gwyn T. Williams3 & Eric A. Ortlund1,2
The majority of the eukaryotic genome is transcribed, generating a signicant number of long intergenic noncoding RNAs (lincRNAs). Although lincRNAs represent the most poorly understood product of transcription, recent work has shown lincRNAs fulll important cellular functions. In addition to low sequence conservation, poor understanding of structural mechanisms driving lincRNA biology hinders systematic prediction of their function. Here we report the molecular requirements for the recognition of steroid receptors (SRs) by the lincRNA growth arrest-specic 5 (Gas5), which regulates steroid-mediated transcriptional regulation, growth arrest and apoptosis. We identify the functional Gas5-SR interface and generate point mutations that ablate the SRGas5 lincRNA interaction, altering Gas5-driven apoptosis in cancer cell lines. Further, we nd that the Gas5 SR-recognition sequence is conserved among haplorhines, with its evolutionary origin as a splice acceptor site. This study demonstrates that lincRNAs can recognize protein targets in a conserved, sequence-specic manner in order to affect critical cell functions.
DOI: 10.1038/ncomms6395
Conserved sequence-specic lincRNAsteroid receptor interactions drive transcriptional repression and direct cell fate
1 Department of Biochemistry, Emory University School of Medicine, Atlanta, Georgia 30322, USA. 2 Discovery and Developmental Therapeutics, Winship Cancer Institute, Atlanta, Georgia 30322, USA. 3 Institute of Science and Technology in Medicine, School of Life Sciences, Keele University, Keele ST5 5BG, UK. 4 Department of Molecular Therapeutics, Scripps Research Institute, Jupiter, Florida 33458 USA. Correspondence and requests for materials should be addressed to E.A.O. (email: mailto:[email protected]
Web End [email protected] ).
NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 1
& 2014 Macmillan Publishers Limited. All rights reserved.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395
An emerging phenomenon in biology is the widening gap between the availability of genomic sequences and the functional understanding of the products encoded
within1. The vast majority of functional research has focused on protein-coding genes, which constitute only 2% of the human genome2. Recently, attention has turned to the non-protein-coding elements of the genome and transcriptome. Although some noncoding RNA molecules (ncRNAs) such as small nucleolar and transfer RNAs have well-dened function, the majority of non-ribosomal, nuclear-encoded RNA molecules present in a cell are of unknown function and/or structure3. Of these, long intergenic ncRNAs (lincRNAs), dened as intergenic ncRNAs greater than 200 nucleotides in length, remain the most poorly understood product of transcription4. lincRNAs have been shown to function in diverse processes such as pluripotency, development, cell cycle, immunity, transcription and apoptosis59. Until recently, conservation of these lincRNAs was considered non-existent; however, emerging studies show higher conservation in lincRNAs than originally perceived, although well below the level of protein-coding exons5,10,11. Consistent with this observation, a recent study searched for similarity between mouse and zebrash lincRNAs and found only 9.0% of annotated mouse lincRNAs contained detectable sequence homology to whole-genome zebrash alignments, with most of this conservation clustered in small domains separated by longer stretches of divergent sequence12. Remarkably, mammalian lincRNA orthologues were still able to rescue developmental defects in zebrash caused by specic lincRNA knockouts, indicating lincRNA function can be conserved despite divergent primary sequence12. However, the mechanisms by which lincRNA functions are conserved in a rapidly changing sequence space are unclear.
The study of such mechanisms requires the identication of functional domains within lincRNAs. Unfortunately, there are currently few lincRNAs with well-characterized function, and still fewer in which functional domains have been identied and characterized. Known lincRNA functional domains include the 50 terminal region of lincRNA-p21, which interacts with hnRNP K to mediate the p53 response7. HOTAIR, a regulator of gene expression and chromatin state, uses a 50 domain to bind polycomb repressive complex 2, and a 30 domain to bind the LSD1/CoREST/REST complex13. Another lincRNA, growth arrest-specic 5 (Gas5), uses a region in its 12th exon to interact with and repress the steroid hormone receptors (SRs)14. Without detailed structural information about these protein lincRNA interactions, the basis of conservation (or lack thereof) within lincRNA functional domains is impossible to determine. By focusing on the interaction between SRs and Gas5, we sought to determine the molecular and structural requirements of a particularly important lincRNAprotein interaction.
The GAS5 gene is a noncoding 50 terminal oligo-pyrimidine gene consisting of 12 exons in humans and forms two mature fully-spliced and polyadenylated isoforms in addition to numerous expressed sequence tags14,15. The 11 introns of the GAS5 gene contain ten box C/D snoRNA genes, which are critical for ribosome modication and embryonic development16. Gas5 is present in all tissue types and is one of the most highly expressed noncoding RNAs in the human genome17. Gas5 has been implicated in many important cellular and physiological processes, including p53 signalling7, embryogenesis6, growth arrest and cell cycle18,19, and apoptosis14,2022. In addition, Gas5 is required for rapamycin action in immune cells20, and Gas5 knockdown affects mRNA levels for M-Ras, prion protein, parkin and other genes6. Gas5 inhibits the transcriptional activity of steroid receptors (SRs) through direct competition for DNA binding14. The SR-binding site was previously mapped to a
putative stem-loop region (bases 546566) and described as a mimic of genomic SR-binding sites, or glucocorticoid response elements (GREs)14. This GRE mimic (GREM) within Gas5 represents a compact lincRNAprotein interaction domain, optimal for examining the effects of altered lincRNA sequence and structure on proteinRNA interactions, and the downstream consequences on cellular processes. Here we describe detailed studies of the mechanistic, structural and evolutionary aspects of the SRGas5 interaction.
ResultsThe Gas5 GREM selectively binds 3-keto SRs. To measure the binding afnity between glucocorticoid receptor (GR) and Gas5, we monitored via uorescence polarization (FP) the ability of full-length Gas5 and shorter GREM-containing constructs (Supplementary Fig. 1) to compete with uorescently labelled DNA-activating GREs, or ( )GREs, for binding to the GR DNA-
binding domain (DBD; Fig. 1a). Full-length Gas5 competed for DNA binding the most strongly, with a Ki of 158 nMwithin the range of afnities of GR for ( )GREs (80 nM1 mM)23. Shorter
constructs (Supplementary Fig. 1) containing only the GREM were sufcient for DNA competition, although afnity was lowered approximately vefold compared with the full-length Gas5 transcript (Fig. 1a). In addition, a uorescently labelled Gas5 GREM construct containing only the stem bound directly to GR, indicating that only the putative double helical region within the GREM is required for GR binding (Fig. 1b), much like GR DNA binding requires a short, double helical response element.
Previous work demonstrated that Gas5 regulates the transcriptional activity of not only GR, but also the androgen receptor (AR), progesterone receptor (PR) and mineralocorticoid receptor (MR), which share the ability to bind 3-keto steroids as well as DNA ( )GREs14. Other nuclear receptors such as the estrogen
receptor (ER), peroxisome proliferator-activated receptor (PPAR) and retinoid X receptor (RXR), which bind different DNA response elements, are not susceptible to Gas5-mediated repression14. To determine the relative afnity of the Gas5 GREM for all SRs, we tested the ability of recombinantly expressed DBDs from all ve SRs to bind both ( )GRE DNA
and the Gas5 GREM stem (Fig. 1c,d). All 3-keto SRs bound both to a DNA ( )GRE and to the Gas5 GREM, which is consistent
with their transcriptional repression by Gas5 (ref. 14). As predicted, the ER DBD bound only to an ER response element (ERE), and was unable to bind the Gas5 GREM (Fig. 1c,d, Supplementary Fig. 1m,n).
Gas5 exploits sequence differences among protein targets. Given their similar structure and sequence (450% identity within the DBD), it is unclear how Gas5 discriminates among SRs; for example, the ER and GR DBDs share an identical fold and insert an a-helix to read the major groove of DNA (Fig. 1e).
However, key amino-acid differences in this helix allow the two receptors to bind disparate response elements. Notably, one ER side chain, Glu203, makes contact with DNA when bound to an ERE, whereas the 3-keto SRs contain a glycine at this position (Fig. 1f). When bound to a ERE, ER Glu203 contacts a cytosine, forming an interaction required for DNA binding and subsequent gene activation24. The 3-keto SRs do not contact DNA at this position, and substitution of glycine with a bulkier amino-acid side chain would introduce steric clashes with ( )GRE DNA
bases (Fig. 1e).
Remarkably, mutation of this single amino acid in ER to glycine (E203G) confers ER binding not only to a DNA ( )GRE
(Fig. 1g), but also to the Gas5 GREM (Fig. 1h). Likewise, the converse mutation in GR (G439E) reduced GR binding to both a DNA ( )GRE and the Gas5 GREM (Fig. 1g,h). The discrimination
2 NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications
& 2014 Macmillan Publishers Limited. All rights reserved.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395 ARTICLE
200
9
9
33 base GREM
8
8
150
Polarization (mP)
100 Gas5 GREM stem
Polarization (mP)
7
7
100
Log(K)
6
Log(K)
6
50
5
5
FL Gas522 base GREM
50
4
4
0 10 9 8 7 6 5 4
0 109 108 107 106 105 104
3 AR PR GR MR ER
3 AR PR GR MR ER
Concentration of Gas5 RNA (logM)
Concentration of GR DBD (M)
DNA (+)GRE binding
Gas5 GREM binding
8
8
ER
GR
7
7
203
ER HYGVWSCEGCKAFFKRSIQGGR HYGVLTCGSCKVFFKRAVEGMR HYGVVTCGSCKVFFKRAVEGPR HYGVLTCGSCKVFFKRAMEGAR HYGALTCGSCKVFFKRAAEG
6
6
Glu203 dT
3-keto SRs
Log(K)
Log(K)
5
5
4
4
NB
NB
Reading helix
3
3
GR GR G439E ER ER E203G
GR GR G439E ER ER E203G
(+)GRE
DNA (+)GRE binding
Gas5 GREM binding
Figure 1 | Gas5 selectively binds the 3-keto steroid receptors. (a) Full-length Gas5 competes strongly for DNA binding to the glucocorticoid receptor (GR; Ki 158 nM, t to a one-site binding competition model). Shorter Gas5 constructs (Supplementary Fig. 1) containing only the GREM stemloop are
sufcient for GR binding (Ki for the 23 and 33 base constructs are 825 and 654 nM, respectively). Error is shown as s.e.m., and was normalized
to the mean for gures showing logKd. (b) A double helical region containing only the GREM stem is sufcient for direct GR binding (Kd 801 nM, t to a
one-site specic binding model). (c) The 3-keto steroid receptors but not the estrogen receptor are able to bind to an activating DNA glucocorticoid response element (( )GRE). (d) Similarly, the GREM stem construct shown in b binds the 3-keto steroid receptors, but not the estrogen receptor.
