Wnt/[beta]-catenin pathway regulates MGMT gene expression in cancer and inhibition of Wnt signalling prevents chemoresistance

Abstract

The DNA repair enzyme O6-methylguanine-DNA methyltransferase (MGMT) is commonly overexpressed in cancers and is implicated in the development of chemoresistance. The use of drugs inhibiting MGMT has been hindered by their haematologic toxicity and inefficiency. As a different strategy to inhibit MGMT we investigated cellular regulators of MGMT expression in multiple cancers. Here we show a significant correlation between Wnt signalling and MGMT expression in cancers with different origin and confirm the findings by bioinformatic analysis and immunofluorescence. We demonstrate Wnt-dependent MGMT gene expression and cellular co-localization between active β-catenin and MGMT. Pharmacological or genetic inhibition of Wnt activity downregulates MGMT expression and restores chemosensitivity of DNA-alkylating drugs in mouse models. These findings have potential therapeutic implications for chemoresistant cancers, especially of brain tumours where the use of temozolomide is frequently used in treatment.

ARTICLE

Received 18 Jan 2015 | Accepted 14 Oct 2015 | Published 25 Nov 2015

DOI: 10.1038/ncomms9904 OPEN

Wnt/b-catenin pathway regulates MGMT gene expression in cancer and inhibition of Wnt signalling prevents chemoresistance

Malin Wickstrm1,*, Cecilia Dyberg1,*, Jelena Milosevic1,*, Christer Einvik2, Raul Calero1, Baldur Sveinbjrnsson1,3, Emma Sandn4, Anna Darabi4, Peter Siesj4, Marcel Kool5, Per Kogner1, Ninib Baryawno6,7,8,**& John Inge Johnsen1,**

The DNA repair enzyme O6-methylguanine-DNA methyltransferase (MGMT) is commonly overexpressed in cancers and is implicated in the development of chemoresistance. The use of drugs inhibiting MGMT has been hindered by their haematologic toxicity and inefciency. As a different strategy to inhibit MGMT we investigated cellular regulators of MGMT expression in multiple cancers. Here we show a signicant correlation between Wnt signalling and MGMT expression in cancers with different origin and conrm the ndings by bioinformatic analysis and immunouorescence. We demonstrate Wnt-dependent MGMT gene expression and cellular co-localization between active b-catenin and MGMT. Pharmacological or genetic inhibition of Wnt activity downregulates MGMT expression and restores chemosensitivity of DNA-alkylating drugs in mouse models. These ndings have potential therapeutic implications for chemoresistant cancers, especially of brain tumours where the use of temozolomide is frequently used in treatment.

1 Department of Womens and Childrens Health, Childhood Cancer Research Unit, Karolinska Institutet, Stockholm S-17176, Sweden. 2 Department of Pediatrics, University Hospital of North Norway, Troms N-9038, Norway. 3 Department of Medical Biology, University of Troms, Troms N-9037, Norway.

4 Department of Clinical Sciences Lund, Glioma Immunotherapy Group, Division of Neurosurgery, Lund University, Lund S-22185, Sweden. 5 Division of Pediatric Neuro-Oncology, German Cancer Research Center, DKFZ, Heidelberg 69120, Germany. 6 Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, Massachusetts 02138, USA. 7 Center for Regenerative Medicine and the Cancer Center, Massachusetts General Hospital, Boston, Massachusetts 02114, USA. 8 Harvard Stem Cell Institute, Cambridge, Massachusetts 02138, USA. * These authors contributed equally to this work. ** These authors jointly supervised this work. Correspondence and requests for materials should be addressed to N.B. (email: mailto:[email protected]

Web End [email protected] ) or to J.I.J. (email: mailto:[email protected]

Web End [email protected] ).

NATURE COMMUNICATIONS | 6:8904 | DOI: 10.1038/ncomms9904 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 1

& 2015 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9904

One of the major hurdles in cancer treatment is development of resistance against chemotherapeutic drugs. MGMT efciently removes alkylating lesions at

the O6 position of guanine and treatment failure caused by the ability of MGMT to repair DNA damage induced by DNA alkylators or chloroethylating agents is frequently observed1. Specically, temozolomide, widely used in treatment of malignant brain tumours, has low effectiveness in tumours with elevated MGMT activity2,3. Unfortunately, systemic clinical use of MGMT inhibitors has been restricted mainly because of an increase in haematologic toxicity to DNA alkylators4,5, and failure in restoring temozolomide sensitivity to temozolomide-resistant glioblastoma multiforme6.

MGMT is an evolutionary conserved and ubiquitously expressed enzyme that is regulated by multiple mechanisms including epigenetic silencing of the MGMT gene by promoter methylation, frequently observed in gliomas and colon cancer7. Also histone modications and aberrant expression of transcriptional activators and repressors, as well as microRNAs binding to the 30-untranslated region of the MGMT gene contribute to the differential expression levels of MGMT in various tumours and normal tissues7. Given that expression of MGMT is regulated by multiple molecular mechanisms we searched for cellular regulators of MGMT that can be specically targeted to lower the levels of MGMT in tumour cells and resensitize these tumours to chemotherapeutic drugs. We show that activation of the canonical Wnt/b-catenin signalling cascade induce MGMT expression, and that inhibition of Wnt signalling augment the effects of alkylating drugs and restore chemosensitivity in different cancers.

ResultsWnt/b-catenin activation correlates with MGMT expression.

To search for cellular regulators of MGMT as an alternative approach to inhibit expression of MGMT in tumour cells we used gene ontology analysis to test for aberrantly expressed genes or signal transduction cascades in cancers with elevated expression of MGMT. Analysis of expression cohorts of tumours with neural origin showed that high MGMT expression levels correlate with poor survival in adult gliomas and childhood neuroblastoma, whereas in medulloblastoma high levels of MGMT was signicantly correlated to the Wnt molecular subgroup with high frequency of mutations in Wnt signalling key molecules (Fig. 1a,b, Supplementary Fig. 1). Moreover, in colon cancer, where aberrant Wnt signalling is common8, high expression of MGMT correlated with poor prognosis (Fig. 1a, Supplementary Fig. 1). Pathway-specic gene-expression proling to search for regulators of MGMT expression showed gene-expression signatures that associated with Wnt signalling in colon cancer, neuroblastoma, glioma, as well as for the Wnt-driven medulloblastoma subgroup (Supplementary Fig. 2). K-means clustering of Wnt gene-expression proles identied subgroups expressing signicantly higher levels of MGMT (Supplementary Figs 2ad and 3ad). Further, immunouorescence analysis on human tumour tissues showed co-localization of nuclear b-catenin and MGMT in subtypes of colon cancer, glioma, medulloblastoma and neuroblastoma (Fig. 1c). Co-localization of b-catenin and MGMT was also observed in HT-29 adenocarcinoma xenografts and in lower crypt cells of normal colon (Supplementary Fig. 4). We also detected a correlation between b-catenin as shown by western blots against the active form of b-catenin dephosphorylated on Ser37 or Thr41 and the downstream effector Axin 2 and MGMT expression in the majority of cancer cell lines derived from these cancers (Fig. 1d,e, Supplementary Fig. 7a).

Wnt/b-catenin regulates MGMT expression. To investigate if Wnt signalling is involved in the regulation of MGMT expression, we genetically blocked the activity of Wnt signalling using shRNA that render the Wnt signalling activity within cancer cells. For this purpose we used the LS174T colon carcinoma cell line which is stably transfected with an inducible b-catenin shRNA and downregulates b-catenin expression following addition of doxycycline9. Knockdown of b-catenin in LS174T cells inhibited MGMT expression (Fig. 2ac, Supplementary Fig. 7b).