However, the estrogen receptor is capable of binding its own response element (Supplementary Fig. 1m). (e) GR and ER recognize their cognate DNA response elements via different sequence-specic contacts. Notably, ER contains a glutamic acid at position 203 (Gly439 in GR), which excludes binding to an activating GR response element, or ( )GRE (f). (g) Mutation of this residue (Glu203) to the homologous GR residue (E203G) restores ER binding to a
GRE (right), and the converse mutation in GR (left, G439E) reduces afnity for a GRE. NB, no binding. (h) Remarkably, the ER E203G mutation confers binding to Gas5 (right), demonstrating that Gas5 exploits differences in GR/ER nucleic acid specicity to selectively target the non-ER steroid receptors. Binding experiments were performed in duplicate (full-length Gas5, panel a) or triplicate (all others), with three internal replicates each.
among evolutionary-related proteins by Gas5 demonstrates that lincRNAs are capable of sequence-specic interactions with their target proteins. In addition, the strong correlation between DNA binding and Gas5 RNA binding suggest the presence of sequence-specic, ( )GRE-like SR contacts in the Gas5 major groove.
A widened major groove facilitates GREM-SR binding. Previous work postulated that a putative double-helical region of the GREM mediated SR-Gas5 binding14. Ultraviolet melting experiments conrm that the Gas5 GREM stemloop indeed forms a secondary structure in solution (Tm 58 C;
Supplementary Fig. 2a). To determine the local RNA structure required for Gas5-SR recognition, we determined the X-ray crystal structure of the Gas5 GREM stem to a resolution of 1.9 . Two merohedrally twinned crystal forms were obtained in the rhombohedral space group R3, but twin renement yielded excellent electron density and statistics (Table 1, Supplementary Table 1, and Supplementary Fig. 2b). In both crystal forms, the Gas5 GREM adopts an A-form double helix with a widened major groove. The average minor and major grooves widths are greater than 15.0 in both crystal structures; wider than most A-form RNA helices found in crystal structures, but within the broader range of major groove widths in solution as determined by NMR25. GR-bound DNA response elements of GR exhibit major groove widths approximately 1.53.0 wider than the free Gas5 GREM structure23,26, indicating that only minimal secondary structure perturbation may be necessary for GR-Gas5 binding (Supplementary Fig. 2c,d).
Molecular determinants and model of the GRGas5 interaction. To identify bases within the GREM for critical SRGas5
Table 1 | Data collection and renement statistics for Gas5 GREM X-ray crystal structures.
Gas5 GREM (4 duplexes)
Gas5 GREM (2 duplexes)
Data collectionSpace group R3 R3Cell dimensionsa, b, c () 43.3, 43.3, 304.2 43.5, 43.5, 173.2 a, b, g () 90.0, 90.0, 120.0 90.0, 90.0, 120.0
Resolution () 1.9 (1.971.90)* 2.2 (2.242.20)* Rmerge 5.2 (42.3) 6.9 (25.6)
I/sI 22.5 (2.8) 28.5 (5.5) Completeness (%) 99.7 (100.0) 99.8 (82.1)
Redundancy 2.9 (2.8) 3.5 (2.5)
RenementResolution () 1.9 2.2 No. of reections 16794 6140 Rwork/Rfree 19.8/26.3 17.7/25.2
No. of atomsRNA 1649 857 Water 114 85 B-factorsRNA 31.6 34.6 Water 24.4 22.2 R.m.s. deviationsBond lengths () 0.0053 0.0065 Bond angles () 0.77 0.77
Coordinate error () 0.26 0.40
GREM, glucocorticoid response element mimic.*Data for each structure were collected from a single crystal. Values in parentheses are for highest-resolution shell. Maximum-likelihood coordinate error is shown.
NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 3
& 2014 Macmillan Publishers Limited. All rights reserved.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395
binding, we performed hydroxyl radical footprinting and used NMR to structurally map the GRGas5 interaction. Increasing concentrations of GR DBD protected several portions of the GREM stem from OH hydrolysis while deprotecting bases
U554-U556 within the loop (Fig. 2ac). The pattern of protection indicates GR interaction with the major groove, much like its classical interaction with DNA. To visualize the impact of GR binding on Gas5, we obtained two-dimensional homonuclear [1H,1H] nuclearverhauser enhancement spectroscopy (NOESY) spectra via 1H NMR of the Gas5 GREM stemloop both in the presence and absence of the GR DBD (Fig. 2df). Nucleotides within the Gas5 GREM stem showed NMR resonances with moderate or strong line broadening upon addition of GR DBD, whereas others displayed strongly shifted positions (40.025 p.p.m.). Broadened resonances correspond to nucleotides that are switching between two states in the intermediate exchange NMR timescale, whereas resonances that are simultaneously shifted and broadened are switching between two states in the slow-to-intermediate or intermediate-to-fast exchange regime. Only C561 and U569 have H10-H6 resonances that are shifted but not broadened, and therefore, have two states that are
in slow or fast exchange. The two states may correspond to nucleotides situated in disparate chemical shift environments, such as (i) free versus GR DBD-bound Gas5 RNA, (ii) two Gas5 RNA conformational states in the presence of GR DBD or (iii) as a result of interactions with a neighbouring Gas5 RNA or with another Gas5 RNA region within the same molecule. Both NMR and OH footprinting demonstrated conformational changes in
the four base loop upon GR binding (Fig. 2c), consistent with previous studies indicating that bulges and loops can widen the RNA major groove, presenting surfaces for protein interaction27,28.
To map the surface through which GR interacts with Gas5, we collected two-dimensional [1H,15N]-heteronuclear single quantum coherence (HSQC) data on the GR DBD both free and bound to the Gas5 GREM (Fig. 3ac). Notably, chemical shift perturbations are observed in helix 1 of the DBD when bound to either DNA29 or Gas5 RNA, indicating that GR uses its DNA-binding interface to bind RNA (Fig. 3be). Additional regions of the GR DBD that contact DNA in a nonspecic manner, such as helix 2 and the N-terminus, are also perturbed when GR is bound to DNA and RNA. However, no chemical shift perturbations are
+
+
GR
AH T1 + + + +
+
U557
OH
0 M GR
12 M GR
100
7.0
U555
G563/C564
G556/U557
C564*
U557/A558
U566*
U566
U554*
G556
80
G559
Band inetnsity (%)
7.5
U562*
580-
60
1H (p.p.m.)
C564
8.0
575-
G571
40
G567
570-
8.5
20
6.0
5.8
5.6 5.4 5.2 5.0
1H (p.p.m.)
565-
0
540 545 550 555 560 565 570 575 580
0.06
NOESY H1 H6/H8 shift
[(H x)2 + (H y)2]0.5
560-
0.05
555 U G
A G
A C U G
CC
U GA
U
G C G
A
G
U C
Ucau ga
5 3
0.04
U
U
U
0.03
555-
C
C
U
560
0.02
550
G
G
0.01
U
G
550-
565
570
575
0.00
A
545
C
548
550
552
554
556
558
560
562
564
566
568
570
572
574
Nucleotide
Nucleotide
C
1.0
NOESY H1 - H6/H8 shift
intensity ratio
U
C
0.8
540
C
545-
G
0.6
cA
cu
0.4
gauc
0.2
N
= OH enhancement (+GR)
N
= Strong NMR peak broadening (+GR)
N
= OH protection (+GR)
= Moderate NMR peak broadening (+GR)
0.0
540-
N
548
550
552
554
556
558
560
562
564
566
568
570
572
574
Figure 2 | Base-specic interactions mediate the glucocorticoid receptorGas5 interaction. (a) GR protects the Gas5 GREM from OH hydrolysis.
Increasing amounts of GR DBD were added to in vitro transcribed Gas5 GREM RNA and subjected to OH hydrolysis, followed by denaturing
polyacrylamide gel electrophoresis; a representative gel is shown. GR-mediated protection from OH hydrolysis is quantied in b. Light and dark blue
indicate moderate and strong protection (410% and 20%, respectively) with GR DBD, and red indicates deprotection in the presence of GR DBD. (c) Results from NMR and OH footprinting are mapped onto the Gas5 GREM. (d) Zoomed in overlay of free Gas5 RNA (black) and 1:1 Gas5 RNA:GR
DNA-binding domain (DBD; orange) 2D [1H,1H]-NOESY spectra with 200 ms mixing time. Broadened resonances in the presence of GR DBD are labelled. Intra-nucleotide H1-H6/H8 resonances are labelled according to nucleotide type and position number. H5-H6 peaks are labelled in the same way, followed by an asterisk (*). Peak labels separated by a slash (/) are for inter-nucleotide H1-H6/H8 NOESY crosspeaks. (e) NMR crosspeak shifting calculated from NOESY spectra for free and GR DBD-bound Gas5 GREM stem reveals strongly shifted resonances (changes 40.025 p.p.m.; horizontal dashed line). (f) NMR crosspeak line broadening determined from NOESY spectra as calculated from the crosspeak intensity ratio for free and
GR-DBD-bound Gas5 GREM stem (moderately broadened resonances, 40.4, grey; strongly broadened resonances, 40.8, yellow).
4 NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications
& 2014 Macmillan Publishers Limited. All rights reserved.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395 ARTICLE
GR DBD - Gas5 GREM
GR DBD - Gha DNA
100
105
110
115
120
125
130
135
D-Loop
1 2 H1 H2 H3
Lever arm
N
Helix 2
Helix 3
Lever arm
D-loop
Chemical shift perturbation
(p.p.m.)
0.20
0.15
0.10
0.05
0.00
C
Helix 2
C
D-loop
Helix 3
Helix 1 (DNA/RNA reading)
420 430 440 450 460 470 480 490 500
Helix 1
N (p.p.m.)
Residue number
Lever arm
Lever arm
GR DBD - Gas5 GREM
GR DBD - Gha DNA
N
Helix 3
D-loop
D-Loop
1 2 H1 H2 H3
Residue number
C
1.0
Chemical shift perturbation
(p.p.m.)