To further investigate the regulatory inuences of b-catenin on MGMT transcription we analysed the 50-anking region of the hmMGMT gene for putative Tcf/Lef transcription factor-binding sites and detected eight putative binding sites within the MGMT promoter/enhancer (Supplementary Fig. 5). Transfection experiments using the MGMT-50 regions containing different numbers of Tcf/Lef-binding sites cloned into luciferase reporter plasmids (Fig. 2d) showed an enhancement of luciferase activity with increasing numbers of Tcf/Lef-binding sites upon activation of b-catenin by inhibition of GSK-3b using LiCl10 or by over-expression of b-catenin (Fig. 2e). Activation of Wnt signalling with prostaglandin E2 (PGE2) (ref. 11) induced an increase in luciferase activity, while inhibition of PGE2 production with the cyclooxygenase-2 (Cox-2) inhibitor celecoxib showed a concentration-dependent reduction (Fig. 2e). Similarly, overexpression (Fig. 2f) or targeted knockdown (Fig. 2f) of b-catenin lead to an increase or decrease, respectively, of the

MGMT promoter in SK-N-AS neuroblastoma, DAOY medulloblastoma, SW480 and LS174T colon carcinoma cells (Fig. 2f). These results further validate that the canonical Wnt signalling cascade directly regulates the expression of MGMT.

Wnt inhibition augments temozolomide-mediated chemotherapy. Next, we tested a panel of Wnt signalling inhibitors in combination with the DNA-alkylating drug temozolomide on colon carcinoma, medulloblastoma, neuroblastoma and glioma cell survival. The agents tested were the non-specic Wnt signalling inhibitor celecoxib10,12,13, the Porcupine inhibitors Wnt-C59 and LGK974, the tankyrase/Axin 1 inhibitors XAV-939 and G007-LK (refs 14,15) and salinomycin, which inhibits signalling by blocking phosphorylation of the Wnt co-receptor lipoprotein receptor-related protein 6 (ref. 16). Except for G007-LK and XAV-939, all Wnt inhibitors augmented the cytotoxic effects of temozolomide in the majority of the tested cancer cell lines (Fig. 3a). Celecoxib was the most profound compound inducing either an additive or synergistic effect on cell cytotoxicity in combination with temozolomide in all investigated cell lines. Celecoxib was therefore selected for further analysis.

We next compared the effect of celecoxib to restore temozolomide sensitivity in cells expressing high levels of MGMT with the MGMT-specic inhibitor O6-Benzylguanine (O6-BG). O6-BG and celecoxib induced similar cytotoxic effects on the cells in combination with temozolomide and no additional cytotoxic effects of temozolomide were observed when O6-BG was used in combination with celecoxib and temozolomide (Fig. 3b). Moreover, celecoxib downregulated both the expression of endogenous b-catenin and MGMT (Fig. 3c, Supplementary Fig. 7c), as well as transcriptional activation induced by b-catenin (Fig. 3d), whereas forced MGMT overexpression by transfection of MGMT cDNA abrogated the cytotoxic effects seen with celecoxib and temozolomide (Fig. 3e). To further test whether celecoxib can restore temozolomide sensitivity to temozolomide-resistant cancer cells in vitro we rst treated cells expressing either low or high levels of MGMT with increasing concentrations of temozolomide and measured the tumourigenic capacity using clonogenic assays. MGMT expression levels corresponded with treatment efciency

2 NATURE COMMUNICATIONS | 6:8904 | DOI: 10.1038/ncomms9904 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2015 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9904 ARTICLE

Medulloblastoma-Amsterdam (Kool)-481.000.900.800.700.600.500.400.300.200.100.00

Colon CIT (Combat)-Marisa-566

1.000.900.800.700.600.500.400.300.200.100.00

Neuroblastoma SEQC-498

P=0.0032

Glioblastoma TCGA-540

High (327) Low (177)

1.000.900.800.700.600.500.400.300.200.100.00

1.000.900.800.700.600.500.400.300.200.100.00

High (520) Low (31)

P=0.002

High (25) Low (23)

High (108) Low (390)

Overall survival probability

Relapse-free survival probability

Overall survival probability

Overall survival probability

P=0.017

P=0.015

0 24

48

72

96

120

0 24

48

72

96

120

144

168

192

0 24

48

72

96

120

144

168

192

216

240

264

0 24

48

72

96

120

144

168

192

Follow-up in months

Follow-up in months

Follow-up in months

Follow-up in months

216

ANOVA (across the groups) P =1.1E14350

300

250

200

150

100

50

0

WNT

WNT MB vs others

P =1.2E06 WNT MB vs adult CB

P =4.4E05

WNT MB vs foetal CB P =NS

WNT 53 SHH 112 Group 3 94 Group 4 164

Foetal CB 5 Adult CB 13

350 300 250 200 150 100

50

0

350 300 250 200 150 100

50 0

350 300 250 200 150 100

50 0

WNT

Others

WNT

Adult CB

WNT

Adult CB

SHH

Group 3

Group 4

Foetal CB

Adult CB

H&EMGMT/-catenin/DAPI

DAPI-cateninMGMT

Colon carcinoma

GBM Medulloblastoma Neuroblastoma

Medulloblastoma Colon cancer Glioma Neuroblastoma

Colo 320 DM

DLD

HCT-116

HT-29

RKO

SW480

U343

U373 MG

U251 MG

U87 MG

U313

T98G

SK-N-SH

SK-N-DZ

SK-N-AS

SK-N-BE(2)

IMR-32

SK-N-FI

Kelly

SH-SY5Y

DAOY

MEB-MED-8A

PFSK-1

D458 MED

D425 MED

D283 MED

UW228-3

Active -catenin (92 kDa)

-actin (45 kDa)

Axin2 (95 kDa) MGMT (21 kDa)

GAPDH (37 kDa)

1.2

Relative expression level

(MGMT/18S)

1.0

0.8

0.6

0.4

0.2

0.0

DAOY

MEB-MED-8A

PFSK-1

D458 MED

D425 MED

D283 MED

UW228-3

Colo 320LG

DLD-1

HCT-116

HT-29

RKO

SW480

U343

U373 MG

U251 MG

U87 MG

U313

T98G

SK-N-SH

SK-N-DZ

SK-N-AS

SK-N-BE(2)

IMR-32

SK-N-FI

Kelly SH-SY5Y

NATURE COMMUNICATIONS | 6:8904 | DOI: 10.1038/ncomms9904 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 3

& 2015 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9904

(IC504100 mM for DAOY, UW228-3, SK-N-AS and SW480; IC50o50 mM for the MGMT-negative cell lines PFSK-1, Figs 3f and 1d). However, when celecoxib was used in combination with temozolomide we observed a signicant restoration of temozolomide chemosensitivity in all MGMT-positive cell lines (Fig. 3f). Similar, but less efcient inhibitory effects were observed using the Porcupine inhibitors Wnt-C59 and LGK974 or the tankyrase/ Axin 1 inhibitor G007-LK (Supplementary Fig. 6). To investigate the mechanism of the demonstrated cytotoxic effect we used the LS174T colorectal carcinoma cell line with Tet-inducible shRNA against b-catenin9. A signicant increased suppression of cell growth was observed in LS174T cells treated with temozolomide where b-catenin was depleted compared with control cells. This synergistic effect could be reversed when adding MGMT cDNA to the b-catenin-depleted cells (Fig. 4a). Similarly, siRNA inhibition of b-catenin signicantly restored temozolomide cytotoxicity in SW480 cells (Fig. 4b). Moreover, a signicant inhibition of clonogenic capacity was observed in b-catenin knockdown cells treated with temozolomide compared with temozolomide-treated wild-type cells (Fig. 4c). This was accompanied by an increase of apoptosis in b-catenin knockdown cells treated with temozolomide compared with LS174T treated with temozolomide only (Fig. 4d).

Inhibition of Wnt restores temozolomide sensitivity in vivo. Celecoxib was selected for further analysis based on its ability to inhibit Wnt signalling17, downregulate MGMT expression (Figs 2e and 3c,d) and induce synergistic toxicity on tumour cells both in combination with temozolomide and several other cytotoxic drugs used as a rst-line treatment of different cancers (Fig. 3a and Supplementary Table 1). Celecoxib and other nonsteroidal anti-inammatory drugs, approved by the FDA and EMEA, have proven anti-tumourigenic effects in preclinical models and reduce the incidence and severity of various human cancers10,12,13,1720. We therefore next used pharmacological and genetic inhibition to investigate the effect of b-catenin blockade on tumour cell sensitivity to temozolomide in vivo. For this purpose we used two cell lines expressing either low (D283 MED)21 or high levels of MGMT (LS174T; Fig. 1d). Administration of temozolomide or celecoxib alone to nude mice carrying established D283 MED medulloblastoma xenografts resulted in signicant tumour growth inhibition after 12 days of treatment and the tumour volume index (TVI) was reduced by 40 and 20%, respectively, when compared with untreated controls, at the end of treatment (Fig. 5a). In combination, celecoxib and temozolomide reduced tumour

growth by 57% (Fig. 5a). The expression of MGMT was repressed in celecoxib-treated xenografts as compared with control xenograft tumours (Fig. 5b, Supplementary Fig. 7d). We also tested the effect of b-catenin knockdown using LS174T cells with Tet-inducible shRNA against b-catenin. No differences in tumour growth were observed in mice with wild-type b-catenin levels, in mice receiving doxycycline to induce b-catenin depletion, or mice treated with temozolomide only (TVI reduction with 16 and 9%, respectively; Fig. 5c). However, a signicant inhibition of tumour growth was observed in mice with b-catenin-depleted tumours treated with temozolomide (TVI was reduced with 60%; Fig. 5c). Expression of MGMT was completely blocked in bcatenin-depleted xenografts as compared with control xenograft tumours (Fig. 5d, Supplementary Fig. 7e). Together these results suggest that targeting b-catenin restores temozolomide chemosensitivity in cancer cells expressing MGMT.

DiscussionIn this study we provide an alternative strategy for targeting chemoresistant cancers by modulating MGMT protein expression through canonical Wnt cascade inhibition. Given the importance of Wnt signalling during embryonic development and the high delity of accurate DNA replication in stem cells22 it is equitable that Wnt signalling may regulate the activity of DNA repair enzymes. MGMT is a suicide enzyme that removes O6-guanosine alkylation adducts caused by alkylation agents in a one-step reaction that restores the guanosine residue to its unchanged state but renders MGMT inactive23. Hence, the expression level of MGMT is therefore fundamental for accurate DNA repair.

Although it remains to be evaluated, the indirect inhibition of MGMT via suppression of Wnt activity will most likely avoid some of the haematological toxicities observed by systemic administration of small-molecule inhibitors of MGMT. The temozolomide dosages (7.5 and 12.5 mg kg 1) used in the xenograft studies are equivalent to a human dose of 90 and 150 mg m 2, respectively24. For the treatment of brain tumours in adults an initiation regimen of 150 mg m 2 temozolomide followed by a maintenance doses of 200 mg m 2 once daily is recommended. However, in humans approximately 20% of temozolomide detected in the blood plasma (area under the concentration-time curve (AUC) 30.1 s.e.m. 6.1 mg/l-h in humans receiving 200 mg m 2 as compared with AUC 6.1 s.e.m. 1.2 mg/l-h in cerebrospinal uid, derived from 35 patients with a total of 227 plasma and 47 CSF samples was analysed) is present in the cerebrospinal uid25. Although we did not perform

Figure 1 | Activation of canonical Wnt/b-catenin correlates with MGMTexpression in tumours of different origins. (a) KaplanMeier survival estimates of high/low MGMT expression in colon carcinoma, glioblastoma, medulloblastoma and neuroblastoma. The Kaplan scanning tool in the R2 genomics analysis and visualization platform (r2.amc.nl) was used to check for MGMT mRNA expression in the different cancer types. All MGMT expression data were scanned to nd the most optimal cut-off between high and low MGMT gene expression and the log-rank test that gave the lowest P-value were calculated to search for signicant differences between tumour samples expressing high and low MGMTmRNA levels. P-values were corrected for multiple testing (one-way ANOVA). (b) MGMT expression in medulloblastoma molecular subgroups (Wnt, Shh, Group 3 and Group 4 (ref. 36). MGMT expression is signicantly (P 1.2 10 6) higher in the Wnt molecular subgroup of medulloblastoma compared with other medulloblastoma subgroups and normal

cerebellum but not foetal cerebellum. (c) Expression of MGMT and active b-catenin are localized to the same cells in clinical tumour samples from medulloblastoma, glioma, neuroblastoma and colon carcinoma. Shown are b-catenin (green), MGMT (red), DAPI (blue), overlays (top) and hematoxylin and eosin (H&E) staining. Scale bar, 20 mm. (d,e) MGMT mRNA expression correlates with active b-catenin in cell lines derived from different cancers. A correlation between active b-catenin and MGMT mRNA expression was detected in the majority of the 27 cell lines except for the sPNET cell line PFSK-1 which expressed active b-catenin but no MGMT mRNA, and RKO, D283 MED and SK-N-BE(2) cells expressing MGMT but low levels of active b-catenin.

No active b-catenin or MGMT were detected in ve out of six glioma cell lines tested. The deciency of MGMT may also be caused by MGMT promoter methylation commonly seen in glioma cell lines. For all cell lines, protein extracts were subjected to western blotting using antibodies to detect activated desphosphorylated form of b-catenin, Axin 2 that is induced by canonical Wnt/b-catenin signalling and MGMT. Quantitative RTPCR was used to detect

MGMT mRNA levels. For the MGMT mRNA means with s.d. of triplicates are displayed.

4 NATURE COMMUNICATIONS | 6:8904 | DOI: 10.1038/ncomms9904 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2015 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9904 ARTICLE

pharmacokinetics for temozolomide in our experiments the systemic AUC as interpolated from others6,26 suggest that the systemic AUC for temozolomide in mice receiving 12.5 or7.5 mg kg 1 to be approximately 7.6 and 4.5 mg/l-h, respectively. This indicates that the selected temozolomide doses used for the

xenografts experiments correspond to the obtainable AUC observed in the cerebrospinal uids. In conclusion, our data supports the use of inhibitors of Wnt signalling and temozolomide in combination as a treatment option for cancer patients expressing high levels of MGMT in their tumour.

Active -catenin (92 kDa) Axin2 (95 kDa)

MGMT (21 kDa) GAPDH (37 kDa)

-catenin MGMT -catenin/MGMT/DAPI

DAPI

LS174T

Control

+Doxycycline

0.5 g ml1 doxy

1.0 g ml1 doxy

1.5 g ml1 doxy

Control

0.20

0.20

0.20

Relative expression

level

(-catenin/18S)

Relative expression

level

(Axin2/18S)

Relative expression

level

(MGMT/18S)

0.15

0.15

0.15

0.10

0.10

0.10

0.05

0.05

0.05

0.00

0.00

0.00

1.5 g ml doxy

1 g ml doxy

0.5 g ml doxy

1 g ml doxy

0.5 g ml doxy

1.5 g ml doxy

CTRL

CTRL

0.5 g ml doxy

1 g ml doxy

1.5 g ml doxy

CTRL

Luciferase

Plasmid 1 Plasmid 2 Plasmid 3

594 954 3500

+2 +4+8 (Tcf-binding sites)

hMGMT promotor

p-594/+24ML p-954/+24ML p-3500/+24ML

Luciferase

Luciferase

DAOY

cDNA -catenin

Scrambled control

**

DAOY

SW480

0.5 M PGE2

800 1.0 M PGE2

Control

10 M PGE2

5 M celecoxib

15 M celecoxib

30 M celecoxib 50 mM LiCl

**

900

3,000

**

***

**

*

***

**

*

600

800

*

Luciferase units

2,000

***

**

400

Luciferase units

700

Luciferase units

***

1,000

Control

20 M Celecoxib

10 M PGE2

200

600

0 Plasmid 1

Plasmid 2

Plasmid 3

Plasmid 1

500 Plasmid 2

Plasmid 3

Plasmid 1

0 Plasmid 2

Plasmid 3

DAOY

SK-N-AS

0 TOPflash MGMT

SW480

0.0 TOPflash MGMT

2.0

**

Ratio luciferase/renilla

8

***

2.0

Ratio luciferase/renilla

Scrambled control

cDNA -catenin

Ratio luciferase/renilla

**

***

*** **

1.5

6

1.5

1.0

4

1.0

0.5

2

0.5

0.0 TOPflash MGMT

1.5

SW480

0.0 TOPflash MGMT

1.5

LS174T

Ratio luciferase/renilla

Ratio luciferase/renilla

Scrambled control

siRNA -catenin

*** *

** ***

Scrambled control (doxy)

shRNA -catenin (+doxy)