Helix 2
0.8
C
D-loop
Helix 1
0.6
Helix 3
0.4
0.2
Helix 1 (DNA/RNA reading)
Helix 2
0.0
10.0 9.0
8.0
7.0 6.0
420 430 440 450 460 470 480 490 500
H (p.p.m.)
Figure 3 | NMR reveals that Gas5 interacts directly with residues that comprise GRs DNA-binding interface. (a) 2D [1H,15N]-HSQC spectra of GR DBD free (black) and bound to the Gas5 GREM (orange). (b) Chemical shift perturbations induced in GR DBD upon binding Gas5. Perturbations greater than 0.05 p.p.m. are coloured orange; blue vertical lines represent resonances that broaden upon binding Gas5 and are no longer observed. (c) GR chemical shift perturbations upon GREM binding mapped onto the HADDOCK model of GR DBD bound to the Gas5 GREM. (d) Chemical shift perturbations greater than 0.1 p.p.m. (green) induced in GR DBD upon binding Gha DNA29 plotted against GR DBD primary and secondary structure. (e) GR chemical shifts upon Gha DNA binding mapped onto the GR DBD crystal structure (PDB 4HN5).
observed in the dimerization interface (D-loop) of the DBD upon RNA binding as is observed with GR DBD( ) GRE
interactions30, providing no evidence for dimerization on RNA (Fig. 3c,e). These GR DBD [1H,15N]-HSQC data, Gas5 GREM [1H,1H] NOESY spectra and mutagenesis data were used to generate a model of the GR DBDGas5 GREM complex using HADDOCK31. In line with the hypothesis that the Gas5 GREM is a RNA mimic of DNA response elements, the top scoring models showed the GR DBD reading the Gas5 GREM by inserting helix 1 into the major groove (Fig. 4a).
A single GREM mutation abolishes the SRGas5 interaction. The specicity of GR and 3 keto-SR-DNA recognition is heavily dictated by the contact of arginine and lysine residues in helix 1 of the GR DBD with two guanine-cytosine (GC) pairs in the ( )GRE major groove. Surprisingly, two equivalently spaced
guanine-containing pairs (G549 and G559) are present in the Gas5 RNA GREM and were identied by structure probing as participating in the GRGas5 interaction (Fig. 2). Mutating these two guanines to adenine, which replaces the major groove O6 carbonyl with an amine, ablates GR binding (Fig. 4bf). Mutation of G549 to 2-aminopurine, which selectively removes a potential hydrogen bond acceptor (O6) from the major groove while leaving the minor groove unchanged, diminishes but does not abolish binding. Critically, these Gas5 RNA mutations preserve secondary structure as monitored by ultraviolet melting (Supplementary Table 2). Along with the structural data above, these experiments establish that GR indeed binds Gas5 in the major groove.
In addition, protein recognition of RNA wobble pairs has been reported in several systems32,33, and two such non-WatsonCrick interactions are present in the Gas5 GREM: U548-G563 and G549-U562. To determine whether GR-GREM recognition depends on this wobble base pairing, we mutated these G-U pairs to canonical WatsonCrick G-C pairs. This mutation only marginally affected GR binding (Fig. 4g), indicating that GR does not discriminate between guanine-uracil and guanine-cytosine pairs.
To examine the effect of the G549A mutation on SR-mediated transcription in cells, we transfected AR-positive 22Rv1 prostate
cancer cells, with wild-type (WT) Gas5, Gas5 with the G549A mutation or empty vector (pcDNA3.1). In these cells, WT Gas5 inhibited the androgen-driven expression of several AR target genes (Fig. 4hj). However, this effect was reversed by the G549A mutation, with expression of the AR target genes returning to vector control levels. We therefore identied a single-nucleotide mutation is sufcient to ablate the interaction between SRs and Gas5 both in vitro and in cells.
The Gas5 G549A mutant prevents Gas5-induced apoptosis. Gas5 is downregulated in both breast and prostate cancers, and its reintroduction accelerates apoptosis in both prostate and breast cancer cell lines21,22,34. However, the potential role of the Gas5 SR interaction in cancer cell proliferation and survival has not been studied. To test whether a Gas5 mutant specically compromised in SR interaction displays aberrant function in SR-driven cancer cell lines, we tested the ability of both the WT and G549A Gas5 to drive apoptosis when expressed in 22Rv1 prostate cancer cells. Transfection of both the WT and mutant constructs increased Gas5 expression compared with the vector control (Fig. 5a), but only the WT sequence caused caspase activation in these cells, and this was accompanied by a corresponding decrease in cell viability (Fig. 5b,c). The G549A mutant, in contrast, had no effect on either parameter (Fig. 5b,c). We repeated these experiments in the PR /ER breast cancer cell line MCF-7; again, the G549A mutant completely prevented the pro-apoptotic phenotype induced by transfection of WT Gas5 (Fig. 5df). Thus, in steroid-driven cancer cells such as 22Rv1 cells, Gas5 function appears to be directly related to the SR-Gas5 signalling axis.
The expression of Gas5 variants has differential effects in immune cells, which are less dependent on SR signalling for growth18. To determine the role of SR-Gas5 interactions in apoptosis and viability in these cells, we transfected three suspension cell lines, JeKo-1, CEM-C7 and Jurkat, with the WT and G549A Gas5 constructs (Fig. 5g). Among all three cell lines, transfection of WT Gas5 induced apoptosis and a corresponding decrease in cell viability (Fig. 5h,i) as we previously reported18. Interestingly, the G549A mutation only partially reversed this phenotype (Fig. 5h,i), in contrast to the complete reversal of
NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 5
& 2014 Macmillan Publishers Limited. All rights reserved.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395
Arg447
549
Arg447
549
Major groove
Minor groove
Guanine (WT) Adenine
Arg447
549
2-Aminopurine
100
Polarization (mP)
100 WT Gas5 WT Gas5 G549A G549A C553U/G559A G549AP
0 109 108 107 106 105 104 109 108 107 106 105 104
100 WT Gas5
No wobble pairs
Concentration of GR DBD (M)
50
Polarization (mP)
50
Polarization (mP)
50
0 109 108 107 106 105 104
0
Concentration of GR DBD (M) Concentration of GR DBD (M)
500
KLK2 expression
(% of control)
400
KLK3 expression
(% of control)
1,500
Vehicle R1881
FKBP5 expression
(% of control)
400
300
1,000
300
200
200
500
100
100
0
0
0
pcDNA3 WT Gas5 G549A
pcDNA3 WT Gas5 G549A
pcDNA3 WT Gas5 G549A
Figure 4 | A single-nucleotide mutation within Gas5 eliminates its ability to bind steroid receptors and repress steroid-driven transcription.(a) Superposition of the highest-scoring cluster of GRGas5 GREM models generated by HADDOCK. In these models, GR binds in the major groove to the A-form helix of the Gas5 GREM. (b) Guanine 549 presents a carbonyl moiety towards the major groove, which GR may recognize with a basic amino acid such as Arg447 (modelled here by HADDOCK) or Lys442. (c) Mutation of guanine 549 to adenine introduces an amine in the major groove, which would clash with the basic major-groove reading amino acids of GR. However, mutation of this guanine to 2-aminopurine (d) removes this carbonyl moiety without affecting the minor groove interaction surface. (e) Mutation of the two guanine bases, including position 549, identied by structure probing (Fig. 2) to adenine ablates binding of GR to the Gas5 GREM stem. Binding (eg) data are t to a one-site specic binding model. (f) The G549A mutation ablates GR binding to the Gas5 GREM stem. However, mutation of G549 to 2-aminopurine reduces GRGas5 GREM stem binding only 2.5-fold, indicating that GR contacts the major groove of Gas5 (see bd). (g) Two G-U wobble pairs (including G549) are present in the GREM; however, WatsonCrick G-C pairs are also compatible with GR binding. (hj) The G549A mutation, which ablates SR-Gas5 binding in vitro, also compromises Gas5-mediated repression of steroid-driven transcriptional activation in 22Rv1 cells. Three androgen receptor-responsive genes were measured and normalized to ACTB via reverse transcription PCR (RTPCR) in 22Rv1 prostate cancer cells with and without the AR agonist R1881. In all panels, error is shown as s.e.m, and binding experiments and RTPCR were both performed in triplicate.
apoptosis induction seen in steroid-driven cancer cell lines (Fig. 5bc,ef). These results indicate that Gas5 has functions beyond regulating SRs, such as mediating mammalian target of rapamycin signalling20, and additional regions of the Gas5 transcript play important roles in regulating apoptosis in immune cells.
GR cannot bind its own transcribed genomic binding sites. As 70% of the genome is transcribed, there may be many Gas5-like RNAs capable of binding and modulating the activity of SRs. In particular, there are B2.3 106 genomic sequences matching a
GR-binding motif35, and many of these lie within transcribed regions. Owing to their inverted repeat sequence, transcribed ( )GREs could form a stemloop structure much like the Gas5
GREM (Fig. 6a), which led us to inquire whether a RNA GREM could readily evolve from a DNA GR-binding site. However, a ( )GRE-derived stemloop differs from the Gas5 GREM in two
ways. First, the loop of the ( )GRE structure would contain a 3-
base loop, whereas the GREM contains a 4-base loop. Second, the ( )GRE sequence differs slightly from the bases found in the
Gas5 GREM (Fig. 6a).
To test the effects of the decreased-length loop on GR binding, which would occur upon transcription of a ( )GRE, we
generated the WT Gas5 GREM with a 3-base loop UUU loop rather than the 4-base UUGU loop found in WT Gas5. Although 3-base loops are often less stable than 4-base loops, a UUU loop with a closing AU pair demonstrates adequate stability36. Nonetheless, the 3-base loop Gas5 GREM showed lower afnity for GR than the WT 4-loop structure, indicating that inverted repeat sequences with 3-base spacers are unlikely to be active GR-binding elements following transcription (Fig. 6b).