1.0

1.0

0.5

0.5

0.0

TOPflash MGMT

NATURE COMMUNICATIONS | 6:8904 | DOI: 10.1038/ncomms9904 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 5

& 2015 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9904

Methods

Chemicals. Celecoxib (Pzer, Taby, Sweden), dimethyl-PGE2 (dmPGE2), cyclophosphamide (given as the active metabolite 4-hydroxycyclophosphamide), temozolomide, doxycycline, XAV-939, salinomycin (all from Sigma-Aldrich, Solna, Sweden), O6-BG, Wnt-C59 and LGK974 (Cayman Chemical, Ann Arbor, MI, USA) were dissolved in dimethyl sulfoxide (Sigma-Aldrich). Cisplatin, irinotecan, doxorubicin and vincristine were purchased from the local pharmacy (Apoteket AB, Sweden) and diluted according to manufactures instructions. G007-LK was a kind gift from Dr Krauss, University of Oslo, Norway14,27. The mTOR inhibitors rapamycin (Sirolimus, LC Laboratories, Woodburn, MA, USA) and CCI-779 (Temsirolimus, a kind gift from Wyeth Pew River, NY, USA) were dissolved in99.5% ethanol. LiCl was dissolved in H2O. All inhibitors/activators were further diluted in OptiMEM (Gibco BRL, Sundbyberg, Sweden) to the desired in vitro concentration. Temozolomide for the in vivo studies was supplied by the local pharmacy (Apoteket AB). For in vivo use of celecoxib and temozolomide in the D283 xenograft study, the stock was prepared as a suspension in a vehicle uid consisting of 0.5% methylcellulose (w/v; Sigma-Aldrich) and 0.1% Tween 80 (v/v; Sigma-Aldrich) in sterile water. For the LS174T xenograft study, temozolomide was dissolved in NaCl and doxycycline in water.

Cell lines. Cell lines used were kindly provided by Dr T. Pietsch (University of Bonn Medical Center, Bonn, Germany), Dr C. Redfern (Northern Institute for Cancer Research, Newcastle University, Newcastle, UK), Dr M. Nister, Dr Sderberg-Naucler and Dr M. Farnebo (Karolinska Institutet, Stockholm, Sweden) and Dr H. Clevers (Hubrecht Institute and University Medical Center Utrecht, Utrecht, Holland), except from DAOY (D324 MED), D283 MED, HT-29, PFSK-1, T98G and SK-N-AS that were purchased from ATCC. The cell lines were cultured in Dulbeccos Modied Eagles Medium (DMEM; MEB-MED-8A, U373 MG, U251 MG ACII, U87 MG, U343, U313, HCT-116, RKO, SK-N-AS), minimum essential media (MEM; DAOY, D283 MED, T98G), RPMI-1640 (PFSK-1, Colo-320-DM, DLD-1, HT-29, SW480, LS174T), Richters improved MEM with zinc/DMEM (IMEMZO/DMEM; (D425MED and D458 MED), DMEM/F12 (UW228-3)). Medium was supplemented with 10% heat-inactivated foetal bovine serum, 2 mM L-glutamine, 100 IU ml 1 penicillin G, and 100 mg ml 1 streptomycin (Life

Technologies, Stockholm, Sweden) at 37 C in a humidied 5% CO2 atmosphere. All media were purchased from Gibco BRL. LS174T was grown in doxycycline in indicated concentrations for at least 3 days before experimental use with silenced b-catenin. All in vitro studies were carried out in OptiMEM supplemented with antibiotics and L-glutamine.

Gene-expression proling and TCF/LEF-binding sites. Gene-expression proling on glioblastoma, colon carcinoma, medulloblastoma and neuroblastoma were performed as described previously28,29. Data analyses (K-means clustering, KaplanMeier survival curves and MGMT expression analyses) on publicly available gene-expression data sets were performed using the R2 microarray analysis and visualization platform (http://r2.amc.nl

Web End =http://r2.amc.nl). TCF/LEF-binding sites within the 50-anking promoter region of the MGMT gene were searched for with

BLAST (Basic Local Alignment Search Toolvate) programs (http://www.ncbi.nlm.nih.gov

Web End =http:// http://www.ncbi.nlm.nih.gov

Web End =www.ncbi.nlm.nih.gov ) and PROMO (http://alggen.lsi.upc.es;

Web End =http://alggen.lsi.upc.es;) (ref. 30).

Immunohistochemistry. Formalin-xed and parafn-embedded tissue sections were deparafnized in xylene, rehydrated in graded alcohols and washed in phosphate-buffered saline (PBS). After antigen retrieval in sodium citrate buffer

(pH 6) in a microwave oven sections were blocked with 5% goat serum (Jackson Immunoresearch, Fisher Scientic, Gothenburg, Sweden) and incubated for 48 h at 4 C with the primary antibody (mouse monoclonal MGMT, prediluted, 54306 Abcam, Cambridge Science Park, Cambridge, UK). Thereafter, sections were incubated for 30 min at room temperature with anti-mouse Alexa Fluor 568 or 594 conjugate. Similarly, for b-catenin detection, sections were incubated for 48 h at4 C with polyclonal rabbit anti-b-catenin (Cell Signaling Technology #8480) or rabbit anti-b-catenin (4 mg ml 1, Abcam), followed by detection with goat-anti-rabbit Alexa Fluor 488 conjugate. Sections were mounted with Dapiuoromount-G (Southern Biotech) mounting medium. Parallell tissue sections were stained with hematoxylin and eosin.

For immunouorescence studies, LS174T cells were treated with 1 mg ml 1 in doxycycline for 7 days and then grown on chamber slides (Nunc, Roskilde,

Denmark) for 72 h. Thereafter the cells were washed with PBS and xed with 2% paraformaldehyde for 30 min and cold methanol (70%) for 15 min. After washing, cell cultures were incubated with anti-MGMT antibody and anti-b-catenin antibody as described above. Pictures were taken on Zeiss LSM 780 microscope using the same acquisition settings for all cell cultures.

Cytotoxicity and clonogenic assay. The effects of Wnt inhibitors in combination with temozolomide and other conventional chemotherapeutic drugs on cell growth were determined using cell-viability assays uorometric microculture cytotoxicity assay as previously described20,31 or WST-1 (Roche Diagnostic, Basel, Switzerland) according to the manufactures description. All concentrations were tested in duplicate or triplicate and the experiments were repeated at least three times. The studies were designed with a xed molar ratio between the drugs (Temozolomide:Celecoxib, 33:1; Temozolomide:G007-LK, 50:1; Temozolomide: LGK974, 20:1; Temozolomide:Wnt-C59, 20:1; Temozolomide:Salinomycin, 40:1; and Temozolomide:XAV-939, 20:1), intended to be equipotent.

To determine colony formation, DAOY, UW228-3, SK-N-AS, PFSK-1 and SW480 cells were seeded in Cell six-well plates (Sarstedt, Solna, Sweden) at a concentration of 150200 cells per dish, in triplicate. Cells were left to attach to the surface for 5 h before treatment with 10 mM celecoxib, 1020 mM G007-LK,510 mM LGK974 or 10 mM Wnt-C59, 50400 mM temozolomide, or a combination of temozolomide and one of the Wnt-inhibiting drugs for 48 h, respectively. After 714 days of incubation in drug-free medium, cell cultures were rinsed with PBS, xed in formaldehyde, and stained with Giemsa (Gibco, BRL). Colonies (475 cells) with 50% plate efciency were counted manually using a colony counter.