However, it is possible that a SR-binding RNA sequence such as the GREM could form via a single-nucleotide insertion into a ( )GRE, creating a 4-base stemloop for SR binding. To eliminate
effects of the loop length, we placed the consensus ( )GRE
halfsite within the Gas5 GREM stem, which is sufcient for GR binding (Fig. 1b). GR could not bind this consensus sequence with either WatsonCrick or Gas5-like wobble pairs (Fig. 6c), but required additional two additional nucleotide changes to achieve GR-binding ability (Supplementary Fig. 3). These results indicate that Gas5 independently and convergently evolved a SR-binding surface, perhaps aided by the rapid sequence evolution of lincRNAs compared with coding genes. Such a mechanism,
6 NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications
& 2014 Macmillan Publishers Limited. All rights reserved.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395 ARTICLE
*** ***
15 100
80
80
**
**
Gas5 expression (vs. 18S) Gas5 expression (vs. 18S)
Caspase-positive cells (%) % Apoptosis
**
60
*
Cell viabiliy (%) Cell viabiliy (%)
10
40
***
5
**
20
0 pcDNA3
WT Gas5
G549A
pcDNA3
0 WT Gas5
G549A
pcDNA3
WT Gas5
G549A
pcDNA3
60 WT Gas5
G549A
pcDNA3
WT Gas5
G549A
+ UV
+ UV
+ UV
***
50
80
100
***
***
***
40
60
*** ***
30
40
80
20
20 *** ***
10
0
pcDNA3
WT Gas5
G549A
pcDNA3
0 WT Gas5
G549A
pcDNA3
WT Gas5
G549A
pcDNA3
60 WT Gas5
G549A
pcDNA3
WT Gas5
G549A
+ UV
8
25
*
** **
***
***
***
80
**
*
***
*
***
***
**
***
*
***
Gas5 expression (vs. 18S)
6
20
No. of colonies
60
% Apoptosis
15
4
40
10
2
5
20
pcDNA3
0 WT Gas5
G549A
pcDNA3
WT Gas5
G549A
pcDNA3
WT Gas5
G549A
pcDNA3
0 G549A
WT Gas5
pcDNA3
WT Gas5
G549A
pcDNA3
WT Gas5
G549A
pcDNA3
0 WT Gas5
G549A
pcDNA3
WT Gas5
G549A
pcDNA3
WT Gas5
G549A
JeKo-1 CEM-C7 Jurkat
JeKo-1 CEM-C7 Jurkat
JeKo-1 CEM-C7 Jurkat
Figure 5 | Selective ablation of the steroid receptorGas5 interaction has dramatic effects on cell fate. (a) Quantication of Gas5 levels normalized to 18S RNA in 22Rv1 cells after transfection with WT Gas5, G549A Gas5 and pcDNA3 constructs. (b) WT Gas5 induces caspase-dependent celldeath in 22Rv1 cells, but this effect is completely reversed in the G549A mutant. Similar effects were seen for cell viability (c). (d) MCF-7 cells were transfected with identical constructs, and levels quantied via reverse transcription PCR and normalized to 18S RNA. The G549A mutation completely ablated the pro-apoptotic (e) effects and reduction in cell viability (f) caused by transfection of WT Gas5. (g) Likewise, three suspension cell lines were transfected with pcDNA3, WT Gas5 or the G549A mutant and expression were quantied as above. In these cell lines, the G549A mutation only partially reverses the apoptotic effects (h) and colony-forming effects (i) seen by transfection of WT Gas5. For all panels, experiments were performed in triplicate, and error is shown as s.e.m. and was normalized to the mean for gures showing logKd. One, two and three asterisks indicate Po0.05,0.01 and 0.001, respectively by one-way ANOVA with Tukeys post-hoc test.
whereby a lincRNA acquires the ability to recognize protein targets could be common, and we sought to establish the evolutionary origin of the Gas5 GREM.
The Gas5 GREM evolved from a splice acceptor site. The GAS5 gene is annotated in only three genomes in the Ensembl database, and the low sequence conservation of lincRNAs makes sequence alignment across multiple species challenging. Fortunately, human Gas5 hosts ten small nucleolar RNAs (snoRNAs) that are highly conserved throughout vertebrates. Intron 11, just upstream of the Gas5 GREM, contains the snoRNA gene U81, which is positionally conserved from reptiles to mammals. The length of intronic sequence from snoRNAs to the downstream 30 acceptor splice site is restricted for proper processing of box C/D snoRNAs, with lengths of 6575 nucleotides from a box C/D snoRNA to the downstream exon ideal for efcient snoRNA excision37. As
Gas5-containing snoRNAs are critical for embryonic development16, we expected the length of intronic sequence downstream of these snoRNAs to be well conserved. Using this anticipated high conservation of snoRNA sequence and intronic length as a guide, we were able to align the Gas5 GREM sequences from over 40 vertebrates. Gas5 does not appear to be present in jawless sh. As expected, the distance from U81 to the downstream splice acceptor site was tightly clustered across vertebrates (Fig. 7a).
The most striking feature of the GAS5 GREM alignment is the presence of an Alu insertion in the haplorhine lineage, belonging to the AluJo family (Fig. 7b). This insertion occurred directly at the GAS5 intron 11/exon 12 boundary, lengthening the GAS5 exon 12 by 100 nucleotides compared with mice. In haplorhines, an Alu-contained splice acceptor site is used for Gas5 transcript processing, maintaining the strict requirement for intron length
NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 7
& 2014 Macmillan Publishers Limited. All rights reserved.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395
N
U G
U U C U
N
N
U
U G
A G
A C U G
U
A
U
Genomic GR response element
C
C
A
U
Transcription
A
G
G
G
5-AGAACANNNTGTTCT-3 3-TCTTGTNNNACAAGA-5
A
U
5 3
5 3
Transcribed (+)GRE RNA
Gas5 GREM stemloop
100
80
100
Polarization (mP)
Polarization (mP)
60
Gas5 WT
Transcribed (+)GRE with wobble pairs
Transcribed (+)GRE
Concentration of GR DBD (M)
40
50
20
Gas5 WT
3 Base stemloop
0
0
9 8 7 6 5 4
Concentration of Gas5 (logM)
109 108 107 106 105 104
Figure 6 | The glucocorticoid receptor will not bind its transcribed genomic response elements. (a) Within genomic DNA, GR binds ( )GREs, which
are inverted repeats separated by three nucleotides. Such inverted repeat sequences would form a stemloop with similar sequence to the Gas5 GREM when transcribed (on right). However, this sequence is incapable of binding GR because of both secondary structure constraints caused by a three-base stemloop (b) as well as a different primary sequence (c). (b) Competition for a uorescently labelled ( )GRE DNA construct was performed with a WT
GREM-containing 51 nt construct or an otherwise-identical construct with a three-base stemloop (DG556). The afnity of the WTconstruct for GR (Ki) was
125 nM, similar to that of full-length Gas5 (Fig. 1a). (c) A uorescently labelled transcribed ( )GRE sequence with Gas5 GREM stem anking sequences
was tested for binding to the GR DBD. Binding (b,c) data are t to a one-site competition or specic binding model, with error shown as s.e.m. Binding experiments were performed in duplicate (b) or triplicate (c), with three internal replicates each.
0 55 60 65 70 75 80 85 90 95
20
Mouse GAS5
Human GAS5
15
Poly(Y)
Poly(Y) AG
Poly(Y)
AG
AG
U81
Exon 12
Frequency
10
GREM AluJo
5
U81
Exon 12
GREM
See alignment
Post-U81 intron length
8
Human CCTCCCAGTGGTCTTTGTAGChimpanzee CCTCCCAGTGGTCTTTGTAGGorilla CCTCCCAGTGGTCTTTGTAGS. Orangutan CCTCCCAATGGTCTTTGTAGB. Orangutan CCTCCCAATGGTCTTTGTAGGibbon CCTCCCAATGGTCTTTGTAGBaboon CCTCCCAATGGTCTTTGTAGR. Macaque CCTCCCAATGGTCTTTGTAGC-E. Macaque CCTCCCAGTGGTCTTTGTAGMarmoset CCTCCCAGTGGCCTTTGTAGSquirrel Monkey CCTCCCAGTGGACTTTGTAGTarsier CCTCAAAGTGGTCTTTGCAG
71% Pyrimidine
0 20 40 60 80
200 Marmoset Macaque Human
6
Log(K i)
0.002
0.003 HumanMarmoset Macaque 59
55 45
150
4
dA 260/dT
100
2
0.001
50
0
0.000
0
1010 109 108 107 106 105 104
WT Gas5
AG mutant
Temperature (C)
Polarization (mP)
Concentration of GR DBD (M)
Figure 7 | The Gas5 GREM evolved from a splice acceptor site. (a) The downstream intron length from the snoRNA U81 is highly conserved because of excision constraints, illustrating the importance of sequence and positional conservation of the splice acceptor site at this locus. (b) The Gas5 GREM was interrupted by an AluJo insertion (red) in haplorhines, moving the ancestral splice acceptor site into exon 12, where splicing no longer occurs. Poly(Y) indicates the position of a polypyrimidine tract. (c) However, despite the lack of splicing at the haplorhine GREM, the haplorhine GREM maintainsa splice site-like sequence with a polypyrimidine tract followed by an AG dinucleotide, which is required for high-afnity steroid receptor-Gas5 binding (mutated to GA in d). Other haplorhine species contain Gas5 GREM sequences that exhibit similar secondary structure (e) and GR-binding afnityto the human Gas5 GREM (f). Error is shown as s.e.m., and was normalized to the mean for gures showing logKd. Binding data (f) were t to a one site, specic binding model. Binding experiments were performed in duplicate (d) or triplicate (f), with three internal replicates each.
downstream of U81. However, this insertion demonstrates that the GREM, although exonic in humans and other haplorhines, evolved from an ancestral splice acceptor site still present in other
vertebrates. Multiple previously unassigned cDNAs from Gen-Bank support both the alignment as well as the presence of a splice site at the GREM (Supplementary Table 3). The AluJo
8 NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications
& 2014 Macmillan Publishers Limited. All rights reserved.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395 ARTICLE
insertion re-positioned the ancestral splice acceptor site to be fully contained within exon 12, and it is this now-defunct splice site through which the SRs bind Gas5 (Fig. 7b).
Owing to snoRNA excision restraints, the haplorhine Gas5 GREM, over 150 bases downstream of U81, would be under negative selection to lose the ancestral splice site features located inside exon 12 incorporated with the AluJo insertion. However, if this locus was selected for both its splice site sequence and SR-binding ability before the Alu insertion, it is possible that splice-site like sequences required for SR binding would be conserved. Remarkably, when haplorhine GREM sequences are aligned, splice site-like features are readily apparent: a polypyrimidine tract and acceptor AG sequence are conserved throughout the haplorhine clade, despite a lack of splicing at this locus (Fig. 7c). The splice site-like sequence shows higher sequence identity among 14 haplorhines (93.8 versus 84.5% for the remainder of exon 12). In addition, relative rate analysis of each position within the ancestral splice site reveals a lower rate of nucleotide substitution within the GREM versus the remainder of exon 12, supporting sequence conservation of the splice site-like sequences required for GR binding to the GREM (Supplementary Fig. 4). Mutation of these splice site-like features, such as the AG within the ancestral splice acceptor sequence, reduces the GREMs afnity for GR binding (Fig. 7d), suggesting that other haplorhines contain conserved, functional GREMs with both a primary sequence and secondary structure capable of binding SRs. Indeed, the GREM sequences of two other haplorhines formed secondary structures in solution (Fig. 7e) and were capable of binding the GR DBD (Fig. 7f).
Given the evolutionary origin of the human Gas5 GREM as a splice acceptor site, it is possible that alternate splicing of the GAS5 gene may control its ability to bind and repress GR in nonhaplorhines. The mouse splice isoforms with exon 11 excised or retained bound GR in vitro (Supplementary Fig. 5a), and the GREM derived from both the splice or unspliced Gas5 transcripts was sufcient for secondary structure formation and GR binding (Supplementary Fig. 5b,c). When we tested for GRGas5 binding across the vertebrate clade, eutherian mammals demonstrated the highest afnity interaction (Supplementary Fig. 5d), suggesting that the Gas5 GREM was perhaps capable of binding SRs at the time of the AluJo insertion, roughly 55 Mya38. However, further study of the mouse and other mammalian Gas5 transcripts is required to denitively determine if GR regulation is a conserved property of Gas5 outside of the haplorhine clade. This is especially true given the short lifetime of unspliced Gas5 and the shorter length of exon 12 in mice compared with haplorhine Gas5 (Fig. 7b).
Gas5 is retrotransposed within multiple mammalian lineages. Finally, given the unique ability of the GREM to bind SRs, we searched for additional GREM-like sequences within the human genome, which could serve as SR-repressing elements. Remarkably, we found processed copies of Gas5 in at least ve locations in the human genome, including within the introns of four genes: GABRB3, NAPEPLD1, MDN1 and SV2C (Supplementary Fig. 6). At least 29 splice variants of the GAS5 gene are known15, and GAS5 retrotransposition events mirror this complexity. Two human copies are fully spliced (splice variant GAS5-001; Supplementary Fig. 6), whereas the sequence within the GABRB3 gene is a copy of the GAS5-008 splice variant (Supplementary Fig. 6). In addition, some retrotransposed copies of Gas5 are from unreported, species-specic, or ancestral splice variants, such as a copy in gibbons that contains exons 14, 6, 7, 11 and 12 (Supplementary Fig. 6). Such a splice variant is not currently described in humans.
GAS5 appears to be highly susceptible to retrotransposition, with either full or partial copies of the processed Gas5 present in multiple mammalian lineages, including mice, dogs and more distal members of the mammalian clade, such as sloths (Supplementary Table 4). At least 15 independent copies appear in the haplorhine lineage with many of these copies located within transcribed loci (Supplementary Table 4). Given the limited species distribution and high-sequence identity between genomic GAS5 sequences and these copies, the retrotransposition events described here are relatively recent. It is likely that additional, ancient copies of GAS5 are present in mammalian genomes but have diverged beyond recognition.
DiscussionUsing a range of structural and biochemical approaches, we offer a mechanism to explain the potent ability of Gas5 to suppress SR-mediated transactivation. This repression is mediated through sequence-specic protein RNA-contacts within an A-form double helical structure with a widened major groove that facilitates SR binding. We show that full-length, fully spliced Gas5 binds strongly to the GR DBD, with afnity comparable to physiological DNA GREs23. In addition, GR exhibits stronger binding to full-length Gas5 than single ( )GRE half-sites or the newly
characterized negative GREs26,39, illustrating the strength of the GRGas5 interaction as well as the versatility of GR as a diverse nucleic acid-binding protein23,40,41. GR is one of a growing number of proteins that bind DNA and RNA, a class that includes ADAR, TFIIIA and the p50 subunit of nuclear factor-kB, among many others42. p50 has been crystallized in complex with its DNA response element as well as a competing RNA aptamer43,44. The RNA aptamer adopts a similar conformation as nuclear factor-kB response elements, and p50 makes nearly identical contacts with RNA as it does with DNA43; we expect a similar mechanism of DNA mimicry occurs with GR and Gas5.
Here we show that GRGas5 interactions are mediated through helix 1 of GRs DBD, demonstrating that GR uses the same surface to bind both DNA and Gas5 RNA. However, the dimerization loop of the GR DBD is not affected upon Gas5 binding, although more study is required to denitively determine GRs dimerization status when bound to RNA, given recent reports demonstrating the importance of the ligand-binding domain in receptor dimerization45. Although the exact Gas5 GREM sequence does not appear in any human mRNAs, we have demonstrated that this sequence evolved from a splice acceptor site; therefore, GR may be able to recognize RNA transcripts similar to Gas5 at splice site sequences; GR has been previously shown to affect the alternate splicing of several genes4648.
The potent repression of SR signalling by Gas5 is likely explained by both the strong afnity of the SR-Gas5 interaction and by the large discrepancy between Gas5 copy number and GR DNA-binding sites in a cell during periods of Gas5 upregulation. In HeLa cells, Gas5 copy number increases by an order of magnitude to roughly 75,000 during serum starvation14, which is on par with or greater than the increase in Gas5 expression caused by exogenous transfection in this study (Fig. 5a,d,g). In contrast, available genomic GR-binding sites are roughly xed in number, ranging from 3,000 to 8,000 depending on cell type35. This suggests that Gas5 regulates SR activity by simply titrating its own GR-binding site against genomic GR-binding sites. However, it is unclear whether Gas5 interferes with DNA binding-independent, SR-mediated transrepression such as tethered GR transrepression49. Future studies are needed to determine if Gas5 modulates these DNA-independent effects.
The GAS5 gene is unique in its high level of alternative splicing: at least 29 non-redundant, alternatively-spliced transcripts
NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 9
& 2014 Macmillan Publishers Limited. All rights reserved.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395
originate from the GAS5 locus15, making it one of the most highly alternatively spliced genes in the genome. Although it is not clear whether Gas5 splicing patterns are tissue-specic, the majority of Gas5 splice variants include the GREM, which is sufcient for SR binding. Notably, we recently showed that exon 12-containing Gas5 transcripts are downregulated in breast ductal carcinoma compared with adjacent normal tissue21. Nevertheless, 13 Gas5 splice variants either exclude exon 12 or shorten exon 12 such that the GREM is not included in the nal transcript50, indicating that alternative splicing may present an additional level of SR regulation by Gas5. Such control may be required for tissue-specic homeostasis and may be disrupted by single-nucleotide polymorphisms (SNPs) that affect the splicing of GREM-containing exon 12 (rs11537772, rs111755386). An additional SNP that alters the GREM sequence (G559U) has also been described (rs186249529). Mutation of G559 in this study, even when combined with a compensatory mutation to preserve secondary structure, dramatically weakens the GRGas5 interaction (Fig. 4e), potentially attenuating riborepression of SR signalling. Thus, it is possible these and other Gas5 SNPs may predispose individuals to steroid-driven cancers despite apparently normal tissue levels of Gas5.
Given the paucity of identied sequence-specic lincRNA function, we used the detailed biochemical and structural data here to examine the evolutionary origin of the Gas5 GREM. The SR DBDs are highly conserved throughout vertebrates; in contrast, two recent studies with lincRNA functional domains show mixed levels of conservation: megamind and cyrano show conserved function between zebrash and mammals12, whereas key functional human domains of the lincRNA HOTAIR are missing in mice51. Given the comparatively faster sequence turnover within lincRNAs compared with their protein targets, we propose that Gas5 co-opted a splice acceptor site into its current SR-binding role. Such a mechanism allows the primary sequence required for SR binding to be conserved because of the presence of a second, stronger pressure for conservation. The relatively loose sequence requirements of an acceptor splice sitea polypyrimidine tract followed by AGmay have allowed this locus to gradually acquire SR-binding ability in eutherian mammals (Supplementary Fig. 5d). However, it is clear that once Gas5-SR binding was established, this function was conserved, given the retention of splice site-like sequences required for SR binding at the GREM (Fig. 7c). The development of this functional domain within the translationally regulated 50 terminal oligo-pyrimidine Gas5 transcript may have provided an important link between translational downregulation and other critical events involved in growth arrest18.
Given the large numbertens of thousandsof lincRNAs, it is likely that hundreds of lincRNAs have precise, sequence-specic functions analogous to that of Gas5. Furthermore, given their large size, it is likely that some lincRNAs contain multiple protein-recognition sites and may serve as scaffolds for protein complexes. Here we have demonstrated that the interaction between Gas5 and SRs depends on unique structural elements and precise, sequence-specic interactions to differentiate among target proteins. Subtle disruptions of these interactions have dramatic effects on cell fate. Further, we show that the lincRNA Gas5 co-opted splicing regulatory sequences into a SR-binding role, explaining functional and sequence conservation at the GREM. Together, these results demonstrate that lincRNAs can contain conserved, sequence-specic protein interaction surfaces that ensure a high level of specicity to bind to target proteins and control cell fate.
Methods
Protein expression and purication. The DBDs of the human GR (GenBank ADP91253.1; residues L381-E541), AR (UniProtKB P10275.2; residues D550-K630),
PR (UniProtKB P06401.4; residues E560-F642), MR (GenBank AAA59571.1; residues S593-G671) and ER (UniProtKB P03372.2; residues A175-R260) were cloned as 6X Histidine fusions into the pMCSG7 vector. Mutations were made with the QuikChange site-directed mutagenesis kit (Stratagene). The DBDs were expressed based on previous protocols26,52: transformed BL-21(DE3)pLysS Escherichia coli were induced with 0.3 mM isopropyl-b-D-thiogalactoside for 4 h at 30 C. Cells were lysed in 1 M NaCl, 20 mM Tris-HCl, pH 7.4, 25 mM imidazole, 5% glycerol via sonication, and protein was puried via afnity chromatography (HisTrap) followed by TEV protease cleavage and dialysis to 100 mM NaCl, 20 mM Tris-HCl, pH 7.4, 25 mM imidazole and 5% glycerol. The DBDs and tags were separated by afnity chromatography (HisTrap), and further puried by gel ltration chromatography. For storage, protein was concentrated to 4 mg ml 1, ash frozen in liquid N2 and stored at 80 C. For 15N labelling, the GR DBD was expressed in M9 minimal
media with 15NH4Cl as the nitrogen source. Cultures were inoculated at an OD600 of 0.30.4, and induced for 14 h with 1 mM isopropyl-b-D-thiogalactoside at an OD600 of 1.2. The GR DBD was then puried via afnity chromatography as above.