Immunoblotting. Total cell protein lysates was extracted from cells in RIPA buffer (25 mM Tris (pH 7.8), 2 mM EDTA, 20% glycerol, 0.1% Nonidet P-40 (NP-40), 1 mM dithiothreitol). All protein extraction buffers were supplemented with MiniComplete protease inhibitor cocktail (Roche Diagnostic) and phosphatase inhibitor cocktail 1 (Sigma-Aldrich). The protein concentration was measured using Bradford reagent (Bio-Rad, Sundbyberg, Sweden). Equal quantities were separated by SDS-PAGE, transferred to nylon membranes (Millipore, Sundbyberg, Sweden), and probed with antibodies against active b-catenin (1:1,000, clone 8E7,

Millipore, Solna Sweden), Axin2 (1:1,000, Cell Signaling Technology, Beverly, MA, USA), MGMT (1:1,000, Cell Signaling Technology), GADPH (1:10,000, Millipore) and b-actin (1:5,000, Cell Signaling Technology). Anti-rabbit IgG or anti-mouse

IgG, conjugated with horseradish peroxidase (Pharmacia Biosciences, Uppsala, Sweden), were used as secondary antibodies. Pierce Super Signal (Pierce, Rockford, IL, USA) was used for chemiluminescent detection. MGMT recombinant protein

Figure 2 | Wnt/b-catenin regulates the expression of MGMT. (a,b) LS174T cells stably transfected with a Tet-inducable shRNA against b-catenin suppressed MGMTexpression upon doxycycline stimulation9 (a) Immunouorescence stained LS174Tcells treated with 1.5 mg ml 1 doxycycline compared with untreated cells. Scale bar, 20 mm. (b,c) Protein and mRNA expression of b-catenin, Axin 2 and MGMT in cellular extracts from LS174T cells treated with the indicated concentrations of doxycycline (doxy), and protein expression was determined by western blotting. mRNA expression was measured with quantitative RTPCR, means with s.d. of triplicates are displayed. (df) b-catenin activates MGMT through Tcf/Lef binding located in the hmMGMT 50-anking regulatory region. (d) Schematic presentation of luciferase reporter plasmids (p-594/ 24 ML, p-954/ 24 ML and p-3500/ 24 ML) with

indicated numbers of putative Tcf/Lef-binding sites. Numbers in plasmid names refer to the amount of TCF/LEF-binding sites: 2 (plasmid 1), 4

(plasmid 2) and 8 (plasmid 3). (e) DAOY medulloblastoma cells were transiently transfected for 24 h with the MGMT promotor plasmids before

treatment with increasing concentrations of either celecoxib, PGE2 or LiCl for another 24 h (one-way ANOVA with Bonferroni post test: plasmid 1: Po0.0001, plasmid 2: Po0.0001, plasmid 3; Po0.0001, *Po0.05, **Po0.01, ***Po0.001). DAOY cells were co-transfected with pb-catSPORT6 expressing b-catenin cDNA and the MGMTpromoter plasmids for 48 h before luciferase activity measurements (t-test, P 0.0092 for plasmid 3). SW480

colon cells were transiently transfected for 24 h with the MGMT promoter plasmids before treatment with celecoxib or PGE2 for 24 h (one-way ANOVA with Bonferroni post test: plasmid 1: P 0.0007, plasmid 2: P 0.0027, plasmid 3: P 0.0003, *Po0.05, **Po0.01, ***Po0.001). (f) Transfection

of DAOY, SK-N-AS, SW480 and LS174T cells with pb-catSPORT6 or b-catenin siRNA regulates luciferase activity of TOPash and p-3500/ 24 ML

(plasmid 3). Luciferase activities are expressed as means.d. of triplicate in one representative experiment (each experiment was repeated two to three times). DAOY, t-test: TOPash P 0.0036, MGMT P 0.004; SK-N-AS t-test: TOPash P 0.0005, MGMT P 0.0002; SW480 one-way ANOVA with

Bonferroni post test: TOPash Po0.0001, MGMT P 0.0003, *Po0.05, **Po0.01, ***Po0.001; LS174T t-test TOPash P 0.0014, MGMT Po0.0001.

For all experiments means with s.d. of triplicates are shown.

6 NATURE COMMUNICATIONS | 6:8904 | DOI: 10.1038/ncomms9904 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2015 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9904 ARTICLE

DAOY

SW480

T98G

SK-N-AS

TMZ Celecoxib Combination

Temozolomide

Temozolomide

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

10

100 1,000 10

3 30 Concentration (M)

100 1,000 10

3 30 Concentration (M)

100 1,000 10

3 30 Concentration (M)

100 1,000

0.3

3 30

0.3

0.3

0.3

Celecoxib

G007-LK

Concentration (M)

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

TMZ G007-LK

LGK-974

LGK-974

Salinomycin

Wnt-C59

XAV-939

Celecoxib

Combination

Combination

10

2 20

0.2 Concentration (M)

100 1,000 10

2 20

0.2 Concentration (M)

100 1,000 10

2 20

0.2 Concentration (M)

100 1,000 10

2 20

0.2 Concentration (M)

100 1,000

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

TMZ

Wnt-C59

10

5 50

0.5 Concentration (M)

100 1,000 10

5 50

0.5 Concentration (M)

100 1,000 10

5 50

0.5 Concentration (M)

100 1,000 10

5 50

0.5 Concentration (M)

100 1,000

Temozolomide

Temozolomide

Temozolomide

Temozolomide

Temozolomide

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

TMZ Salinomycin Combination

Combination

TMZ

Combination

TMZ + vehicle TMZ + O6-BG

Celecoxib + O6-BGTMZ + celecoxib + vehicle

10

2.5 25 Concentration (M)

100 1,000 10

2.5 25 Concentration (M)

100 1,000 10

2.5 25 Concentration (M)

100 1,000 10

2.5 25 Concentration (M)

100 1,000

0.25

0.25

0.25

0.25

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

TMZ

XAV-939

10

100 1,000 10

5 50

100 1,000 10

5 50

100 1,000 10

5 50

100 1,000

0.5

5 50

0.5

0.5

0.5

Concentration (M) Concentration (M) Concentration (M) Concentration (M)

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

10

100 1,000 10

5 50

100 1,000 10

5 50

100 1,000 10

5 50

100 1,000

0.5

5 50

0.5

0.5

0.5

Concentration (M) Concentration (M) Concentration (M) Concentration (M)

0.3

DAOY

SW480

T98G

SK-N-AS

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Survival index (%)

125 100

75 50 25

0

Celecoxib + vehicle

TMZ + celecoxib + O6-BG

10

3 30 Concentration (M)

100 1,000 10

3 30 Concentration (M)

100 1,000 10

3 30 Concentration (M)

100 1,000 10

3 30 Concentration (M)

100 1,000

0.3

0.3

0.3

Cell viability

(% of matched control cells)

125 100

75 50 25

0

Concentration temozolomide (M)

TMZ + celecoxib 5 M +

scrambled cDNA

TMZ + celecoxib 10 M +

scrambled cDNA

TMZ + celecoxib 10 M +

MGMT cDNA

TMZ + celecoxib 5 M +

MGMT cDNA

0 h 24 h

8 h 48 h Celecoxib

Ratio luciferase/renilla

SW480

SW480

Active -catenin (92 kDa)

MGMT (21 kDa)

GAPDH (37 kDa)

1.5

1.0

0.5

0.0

*** ***

TOPflash

MGMT

Control

Celecoxib

100

1000

DAOY SW480 SK-N-AS UW228-3 PFSK-1 *** ***

***

***

***

***

Clonogenic-forming ability

(percentage of control)

***

125

75 50 25

Clonogenic-forming ability

(percentage of control)

125

75 50 25

Clonogenic-forming ability

(percentage of control)

125

75 50 25

Clonogenic-forming ability

(percentage of control)

125

75 50 25

Clonogenic-forming ability

(percentage of control)

125

75 50 25

* *** ***

* *** ***

***

100

100

100

100

**

100

Control TMZ 50 M

TMZ 100 M

0 TMZ 200 M

Cele 10 M

Cele 10 M + TMZ 50 M

Cele 10 M+ TMZ 100 M

Cele 10 M+ TMZ 200 M

Control TMZ 50 M

0 TMZ 100 M

Cele 10 M

Cele 10 M + TMZ 50 M

Cele 10 M+ TMZ 100 M

Control TMZ 50 M

0 TMZ 100 M

TMZ 200 M

Cele 10 M

Cele 10 M + TMZ 50 M

Cele 10 M+ TMZ 100 M

Cele 10 M+ TMZ 200 M

Control TMZ 50 M

TMZ 100 M

0 TMZ 200 M

Cele 10 M

Cele 10 M + TMZ 50 M

Cele 10 M+ TMZ 100 M

Cele 10 M+ TMZ 200 M

Control TMZ 50 M

TMZ 100 M

TMZ 200 M

0 TMZ 400 M

NATURE COMMUNICATIONS | 6:8904 | DOI: 10.1038/ncomms9904 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 7

& 2015 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9904

served as positive control (Assay Designs, Ann Arbor, MI, USA). Quantication of blots were done with densitometry measurements in ImageJ32.