Nucleic acid synthesis and purication. Constructs for in vitro transcription were ligated into the puc57 vector using a forward primer with the T7 promoter sequence and a reverse primer using the HindIII restriction site. Plasmid was cut overnight with HindIII (Fermentas) and used as template for in vitro transcription in 50 mM Tris-HCl, pH 7.5, 15 mM MgCl2, 5 mM DTT and 2 mM spermidine with 2 mM each of individual nucleoside triphosphates. Recombinant T7 RNA polymerase (0.1 mg ml 1 per reaction) and inorganic pyrophosphatase (1 U ml 1 per reaction, Fermentas) were added and the reaction was incubated for 5 h at 37 C. RNA was puried by anion exchange chromatography as described previously53 and ethanol precipitated. Both in vitro transcribed and synthetic nucleic acid duplexes (Integrated DNA Technologies) were annealed in 10 mM NaCl, 20 mM Tris-HCl, pH 8.0, by heating to 85 C and slow cooling to room temperature.
Nucleic acid-binding assays. FP was used to detect the formation of DBD-nucleic acid complexes. Indicated amounts of DBD were added to wells containing 10 nM of 50 carboxyuorescein-labeled nucleic acids. For competition assays, labelled
DNA was used at a concentration 1.2 times higher than the GR( )GRE Kd.
Reactions were performed in 100 mM NaCl, 20 mM Tris-HCl, pH 7.4, 5% glycerol and measured with a Biotek Synergy plate-reader (BioTek) at an excitation/emission wavelength of 485/528 nm. FP data were analysed and graphed using GraphPad Prism 5 (Graphpad Software, Inc.). Error is shown as s.e.m., and was normalized to the mean for gures showing logKd. Sequences used in binding experiments can be found in Supplementary Fig. 1. All binding experiments were performed at least in duplicate, with three internal replicates.
Ultraviolet melting assays. Ultraviolet melting assays were conducted as described previously54. Briey, samples containing 25 mg RNA in a solution of10 mM Tris, pH 7.4, and 20 mM NaCl were melted and ultraviolet absorption collected on a Varian Cary 400 ultravioletvisible spectrophotometer. Sample temperatures were measured with an in-cell temperature probe. First derivatives of the melting curves were calculated in GraphPad Prism 5.
Hydroxyl radical probing. In vitro transcribed Gas5 GREM RNA was treated with FastAP (Fermentas) and 50-end labelled using [g-32P]ATP and T4 polynucleotide kinase. Labelled RNA was urea denaturing gel puried and annealed by heating at 65 C for 10 min and slowly cooling to room temperature before use. GR was dialysed against 20 mM Tris, pH 7.5, 100 mM NaCl. In a total volume of 25 ml, labelled RNA (50,000 c.p.m.) was incubated without or with GR (0.2, 0.8, 3 or12 mM) and hydroxyl radicals produced by adding 1 ml each of 50 mM Fe(SO4)2,
100 mM EDTA, 250 mM ascorbic acid and 3% (v/v) hydrogen peroxide. The reaction was allowed to proceed on ice for 5 min before quenching by ethanol precipitation in the presence of yeast tRNA (0.4 mg ml 1) as a carrier and resolving the RNA products by 12% urea denaturing-polyacrylamide gel electrophoresis for 1.5 h at 55 W. Control experiments with labelled RNA and GR were preformed to ensure no contaminating RNases were present in the E. coli-expressed protein. Band quantication was performed with ImageQuant applying the Rubber Band background subtraction. For normalization, the intensity of each band was measured and normalized to the most intense band in 0 mM GR. The normalized intensities were compared between 0 and 12 mM GR. A nucleotide was considered strongly protected/enhanced if the difference in normalized intensity was greater () 20%, or moderately protected if the difference was 10%.
Crystallization and structure analysis. Bipyramidal crystals of the Gas5 GREM duplex appeared in two conditions. Crystals grown in 0.05 M sodium succinate, pH5.5, 0.5 mM spermine, 0.02 M MgCl2 and 3 M ammonium sulfate were frozen directly in liquid N2. Data from these crystals were collected at 100 K at the Emory University home source to a resolution of 2.2 at a wavelength of 1.54 . Crystals that formed in 0.1 M citric acid, pH 4, and 3 M ammonium sulfate were cryo-protected in 0.1 M citric acid, pH 4, 3 M ammonium sulfate and 10% glycerol and ash-frozen in liquid N2. Data from these crystals were collected at the Advanced
Photon Source BM-22 at a wavelength of 1.00 , and data from both crystals were
10 NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications
& 2014 Macmillan Publishers Limited. All rights reserved.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395 ARTICLE
integrated and indexed in HKL-2000. Phases were determined using molecular replacement from an ideal RNA helix modelled in Coot55, using PHASER in the PHENIX suite56. Crystal twinning was detected using phenix.xtriage, and twin renement was performed in phenix.rene56. Molprobity indicated no incorrect sugar puckers, bad bonds or bad angles in both crystal structures. The composite omit map utility within PHENIX was used to generate the simulated annealing composite omit map56. Representative electron density is shown in Supplementary Fig. 7. RNA and DNA structure analyses were performed in 3DNA57, using rened P-P distances to determine major and minor groove widths. Figures of models and crystal structures were generated in the PyMOL Molecular Graphics System (Schrdinger LLC).
NMR. NMR data were collected at 25 C on a Bruker 700 MHz 1H frequency equipped with a QCI cryoprobe. For RNA NMR experiments, the 33 nt Gas5 RNA (Supplementary Fig. 1) was reconstituted after ethanol precipitation in 20 mM phosphate, 50 mM KCl, 10% D2O buffer, pH 7.4 to a nal concentration of10 mg ml 1. The RNA sample was annealed by denaturing at 95 C for 5 min and equilibrating to room temperature (2023 C) overnight. Two-dimensional 1H-detected NOESY and total correlation spectroscopy spectra were collected using 100- and 200-ms mixing times for Gas5 RNA and after adding equimolar concentration of GR DBD. The proton carrier frequency was set coincident with the water resonance for all experiments. For protein NMR experiments, 2D [1H,15N]-HSQC spectra were collected for free 15N-labelled GR DBD protein or complexed with 33 nt Gas5 RNA in the same buffer as above. Chemical shift perturbations were assigned using previously published GR DBD NMR chemical shifts29 and calculated using the minimum chemical shift perturbation procedure58. Data were analysed with NMRViewJ (OneMoon Scientic, Inc.)59.
Modelling of the GR DBD-Gas5 RNA complex. NMR chemical shift perturbation and mutagenesis data were used as input to HADDOCK31 to model the GR DBDGas5 RNA complex. Before docking, the AMBER 12 package60 was used to perform molecular dynamics on the crystal structure of the Gas5 GREM duplex in order to widen the major groove. Briey, the tleap module was used to solvate the Gas5 GREM using a TIP3P octahedral box water model61 and neutralize the system. The ff12SB force eld was employed in the calculations with the sander module used for the equilibration period and the pmemd.cuda code62,63 used on a graphics processor unit for the production runs. The system was equilibrated in a multi-step process64, starting with 10,000 steps of energy minimization (5,000 steps of steepest descent, followed by 5,000 steps of conjugate gradient); all non-water and non-hydrogen atoms were restrained during this minimization step. The systems were then equilibrated for 200 ps in the canonical NVT ensemble65 during which time the temperature was ramped from 10295 K during the rst 100 ps and the restraints on the solute atoms were retained. Particle-MESH-Ewald periodic boundary conditions and a cutoff of 1 nm for both electrostatic and Lennard-Jones interactions were employed; the SHAKE algorithm66 was applied to constrain bonds to hydrogen atoms, and a time step of 1 fs was used. After HADDOCK docking, the lowest energy docked model from the best scoring cluster was used as the representative model. Statistics for the highest scoring cluster are presented in Supplementary Table 5.
Cell culture. Human adherent cell lines, 22Rv1 (prostate carcinoma cells) and MCF-7 (breast carcinoma cells), and suspension cell lines, Jurkat, CEM-C7 (both T-lymphoblastic leukemia cells) and JeKo-1 (Mantle cell B lymphomacells) were routinely cultured in R-10 medium (RPMI-1640 medium supplemented with L-
glutamine (2 mM), fetal bovine serum (10%) and gentamicin (50 mg ml 1)) at37 C in a humidied incubator with 5% CO2. CEM-C7 and Jurkat cells were derived from ref. 67, the 22Rv1 cells used are an apoptosis-sensitive clone described in ref. 68, MCF-7 cells were purchased from American Type Culture Collection and JeKo1 cells were a gift of Dr. Aneela Majid.
For experiments to determine the inuence of Gas5 on androgen signalling, 22Rv1 cells were switched to prfR-10DCSS (phenol red-free RPMI-1640 medium supplemented with L-glutamine (2 mM), dextran charcoal-stripped fetal bovine serum (10%) and gentamicin (50 mg ml 1)) at 24 h before transfection. All experiments were carried out using cells in the logarithmic phase of growth.
Plasmid DNA transfection. WT Gas5 (NR_002578.2 bases 1631) was cloned into the pcDNA3.1 vector and the G549A mutation made with the Quikchange site-directed mutagenesis kit (Stratagene). 22Rv1, MCF7 cells (each at 2 106 cells
in 0.1 ml Nucleofector solution V) and JeKo-1 cells (5 106 cells in 0.1 ml
Nucleofector solution R) were nucleofected with 2 mg plasmid, using programmes X-001, E-014 and X-001, respectively. Cells were diluted to 2 ml with R-10 medium (or prfR-10DCSS medium, as appropriate) and cultured in six-well plates.
Determination of apoptosis and cell survival. Adherent cell lines were trypsinized at 24 h post-nucleofection, samples were collected for RNA isolation, and cells were re-plated in 12-well plates (8 104 cells per well). For 22Rv1 and MCF-7
cells, additional samples were irradiated with ultraviolet light to induce apoptosis before re-plating: cells (105 per ml medium) in plastic Petri dishes (lids removed)
were exposed to a dose of 40 J m 2 ultraviolet-C light, then immediately centrifuged and resuspended in fresh medium. After culture for 24 h (22Rv1) or 48 h (MCF7), cells were trypsinized, and adherent and non-adherent cells were combined. Suspension cell lines were also collected at 24 h following transfection for total RNA isolation and for re-plating at 2 105 cells per well in 12-well plates. To
determine viability, cells were stained with 0.1% nigrosin (w/v) and counted using a haemocytometer; cells which excluded the dye were considered to be viable. To determine apoptosis, cells were stained with acridine orange (25 mg ml 1), and the proportion of cells containing condensed or fragmented chromatin was scored by uorescence microscopy (Z200 cells per treatment were scored). In some experiments, the proportion of cells containing activated caspase activity was determined using a commercial Caspatag assay (CaspaTag Pan-Caspase In Situ Assay Kit, Millipore) and uorescence microscopy (Z200 cells per treatment were scored), according to the supplied instructions.
Clonogenic assay. Long-term survival and proliferation of transfected JeKo-1, CEM-C7 and Jurkat cells were assessed by the ability of the cells to form colonies in soft agar. An equal proportion of the culture from each experimental condition was diluted in 5 ml Iscoves medium (Sigma) containing 20% heat-inactivated fetal calf serum, 10% cell conditioned medium and 0.3% Noble agar (Difco) and plated in 60 mm dishes. Dishes were also overlaid with 2.5 ml Iscoves complete medium containing 10% cell conditioned medium. The number of colonies formed was counted following 23 weeks incubation at 37 C in 5% CO2.
Determination of androgen sensitivity. 22Rv1 cells were trypsinized at 24 h post-nucleofection and cells were re-plated in 12-well plates (8 104 cells per well) in
prfR-10DCSS. Cells were allowed to attach to plates for 6 h, then treated with 10 nM R1881 in prfR-10DCSS; controls received 0.05% DMSO. After 4 h, cells were collected in TRIZOL reagent (Invitrogen) for total RNA isolation.
Real-time PCR analysis of gene expression. Total RNA was isolated using TRIZOL reagent (Invitrogen), treated with RQ1 RNase-free DNase (Promega) then reverse transcribed using random hexamer priming and SuperScript II Reverse Transcriptase (Invitrogen), according to the supplied protocols. For determination of Gas5 levels, real-time PCR was conducted using SensiFast Probe Hi-ROX kit (Bioline) and Taq Man Gene Expression Assays (Applied Biosystems; assay codes Hs03464472_m1 for GAS5 and Hs99999901_m1 for 18S). For determination of expression levels of androgen-responsive genes, real-time PCR was conducted using SensiFast SYBR Hi-ROX kit (Bioline) according to the supplied instructions and primer sets specic for: KLK2 (forward: 50-ATGTGTGCTAGAGCTTA
CTC-30; reverse: 50-AAGTGGACCCCCAGAATCAC-30); KLK3 (forward: 50-CCA AGTTCATGCTGTGTGCT-30; reverse: 50-CCCATGACGTGATACCTTGA-30); FKBP5 (forward: 50-CGCAGGATATACGCCAACAT-30; reverse: 50-GAAGTCT TCTTGCCCATTGC-30) and ACTB (forward: 50-GTTTGAGACCTTCAACA CCC-30; reverse: 50-ATGTCACGCACGATTTCCC-30). Assays contained 10 ng sample cDNA in a nal volume of 25 ml and were run on an ABI Prism Sequence Detection System model 7000. For adherent cell lines, standard curves, comprising0.260 ng cDNA (prepared from parental cells), were included with each assay to allow relative quantiation; standard curves of threshold cycle (CT) value versus log input standard cDNA were constructed by linear regression, and the equation of the line was used to calculate input amounts of samples from their respective CT values. For suspension cell lines, quantitation of Gas5 was determined using the comparative CT method, using parental cells as calibrators. Gas5 levels were expressed relative to 18S rRNA, and levels of androgen-responsive genes were expressed relative to ACTB.
Evolutionary analysis. Genomic sequences of the GAS5 locus were downloaded from the Ensembl database50. For species where Gas5 was not annotated, the exon 12 sequence was determined using splice prediction downstream of SNORD81 (ref. 69). Sequences were aligned in Geneious (Biomatters), and evolutionary rate analysis was conducted with the haplorhine sequences in MEGA 5 with the Tamura-Nei model, using all sites and three gamma rate categories70.
References
1. Galperin, M. Y. & Koonin, E. V. From complete genome sequence to complete understanding? Trends Biotechnol. 28, 398406 (2010).
2. Consortium, I.H.G.S. Initial sequencing and analysis of the human genome. Nature 409, 860921 (2001).
3. Kapranov, P. et al. The majority of total nuclear-encoded non-ribosomal RNA in a human cell is dark matter un-annotated RNA. BMC Biol. 8, 149149 (2010).
4. Khalil, A. M. & Rinn, J. L. RNA-protein interactions in human health and disease. Semin. Cell Dev. Biol. 22, 359365 (2011).
5. Guttman, M. et al. Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature 458, 223227 (2009).
6. Guttman, M. et al. lincRNAs act in the circuitry controlling pluripotency and differentiation. Nature 477, 295300 (2011).
NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 11
& 2014 Macmillan Publishers Limited. All rights reserved.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395
7. Huarte, M. et al. A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response. Cell 142, 409419 (2010).
8. Loewer, S. et al. Large intergenic non-coding RNA-RoR modulates reprogramming of human induced pluripotent stem cells. Nat. Genet. 42, 11131117 (2010).
9. Sharma, S. et al. Dephosphorylation of the nuclear factor of activated T cells (NFAT) transcription factor is regulated by an RNA-protein scaffold complex. Proc. Natl Acad. Sci. USA 108, 1138111386 (2011).
10. Guttman, M. et al. Ab initio reconstruction of cell typespecic transcriptomes in mouse reveals the conserved multi-exonic structure of lincRNAs. Nature Biotechnol. 28, 503510 (2010).
11. Ponjavic, J., Ponting, C. P. & Lunter, G. Functionality or transcriptional noise? Evidence for selection within long noncoding RNAs. Genome Res. 17, 556565 (2007).
12. Ulitsky, I., Shkumatava, A., Jan, C. H., Sive, H. & Bartel, D. P. Conserved function of lincRNAs in vertebrate embryonic development despite rapid sequence evolution. Cell 147, 15371550 (2011).
13. Tsai, M.-C. et al. Long Noncoding RNA as Modular Scaffold of Histone Modication Complexes. Science 392, 689693 (2010).
14. Kino, T., Hurt, D. E., Ichijo, T., Nader, N. & Chrousos, G. P. Noncoding RNA gas5 is a growth arrest- and starvation-associated repressor of the glucocorticoid receptor. Sci. Signal 3, ra8ra8 (2010).
15. Frankish, A., Mudge, J. M., Thomas, M. & Harrow, J. The importance of identifying alternative splicing in vertebrate genome annotation. Database 2012 (2012).
16. Higa-Nakamine, S. et al. Loss of ribosomal RNA modication causes developmental defects in zebrash. Nucleic Acids Res. 40, 391398 (2011).
17. Gibb, E. A. et al. Human cancer long non-coding RNA transcriptomes. PLoS ONE 6, e25915e25915 (2011).
18. Mourtada-Maarabouni, M., Hedge, V. L., Kirkham, L., Farzaneh, F. & Williams, G. T. Growth arrest in human T-cells is controlled by the non-coding RNA growth-arrest-specic transcript 5 (GAS5). J. Cell Sci. 123, 11811181 (2010).
19. Schneider, C., King, R. M. & Philipson, L. Genes specically expressed at growth arrest of mammalian cells. Cell 54, 787793 (1988).
20. Mourtada-Maarabouni, M., Hasan, A. M., Farzaneh, F. & Williams, G. T. Inhibition of human T-cell proliferation by mammalian target of rapamycin (mTOR) antagonists requires noncoding RNA growth-arrest-specic transcript 5 ( GAS5 ). Mol. Pharmacol. 78, 1928 (2010).
21. Mourtada-Maarabouni, M., Pickard, M. R., Hedge, V. L., Farzaneh, F. & Williams, G. T. GAS5, a non-protein-coding RNA, controls apoptosis and is downregulated in breast cancer. Oncogene 28, 195208 (2009).
22. Pickard, M. R., Mourtada-Maarabouni, M. & Williams, G. T. Long non-coding RNA GAS5 regulates apoptosis in prostate cancer cell lines. Biochim. Biophys. Acta 1832, 16131623 (2013).
23. Meijsing, S. H. et al. DNA binding site sequence directs glucocorticoid receptor structure and activity. Science 324, 407410 (2009).
24. Schwabe, J. W. R., Chapman, L., Finch, J. T. & Rhodes, D. The crystal structure of the estrogen receptor DNA-binding domain bound to DNA: how receptors discriminate between their response elements. Cell 75, 567578 (1993).
25. Tolbert, B. S. et al. Major groove width variations in RNA structures determined by NMR and impact of 13C residual chemical shift anisotropy and 1H-13C residual dipolar coupling on renement. J. Biomol. NMR 47, 205219 (2010).
26. Hudson, W. H., Youn, C. & Ortlund, E. A. The structural basis of direct glucocorticoid-mediated transrepression. Nat. Struct. Mol. Biol. 20, 5358 (2013).
27. Battiste, J. L. et al. Helix-RNA major groove recognition in an HIV-1 Rev peptide-RRE RNA complex. Science 273, 15471551 (1996).
28. Weeks, K. & Crothers, D. Major groove accessibility of RNA. Science 261, 15741577 (1993).
29. Watson, L. C. et al. The glucocorticoid receptor dimer interface allosterically transmits sequence-specic DNA signals. Nat. Struct. Mol. Biol 20, 876883 (2013).
30. Luisi, B. F. et al. Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352, 497505 (1991).
31. de Vries, S. J., van Dijk, M. & Bonvin, A.M.J.J. The HADDOCK web server for data-driven biomolecular docking. Nat. Protoc. 5, 883897 (2010).
32. Strobel, S. & Cech, T. Minor groove recognition of the conserved G.U pair at the Tetrahymena ribozyme reaction site. Science 267, 675679 (1995).
33. Magali, F. & Schimmel, P. Subtle atomic group discrimination in the RNA minor groove. Proc. Natl Acad. Sci. USA 94, 1129111294 (1997).
34. Romanuik, T. L. et al. LNCaP Atlas: gene expression associated with in vivo progression to castration-recurrent prostate cancer. BMC Med. Genomics 3, 43 (2010).
35. John, S. et al. Chromatin accessibility pre-determines glucocorticoid receptor binding patterns. Nature Genet. 43, 264268 (2011).