Flow cytometry. To measure sub-G0 cell population, cells were trypsinized, washed with ice-cold PBS, and xed in 70% ethanol at 20C. Cells were washed

with PBS and incubated with RNase 20 mg ml 1 and propidium iodide (PI)0.5 mg ml 1 (Sigma-Aldrich). All analyses were performed with LSR II Flow Cytometer and FACSDiva v.6.1.3 software (BD Biosciences).

Quantitative real-time RTPCR analyses. The mRNA expression levels of MGMT, CTNNB1, AXIN2 and an endogenous housekeeping gene encoding for 18S ribosomal RNA as a reference were quantied using TaqMan technology on an ABI PRISM 7500 sequence detection systems (PE Applied Biosystems). Sequence-specic primers and probes were selected from the Assay-on-Demand products (Applied Biosystems), including MGMT (assay ID: Hs01037698_m1), CTNNB1 (Hs00355049_m1), AXIN2 (Hs00610344_m1) and 18S ribosomal RNA (Hs99999901_s1). All gene-expression assays had an FAM reporter dye at the50 end of the TaqMan MGB probe, and a non-uorescent quencher at the 30 end of the probe.

SW480

**

LS174T

TMZ ( doxy)

IC50 258 M

TMZ + sh--catenin (+ doxy)

IC50 142 M

TMZ + sh--catenin (+ doxy)

+ MGMT cDNA

IC50 >1,000 M

Cell viability (percentage of

matched control cells)

Cell viability (percentage of

matched control cells)

150

90

80

100

70

50

TMZ + sh--catenin (+ doxy)

+ scrambled cDNA

IC50 314 M

60

0

50 Non-silencing RNA si-catenin

100 1000

Concentration temozolomide (M)

TMZ 100 M

LS174T

Control ( doxy)

sh-catenin (+ doxy)

LS174T

150

Clonogenic-forming ability

(percentage of control)

20

Apoptotic cells (%)

Control ( doxy)

sh-catenin (+ doxy)

*

125

*

15

100

75

10

50

5

25

0

0

TMZ 50 M

single

TMZ 50 M

repeated

Untreated control TMZ 50 M

Figure 4 | Genetical inhibition of Wnt/b-catenin signalling augments the cytotoxic effects of temozolomide. (a,b) Inhibition of b-catenin expression by shRNA or siRNA sensitizes LS174T (a) and SW480 (b) colon carcinoma cells to temozolomide. LS174T cells were grown in medium containing 1 mg ml 1 doxycycline (doxy) and treated with increasing concentrations of temozolomide (TMZ) twice (at 0 and 48 h) for totally 96 h. Doxy-induced shRNA knockdown of b-catenin expression signicantly augment the cytotoxic effect of TMZ (t-test on log IC50, P 0.0003). Overexpression of MGMT

reversed the cytotoxic effect of TMZ caused by b-catenin knockdown (t-test on log IC50, P 0.0491). Each concentration was tested in triplicate and the

experiments were repeated twice. Values are means.e.m. and presented as the percentage of matched control cells. Only depletion of b-catenin inhibited cell growth to 465.8% (means.e.m.) of untreated control. (b) SW480 cells were transiently transfected with siRNA against b-catenin and subsequently treated with 100 mM TMZ for 48 h. Signicant growth inhibition was observed in cells treated with a combination of siRNA against b-catenin and TMZ compared with only TMZ (t-test, P 0.002). The experiment was repeated twice. Values are means.e.m. (c) Clonogenic capacity of LS174T

cells 1 mg ml 1 doxy to induce shRNA against b-catenin and treated with 50 mM TMZ, as a single treatment or repeated treatment. The TMZ treatment was signicantly more efcient in the shRNA-induced LS174Tcells (t-test, P 0.032). Each experimental point was performed in triplicate. The experiment

was repeated with similar results. Means.d. are displayed. (d) b-catenin knockdown signicantly increases TMZ-induced apoptosis in LS174T cells. LS174Tcells were incubated with 1 mg ml 1 doxy to induce shRNA against b-catenin and treated with 50 mM TMZ for 48 h (t-test, P 0.036). Apoptosis

was analysed by ow cytometry measurement of cells in sub-G0 phase. The experiment was repeated three times. Values are means.d.

Figure 3 | Pharmacological inhibition of Wnt/b-catenin signalling augments the cytotoxic effects of temozolomide. (a) Cell viability of cancer cell lines treated with increasing concentrations of different Wnt inhibitors and temozolomide (TMZ). Cell growth was assessed by FMCA or WST-1 after 72 h. All drugs were combined with a xed molar ratio: TMZ:Celecoxib, 33:1; TMZ:G007-LK, 50:1; TMZ:LGK974, 20:1; TMZ:Wnt-C59, 20:1; TMZ:Salinomycin, 40:1; and TMZ:XAV-939, 20:1. Combination index (CI) at IC70 was calculated by the median-effect method. Synergism and antagonism are dened as a CI mean signicantly lower/higher than 1 with one-sample t-test (Po0.05). The combinations with G007-LK and XAV-939 (in all tested cell lines) and with

LGK974 and Wnt-C59 in T98G could not be analysed by the median-effect method since the single drug effect did not achieve a full doseresponse curve. Each concentration was tested in duplicate and the experiment was repeated at least three times. Values are means.e.m. (b) Cell viability of cancer cell lines pre-treated with or without the MGMT inhibitor O6-BG (25 mM), and increasing concentrations of TMZ and celecoxib. Data represent the means.d.

of three or four experiments (t-test on log IC50 with and without O6-BG pre-treatment, DAOY TMZ P 0.0237, SW480 TMZ P 0.0073, SK-N-AS TMZ

P 0.0007). (c) Western blotting of cellular extracts from SW480 cells treated with 10 mM celecoxib for 048 h. (d) Treatment with celecoxib 30 mM in

SW480 regulates luciferase activity of TOPash and p-3500/ 24 ML (plasmid 3). Luciferase activities are expressed as means.d. of triplicate,

experiment was repeated twice. (e) Overexpression of MGMT overcomes the cytotoxic effects of TMZ induced by celecoxib. SW480 cells were transfected with MGMTcDNA (pMGMTSPORT6) or scrambled control, left for 24 h and then treated with celecoxib and increasing concentrations of TMZ for 48 h. Data represent the means.e.m. (f) Clonogenic capacity of cancer cell lines treated with celecoxib (Cele) and TMZ. Cells were then incubated in drug-free medium for 714 days and colonies were counted. Each experimental point was performed in triplicate and repeated three times. Values are means.d. One-way ANOVA, *Po0.05, **Po0.01, ***Po0.001).

8 NATURE COMMUNICATIONS | 6:8904 | DOI: 10.1038/ncomms9904 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2015 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9904 ARTICLE

cDNA of each sample was synthesized from 100 ng of RNA using High capacity RNA-to-cDNA kit (Applied Biosystems). The quantitative real-time RTPCR was performed in a total reaction volume of 25 ml containing 1 TaqMan Universal

PCR Master Mix, 1 TaqMan Gene Expression Assays (Applied Biosystems) and

10 ml of cDNA from each sample as a template, in MicroAmp optical 96-well plates covered with MicroAmp optical caps (Applied Biosystems). Samples were heated for 2 min at 50 C and amplied for 40 cycles of 15 s at 95 C and 1 min at 60 C. To establish a standard curve for relative quantication we used cDNA synthesized from 1 mg RNA of the cell lines combined. For each sample, the amount of target mRNA was normalized to the standard curve and then normalized to 18S ribosomal RNA expression. All quantitative real-time RTPCR experiments included a no template control and were performed in triplicate.

Transfections and luciferase assays. All transfections were carried out using Lipofectamine 2000 (Invitrogen) according to the manufacturers instructions. MGMT promoter-activity measurements were achieved using luciferase reporter plasmids that were kindly provided by Dr Bhakat K. Kishor, University of Texas. Construction of plasmids is described elsewhere33. Three different lengths of the MGMT promoter coupled to reporter gene were used; the three MGMT promoter constructs contain 1, 3 or 8 putative TCF/LEF-binding sites, respectively

(MatInspector). TOPash luciferase reporter plasmid, M50 Super 8 TOPFlash

was a gift from Randall Moon (Addgene, plasmid #12456 (ref. 34), was used to measure b-catenin-mediated transcriptional activation. Renilla Luciferase Assay

System (Promega Biotech AB) was used as control. Briey, 50,000250,000 cells (depending on cell type) were seeded on 24-well plates 24 h prior transfection and luciferase expression plasmids (500 ng per well) were transfected into cells. When applicable, after 24 h cells were treated with increasing concentrations of celecoxib,

PGE2 or LiCl. Cells were collected 48 h after transfection. Luciferase activity was measured using kits from Promega Biotech AB according to the manufacturer-recommended protocols. b-catenin knockdown was achieved using the

SignalSilence b-catenin kit (Cell Signaling Technology) according to the manufacturers instructions. Non-silencing siRNA was used as control (Cell Signaling Technology). Overexpression of b-catenin and MGMT was done with pb-catSPORT6 expressing b-catenin (Cell Signaling Technology) and pMGMTSPORT6 expressing MGMT (Dharmacon, VWR International, Stockholm, Sweden).

Nude mice tumour xenografts. Four-to-six-week-old female NMRI nu/nu mice (Scanbur, Stockholm, Sweden) were maintained at ve each per cage and were given sterile water and food ad libitium. In the rst experiment each NMRI nu/nu mouse was subcutaneously injected with 7 106 human D283 MED medullo

blastoma cells. Mice were randomly assigned into four treatment groups and the drugs were administered as follows: (i) 90 mg kg 1 celecoxib (n 12) daily by oral

gavage, (ii) 7.5 mg kg 1 temozolomide (n 9) orally via a gastric feeding tube at

days 15, (iii) 90 mg kg 1 celecoxib and 7.5 mg kg 1 temozolomide (n 9),

(iv) no treatment (n 10). In the second experiment each mouse was sub

cutaneously injected with 10 106 human LS174T colon carcinoma cells. Mice

were randomly assigned into four groups and the mice were treated as follows: (i)12.5 mg kg 1 temozolomide intraperitoneally at days 15 and days 813 (n 9),

(ii) 2 mg ml 1 doxycycline added to drinking water to knockdown b-catenin expression by shRNA (n 8), (iii) a combination of 12.5 mg kg 1 temozolomide

and 2 mg ml 1 doxycycline (n 9) and (iv) no treatment (n 8). In both

experiments each mouse was treated for 12 days and treatment was started on the appearance of palpable tumours. The mean tumour volume at the start of treatment was 0.13 ml for mice injected with D283 MED cells and 0.22 ml for mice carrying LS174T xenografts. Tumours were measured every day and tumour volume was calculated as (width)2 length 0.44. TVI was calculated using the

measured volume divided by the volume measured at start of treatment. At autopsy, tumours were frozen in liquid nitrogen for subsequent analysis. HT-29 colon cancer xenografts were established by inoculation of 106 HT-29 cells intradermally in the abdomen of nude Balb/c mice (Harlan, The Netherlands). At

D283 MED

0 2 4 6 8 10 12

Control

12

Celecoxib

Tumour volume index

10

Temozolomide

Celecoxib + temozolomid

8

6

4

2

0

Figure 5 | Inhibition of Wnt/b-catenin in combination with temozolomide reduces tumour growth in vivo. (a) A combination of temozolomide and celecoxib signicantly impairs the growth of established human medulloblastoma xenografts in NMRI nu/nu mice. Mice were engrafted with 7 106 D283 MED cells subcutaneously and randomized to receive

either celecoxib (90 mg kg 1; n 12) through daily oral gastric feeding,

temozolomide (7.5 mg kg 1; n 9; days 15), a combination of celecoxib

and temozolomide (n 9) or no treatment (n 10), starting at the

appearance of palpable tumours of approximately 0.10 ml (mean 0.13 ml). Celecoxib augments the inhibitory effect of temozolomide on medulloblastoma growth in vivo, as shown by the TVI (at day 12, celecoxib: TVI 6.2, Po0.0001; temozolomide: TVI 8.1, not signicant;

combination: TVI 4.4 versus 10.3 in untreated controls, Po0.0001, TVI,

two-way ANOVA). (b) Western blot of protein extracts isolated from celecoxib- and vehicle-treated xenograft tumours. Celecoxib downregulated the expression of MGMT in vivo. Protein expression was assessed with densitometry (t-test, P 0.0266). (c) A combination of b-catenin

knockdown and temozolomide inhibits the growth of established colon adenocarcinoma xenografts in vivo. NMRI nu/nu mice were engrafted with 10 106 LS174T cells subcutaneously and randomized (10 mice each

group) to receive 2 mg ml 1 doxycycline to induce shRNA against bcatenin, 12.5 mg kg 1 temozolomide i.p. from day 1 to day 5 and day 8 to day 12, a combination of temozolomide and doxycycline or vehicle only. No differences were observed in LS174T xenograft tumour growth treated with doxycycline or temozolomide as single treatment, whereas a combination of b-catenin knockdown and temozolomide induced signicant inhibition of tumour growth at day 7 of treatment until the end of treatment (at day 12: sh-b-catenin: TVI 3.7, not signicant; temozolomide: TVI 3.8, not

signicant; combination: TVI 2.5 versus 4.2 in untreated controls,

Po0.0001; combination versus shb-catenin, Po0.01; combination versus temozolomide, Po0.01, two-way ANOVA). LS174T shRNA sequence directed against b-catenin: 50-GATCCCGTGGGTGGTATAGAGGCTCTT CAAGAGAGAGCCTCTATACCACCCACT TTTTGGAAA-30 (d) Western blot of protein extracts isolated from LS174T xenograft tumours conrm downregulation of active b-catenin and MGMT.

Time (days)

Control

Positive control

(MGMT)

Celecoxib

MGMT (21 kDa) -actin (45 kDa)

1.2

Ratio MGMT/-actin

*

1.0

0.8

0.6

0.4

0.2

0.0

Control

Control

Celecoxib

Celecoxib

LS174T

5

Tumour volume index

4

Controlsh-catenin Temozolomide sh-catenin + temozolomide

3

2

1

0

0 2 4 6 8 10 12

Time (days)

sh-catenin Control

Active -catenin (92 kDa)

GAPDH (37 kDa)

MGMT (21 kDa)

NATURE COMMUNICATIONS | 6:8904 | DOI: 10.1038/ncomms9904 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 9

& 2015 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9904

autopsy, the mice were perfused with cold PBS followed by 4% paraformaldehyde and the tumour tissue was excised and further processed for histological analysis. All animal experiments were approved by the regional ethics committee for animal research (approval N304/08 and N391/11) in accordance with the Animal Protection Law (SFS1988:534), the Animal Protection Regulation (SFS 1988:539) and the Regulation for the Swedish National Board for Laboratory Animals (SFS1988:541).

Statistical analysis. All statistical analyses were performed with GraphPad Prism software (GraphPad Software, San Diego, CA, USA). Calculation of IC50 values was done from log-concentration-effect curves in GraphPad Prism. Testing for synergistic or additive effects of combination therapy was performed as previously described according ChouTalalay method with Combosyn software20,35. Synergism and antagonism are dened as a mean of the combination index at 70% growth inhibition signicantly lower/higher than 1 with one-sample t-test (Po0.05). For in vitro studies, the t-test was used to determine whether the mean of a single sample differed signicantly from control. To compare several treatment groups, one-way ANOVA with Bonferroni multiple-comparisons tests were used. Po0.05 was considered signicant. Tumour growth was analysed by two-way

ANOVA and the Bonferroni post hoc test was used for multiple comparisons between groups.

References

1. Christmann, M., Verbeek, B., Roos, W. P. & Kaina, B. O(6)-Methylguanine-DNA methyltransferase (MGMT) in normal tissues and tumors: enzyme activity, promoter methylation and immunohistochemistry. Biochim. Biophys. Acta 1816, 179190 (2011).

2. Belanich, M. et al. Retrospective study of the correlation between the DNA repair protein alkyltransferase and survival of brain tumor patients treated with carmustine. Cancer Res. 56, 783788 (1996).

3. Esteller, M. et al. Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to alkylating agents. N. Engl. J. Med. 343, 13501354 (2000).

4. Hegi, M. E. et al. MGMT gene silencing and benet from temozolomide in glioblastoma. N. Engl. J. Med. 352, 9971003 (2005).

5. Kaina, B., Margison, G. P. & Christmann, M. Targeting O(6)-methylguanine-DNA methyltransferase with specic inhibitors as a strategy in cancer therapy. Cell Mol. Life Sci. 67, 36633681 (2010).

6. Quinn, J. A. et al. Phase II trial of temozolomide plus o6-benzylguanine in adults with recurrent, temozolomide-resistant malignant glioma. J. Clin. Oncol. 27, 12621267 (2009).

7. Wick, W. & Platten, M. Understanding and targeting alkylator resistance in glioblastoma. Cancer Discov. 4, 11201122 (2014).

8. Phelps, R. A. et al. A two-step model for colon adenoma initiation and progression caused by APC loss. Cell 137, 623634 (2009).

9. van de Wetering, M. et al. Specic inhibition of gene expression using a stably integrated, inducible small-interfering-RNA vector. EMBO Rep. 4, 609615 (2003).

10. Anastas, J. N. & Moon, R. T. WNT signalling pathways as therapeutic targets in cancer. Nat. Rev. Cancer 13, 1126 (2012).

11. Castellone, M. D., Teramoto, H., Williams, B. O., Druey, K. M. & Gutkind, J. S. Prostaglandin E2 promotes colon cancer cell growth through a Gs-axin-beta-catenin signaling axis. Science 310, 15041510 (2005).

12. Barker, N. & Clevers, H. Mining the Wnt pathway for cancer therapeutics. Nat. Rev. Drug Discov. 5, 9971014 (2006).

13. Kahn, M. Can we safely target the WNT pathway? Nat. Rev. Drug Discov. 13, 513532 (2014).

14. Lau, T. et al. A novel tankyrase small-molecule inhibitor suppresses APC mutation-driven colorectal tumor growth. Cancer Res. 73, 31323144 (2013).

15. Huang, S. M. et al. Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling. Nature 461, 614620 (2009).

16. Lu, D. et al. Salinomycin inhibits Wnt signaling and selectively induces apoptosis in chronic lymphocytic leukemia cells. Proc. Natl Acad. Sci. USA 108, 1325313257 (2011).

17. Baryawno, N. et al. Tumor-growth-promoting cyclooxygenase-2 prostaglandin E2 pathway provides medulloblastoma therapeutic targets. Neuro. Oncol. 10, 661674 (2008).

18. Giardiello, F. M. et al. Treatment of colonic and rectal adenomas with sulindac in familial adenomatous polyposis. N. Engl. J. Med. 328, 13131316 (1993).

19. Phillips, R. K. et al. A randomised, double blind, placebo controlled study of celecoxib, a selective cyclooxygenase 2 inhibitor, on duodenal polyposis in familial adenomatous polyposis. Gut 50, 857860 (2002).

20. Ponthan, F. et al. Celecoxib prevents neuroblastoma tumor development and potentiates the effect of chemotherapeutic drugs in vitro and in vivo. Clin. Cancer Res. 13, 10361044 (2007).

21. von Bueren, A. O. et al. Mismatch repair deciency: a temozolomide resistance factor in medulloblastoma cell lines that is uncommon in primary medulloblastoma tumours. Br. J. Cancer 107, 13991408 (2012).

22. Nagaria, P., Robert, C. & Rassool, F. V. DNA double-strand break response in stem cells: mechanisms to maintain genomic integrity. Biochim. Biophys. Acta 1830, 23452353 (2013).

23. Iyama, T. & Wilson, 3rd D. M. DNA repair mechanisms in dividing and non-dividing cells. DNA Repair 12, 620636 (2013).

24. Reagan-Shaw, S., Nihal, M. & Ahmad, N. Dose translation from animal to human studies revisited. FASEB J. 22, 659661 (2008).

25. Ostermann, S. et al. Plasma and cerebrospinal uid population pharmacokinetics of temozolomide in malignant glioma patients. Clin. Cancer Res. 10, 37283736 (2004).

26. Middlemas, D. S. et al. Biochemical correlates of temozolomide sensitivity in pediatric solid tumor xenograft models. Clin. Cancer Res. 6, 9981007 (2000).

27. Waaler, J. et al. A novel tankyrase inhibitor decreases canonical Wnt signaling in colon carcinoma cells and reduces tumor growth in conditional APC mutant mice. Cancer Res. 72, 28222832 (2012).

28. Kool, M. et al. Integrated genomics identies ve medulloblastoma subtypes with distinct genetic proles, pathway signatures and clinicopathological features. PLoS ONE 3, e3088 (2008).

29. Northcott, P. A. et al. Medulloblastoma comprises four distinct molecular variants. J. Clin. Oncol. 29, 14081414 (2011).

30. Messeguer, X. et al. PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 18, 333334 (2002).

31. Lindhagen, E., Nygren, P. & Larsson, R. The uorometric microculture cytotoxicity assay. Nat. Protoc. 3, 13641369 (2008).

32. Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671675 (2012).

33. Biswas, T. et al. Activation of human O6-methylguanine-DNA methyltransferase gene by glucocorticoid hormone. Oncogene 18, 525532 (1999).

34. Veeman, M. T., Slusarski, D. C., Kaykas, A., Louie, S. H. & Moon, R. T. Zebrash prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements. Curr. Biol. 13, 680685 (2003).

35. Chou, T. C. Drug combination studies and their synergy quantication using the Chou-Talalay method. Cancer Res. 70, 440446 (2010).

36. Northcott, P. A. et al. Medulloblastomics: the end of the beginning. Nat. Rev. Cancer 12, 818834 (2012).

Acknowledgements

Confocal microscopy was performed at the University of Troms, Norway Advanced Microscopy Core Facility. This work was supported by grants from The Swedish Childrens Cancer Foundation, The Swedish Research Council, The Swedish Cancer Society, The Swedish Foundation for Strategic Research (http://www.nnbcr.com

Web End =www.nnbcr.com), Marta and Gunnar V. Philipson Foundation, The Mary Bev Foundation, Damman Foundation, and Erna and Olav Aakres Foundation for Cancer Research.

Author contributions

Conception and design: J.I.J., N.B., M.W., C.D., J.M. Development of methodology: J.I.J., N.B., M.W., J.M., C.D., C.E., B.S., M.K. Acquisition of data: M.W., J.I.J., N.B., C.D., J.M., P.K., B.S., E.S., A.D., M.K., P.S. Analysis and interpretation of data: C.D., J.M., M.K., J.I.J., N.B., M.W., R.C., C.E., B.S., A.D., E.S. Writing, review, and/or revision of the manuscript: J.I.J., M.W., N.B., C.D., J.M. Administrative, technical, or material support: M.W., C.D., J.M., J.I.J., N.B. Study supervision: J.I.J., N.B., M.W., P.K.

Additional information

Supplementary Information accompanies this paper at http://www.nature.com/naturecommunications

Web End =http://www.nature.com/ http://www.nature.com/naturecommunications

Web End =naturecommunications

Competing nancial interests: The authors declare no competing nancial interests.

Reprints and permission information is available online at http://npg.nature.com/reprintsandpermissions/

Web End =http://npg.nature.com/ http://npg.nature.com/reprintsandpermissions/

Web End =reprintsandpermissions/

How to cite this article: Wickstrm, M. et al. Wnt/b-catenin pathway regulates MGMT gene expression in cancer and inhibition of Wnt signalling prevents chemoresistance. Nat. Commun. 6:8904 doi: 10.1038/ncomms9904 (2015).

This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the articles Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Web End =http://creativecommons.org/licenses/by/4.0/

10 NATURE COMMUNICATIONS | 6:8904 | DOI: 10.1038/ncomms9904 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2015 Macmillan Publishers Limited. All rights reserved.