36. Shu, Z. & Bevilacqua, P. C. Isolation and characterization of thermodynamically stable and unstable RNA hairpins from a Triloop Combinatorial Library. Biochemistry 38, 1536915379 (1999).
37. Hirose, T. & Steitz, J. A. Position within the host intron is critical for efcient processing of box C/D snoRNAs in mammalian cells. Proc. Natl Acad. Sci. USA 98, 1291412919 (2001).
38. Batzer, M. A. & Deininger, P. L. Alu repeats and human genomic diversity. Nat. Rev. Genet. 3, 370379 (2002).
39. Surjit, M. et al. Widespread negative response elements mediate direct repression by agonist-liganded glucocorticoid receptor. Cell 145, 224241 (2011).
40. Ali, M. & Vedeckis, W. The glucocorticoid receptor protein binds to transfer RNA. Science 235, 467470 (1987).
41. Ishmael, F. T. et al. The human glucocorticoid receptor as an RNA-binding protein: global analysis of glucocorticoid receptor-associated transcriptsand identication of a target RNA motif. J. Immunol. 186, 11891198 (2011).
42. Hudson, W. H. & Ortlund, E. A. Proteins that bind DNA and RNA: structure, function, and evolution. Nat. Rev. Mol. Cell. Biol 15, 749760 (2014).
43. Huang, D.-B. et al. Crystal structure of NF-kB (p50)2 complexed to a high-afnity RNA aptamer. Proc. Natl Acad. Sci. USA 100, 92689273 (2003).
44. Mller, C. W., Rey, F. A., Sodeoka, M., Verdine, G. L. & Harrison, S. C. Structure of the NF-kB p50 homodimer bound to DNA. Nature 373, 311317 (1995).
45. Presman, D. M. et al. Live cell imaging unveils multiple domain requirements for in vivo dimerization of the glucocorticoid receptor. PLoS Biol. 12, e1001813 (2014).
46. Cote, G. J. & Gagel, R. F. Dexamethasone differentially affects the levels of calcitonin and calcitonin gene-related peptide mRNAs expressed in a human medullary thyroid carcinoma cell line. J. Biol. Chem. 261, 1552415528 (1986).
47. Kosaki, A. & Webster, N. J. Effect of dexamethasone on the alternative splicing of the insulin receptor mRNA and insulin action in HepG2 hepatoma cells.J. Biol. Chem. 268, 2199021996 (1993).48. Lai, G.-J. & McCobb, D. P. Opposing actions of adrenal androgens and glucocorticoids on alternative splicing of Slo potassium channels in bovine chromafn cells. Proc. Natl Acad. Sci. USA 99, 77227727 (2002).
49. Webster, J. C. & Cidlowski, J. A. Mechanisms of Glucocorticoid-receptor-mediated repression of gene expression. Trends Endocrinol. Metab. 10, 396402 (1999).
50. Flicek, P. et al. Ensembl 2011. Nucleic Acids Res. 39, D800D806 (2011).51. Schorderet, P. & Duboule, D. Structural and functional differences in the long non-coding RNA hotair in mouse and human. PLoS Genet. 7, e1002071 (2011).
52. Hudson, W. H., Youn, C. & Ortlund, E. A. Crystal structure of the mineralocorticoid receptor DNA binding domain in complex with DNA. PLoS One 9, e107000 (2014).
53. Easton, L. E., Shibata, Y. & Lukavsky, P. J. Rapid, nondenaturing RNA purication using weak anion-exchange fast performance liquid chromatography. RNA 16, 647653 (2010).
54. Wahid, A. M., Coventry, V. K. & Conn, G. L. The PKR-binding domain of adenovirus VA RNAI exists as a mixture of two functionally non-equivalent structures. Nucleic Acids Res. 37, 58305837 (2009).
55. Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallogr. D60, 21262132 (2004).
56. Adams, P. D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. D66, 213221 (2010).
57. Lu, X.-J. & Olson, W. K. 3DNA: a versatile, integrated software system for the analysis, rebuilding and visualization of three-dimensional nucleic-acid structures. Nat. Protoc. 3, 12131227 (2008).
58. Williamson, M. P. Using chemical shift perturbation to characterise ligand binding. Prog. Nucl. Mag. Res. Sp 73, 116 (2013).
59. Johnson, B. in Protein NMR Techniques Vol. 278 (ed. Downing, A. K.) 313352 (Humana, 2004).
60. Case, D. A. et al. The Amber biomolecular simulation programs. J. Comput. Chem. 26, 16681688 (2005).
61. Jorgensen, W. L., Chandrasekhar, J., Madura, J. D., Impey, R. W. & Klein, M. L. Comparison of simple potential functions for simulating liquid water. J. Biol. Chem. 79, 926935 (1983).
62. Gotz, A. W. et al. Routine microsecond molecular dynamics simulations with AMBER on GPUs. 1. Generalized Born. J. Chem. Theory Comput. 8, 15421555 (2012).
63. Le Grand, S., Gtz, A. W. & Walker, R. C. SPFP: Speed without compromise A mixed precision model for GPU accelerated molecular dynamics simulations. Comput. Phys. Commun. 184, 374380 (2013).
64. Shang, Y. & Simmerling, C. Molecular dynamics applied in drug discovery: the case of HIV-1 protease. Methods Mol. Biol. 819, 527549 (2012).
65. Allen, M. P. & Tildesley, D. J. Computer Simulation of Liquids (Oxford Univ., 1987).
12 NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications
& 2014 Macmillan Publishers Limited. All rights reserved.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms6395 ARTICLE
66. Ryckaert, J.-P., Ciccotti, G. & Berendsen, H. J. C. Numerical integration of the cartesian equations of motion of a system with constraints: molecular dynamics of n-alkanes. J. Comput. Phys. 23, 327341 (1977).
67. Williams, G. T., Critchlow, M. R., Hedge, V. L. & OHare, K. B. Molecular failure of apoptosis: inappropriate cell survival and mutagenesis? Toxicol. Lett. 102-103, 485489 (1998).
68. Pickard, M. R., Darling, D., Farzaneh, F. & Williams, G. T. Preparation and characterization of prostate cell lines for functional cloning studies to identify regulators of apoptosis. J. Androl. 30, 248258 (2009).
69. Reese, M., Eeckman, F., Kulp, D. & Haussler, D. Improved Splice Site Detection in Genie. J. Comput. Biol. 4, 311323 (1997).
70. Tamura, K. et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 27312739 (2011).
Acknowledgements
We thank Jo Linpinsel for assistance with the ultraviolet melting experiments, Christine Dunham for the T7 polymerase expression construct, Keith Yamamoto and Lisa Watson for the NMR restraints for the GR DBD and GR DBDGha complex, and Naoya Kenmochi for helpful discussion regarding sh Gas5. W.H.H. was supported by the Emory-NIH Graduate Training in Pharmacological Studies Grant 5T32GM008602-14, an American Heart Association predoctoral fellowship (13PRE16920012), and E.A.O. and W.H.H. were supported by the National Institute of Diabetes and Digestive and Kidney Diseases of the National Institutes of Health under award number RO1DK095750. M.R.P., M.M.-M. and G.T.W. are grateful to the UK charities Breast Cancer Campaign, Leukemia and Lymphoma Research and Prostate Cancer UK for nancial support. This research was also supported by startup funds to E.A.O. from Emory University and startup funds to D.J.K. from The Scripps Research Institute. Some X-ray data were collected at Southeast Regional Collaborative Access Team (SER-CAT) 22-BM beamline
at the Advanced Photon Source, Argonne National Laboratory. Supporting institutions may be found at http://http://www.ser-cat.org/members.html
Web End =www.ser-cat.org/members.html . Use of the Advanced Photon Source was supported by the US Department of Energy, Ofce of Science, Ofce of Basic Energy Sciences, under Contract No. W-31-109-Eng-38.
Author contributions
W.H.H. performed binding studies, crystallographic analysis, mutagenesis, protein expression, in vitro transcription and evolutionary analysis. M.R.P and G.T.W. performed apoptosis, survival and reverse transcription (RT)PCR assays in MCF-7 and 22Rv1 cells. M.M.-M. and G.T.W. performed apoptosis, survival and RTPCR assays in suspension cell lines. I.M.S.deV. and D.J.K. performed NMR assays on the GR-Gas5 complex and HADDOCK modelling, and E.G.K. and G.L.C. performed OH foot
printing on the GR-Gas5 complex. W.H.H. and E.A.O. conceived the experiments and wrote the manuscript with input from all authors.
Additional information
Accession codes: The Gas5 GREM duplex crystal structures have been deposited to the PDB under accession numbers 4MCE and 4MCF.
Supplementary Information accompanies this paper at http://www.nature.com/naturecommunications
Web End =http://www.nature.com/ http://www.nature.com/naturecommunications
Web End =naturecommunications
Competing nancial interests: The authors declare no competing nancial interests.
Reprints and permission information is available online at http://npg.nature.com/reprintsand
Web End =http://npg.nature.com/ http://npg.nature.com/reprintsand
Web End =reprintsand permissions/
How to cite this article: Hudson, W. H. et al. Conserved sequence-specic lincRNA-steroid receptor interactions drive transcriptional repression and direct cell fate.
Nat. Commun. 5:5395 doi: 10.1038/ncomms6395 (2014).
NATURE COMMUNICATIONS | 5:5395 | DOI: 10.1038/ncomms6395 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 13
& 2014 Macmillan Publishers Limited. All rights reserved.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright Nature Publishing Group Nov 2014
Abstract
The majority of the eukaryotic genome is transcribed, generating a significant number of long intergenic noncoding RNAs (lincRNAs). Although lincRNAs represent the most poorly understood product of transcription, recent work has shown lincRNAs fulfill important cellular functions. In addition to low sequence conservation, poor understanding of structural mechanisms driving lincRNA biology hinders systematic prediction of their function. Here we report the molecular requirements for the recognition of steroid receptors (SRs) by the lincRNA growth arrest-specific 5 (Gas5), which regulates steroid-mediated transcriptional regulation, growth arrest and apoptosis. We identify the functional Gas5-SR interface and generate point mutations that ablate the SR-Gas5 lincRNA interaction, altering Gas5-driven apoptosis in cancer cell lines. Further, we find that the Gas5 SR-recognition sequence is conserved among haplorhines, with its evolutionary origin as a splice acceptor site. This study demonstrates that lincRNAs can recognize protein targets in a conserved, sequence-specific manner in order to affect critical cell functions.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer




