About the Authors:
Jianming Ying
Contributed equally to this work with: Jianming Ying, Chen Lin
Affiliation: Department of Pathology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Chen Lin
Contributed equally to this work with: Jianming Ying, Chen Lin
Affiliation: Department of Abdominal Surgical Oncology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Jian Wu
Affiliation: MyGenostics Inc., Baltimore, MD, United States of America
Lei Guo
Affiliation: Department of Pathology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Tian Qiu
Affiliation: Department of Pathology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Yun Ling
Affiliation: Department of Pathology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Ling Shan
Affiliation: Department of Pathology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Haitao Zhou
Affiliation: Department of Abdominal Surgical Oncology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Dongbing Zhao
Affiliation: Department of Abdominal Surgical Oncology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Jian Wang
Affiliation: Department of Abdominal Surgical Oncology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Jianwei Liang
Affiliation: Department of Abdominal Surgical Oncology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Jianjun Zhao
Affiliation: Department of Abdominal Surgical Oncology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Yuchen Jiao
* E-mail: [email protected] (HZ); [email protected] (NL); [email protected] (YCJ)
Affiliation: Laboratory of Cell and Molecular Biology & State Key Laboratory of Molecular Oncology, Cancer Institute & Cancer Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, PR China
Ning Lu
* E-mail: [email protected] (HZ); [email protected] (NL); [email protected] (YCJ)
Affiliation: Department of Pathology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Hong Zhao
* E-mail: [email protected] (HZ); [email protected] (NL); [email protected] (YCJ)
Affiliation: Department of Abdominal Surgical Oncology, Cancer Hospital, Chinese Academy of Medical Sciences, Beijing, PR China
Introduction
Anaplastic lymphoma kinase (ALK) was first discovered as a fusion gene with nucleophosmin in non-Hodgkin's lymphoma[1]. This gene encodes a receptor tyrosine kinase belonging to the insulin receptor superfamily. Since the original description in 1994, other ALK gene alterations have been subsequently reported in the literature, and this gene has been found to be rearranged, mutated, or amplified in several types of solid tumors, such as inflammatory myofibroblastic tumor, lung cancer and colorectal cancer (CRC)[2–4]. ALK gene rearrangements are the most common genetic alterations and usually lead to the overexpression of fusion proteins[1–4]. In the year of 2006, the fusion protein TPM4–ALK was found to be expressed in esophageal squamous cell carcinoma[5]. To date, more than 20 different genes have been described as being translocated with ALK (S1 Table). Despite the difference in cancer types and fusion partners, ALK rearrangements often lead to the constitutive activation of ALK. The JAK–STAT3, PI3K–AKT and RAS–MAPK pathways, all of which are involved in cell proliferation and survival, can be activated by ALK gene rearrangements through ALK activation[6–8]. A preclinical analysis of more than 600 cell lines showed that ALK inhibitors could reduce the proliferation of cells carrying genetic alterations in ALK, suggesting the role of ALK as a drug target[9]. Clinically, ALK activation was found to modulate responsiveness to targeted therapy agents and ALK rearrangements might define a subgroup of solid tumors which is susceptible to targeted kinase inhibition. An increasing number of studies are focusing on ALK rearrangements and crizotinib, an inhibitor of ALK, c-Met and c-ros oncogene 1 (ROS1). In lung cancer, crizotinib has shown clinical benefits in patients with ALK rearrangements[10, 11]. And it has been approved in the United States, Korea, and other countries for the treatment of ALK-positive non-small cell lung cancer (NSCLC)[12].
CRC, gastric cancer (GC) and esophageal squamous cell carcinoma (ESCC) are all among the leading causes of cancer-related deaths worldwide[13]. Individual therapy is becoming increasingly important in those digestive tract tumors. Predictive biomarkers impact the choice of therapy strategies. KRAS and BRAF are two frequently detected genes for making individual therapy in CRC. Cetuximab and panitumumab are two monoclonal antibodies (MoAb) targeting epidermal growth factor receptor, and Bevacizumab is a MoAb targeting vascular endothelial growth factor. In advanced esophagogastric cancer, trastuzumab can improve the overall survival of HER2-overexpressing cases[14]. To identify ALK alterations in digestive tract tumors, we used an automated immunohistochemistry (IHC) assay to detect ALK alterations. It will provide new evidences to the potential role of ALK gene translocation in targeted therapy for other solid tumors, in addition to lung cancer.
Materials and Methods
Patients
We enrolled 169 ESCC, 182 GC and 457 CRC patients from the Cancer Hospital, Chinese Academy of Medical Sciences (CAMS), Beijing, China, from April 2006 to July 2010. For all cases, ESCC/GC/CRC diagnosis was histologically confirmed. The tumor samples were formalin-fixed paraffin-embedded (FFPE). Tissue microarray (TMA) blocks were built to perform IHC and fluorescence in situ hybridization (FISH) as described before[3]. For DNA/RNA extraction from FFPE sections, Hematoxylin and eosin-stained (HE) sections of FFPE tissue were reviewed for each sample to identify the section with the highest tumor density (at least 50% tumor content). This study was approved by the Independent Ethics Committee, Cancer Hospital, Chinese Academy of Medical Sciences. The approval number was NCC2012G-034. All subjects had given written informed consent prior to the study in accordance with the oversight of the local ethics committee.
Immunohistochemistry
We performed IHC using a fully automated IHC assay as described before[3]. Briefly, pre-diluted Ventana anti-ALK (D5F3) Rabbit monoclonal primary antibody was used together with Optiview DAB IHC detection kit and Optiview Amplification kit on the Benchmark XT stainer. A matched rabbit monoclonal negative control Ig antibody was also stained in each case. For evaluating the staining results, a binary scoring system was adopted according to the manufacturer’s scoring algorithm. Despite the percentage of positive tumor cells, presence of strong granular cytoplasmic staining in tumor cells turned out to be ALK positive, while absence of strong granular cytoplasmic staining was ALK negative.
FISH
FISH analysis was performed with the Vysis LSI ALK Dual color, Break Apart Rearrangement Probe (Vysis/Abbott, Abbott Park, IL) according to the manufacturer’s instructions.
ALK real-time polymerase chain reaction
Total RNA was extracted from tumor tissues to detect the EML4-ALK fusion by real-time polymerase chain reaction (qRT-PCR) using AmoyDx EML4-ALK Fusion Gene Detection Kit (Amoy Diagnostics, Xiamen, China), according to manufacturer’s instruction[3]. The amplified PCR product was subjected to direct sequencing, using AB3500xl DNA Sequencer (Applied Biosystems).
DNA and RNA isolation
We extracted DNA and total RNA from formalin fixed paraffin embedded tissues using the QIAamp® DNA Mini kit (Qiagen) and RNeasy FFPE kit (Qiagen) following the manufacturer's instructions, respectively.
DNA Library Preparation
Each DNA sample is quantified by agarose gel electrophoresis and Nanodrop (Thermo). Libraries were prepared using Illumina standard protocol. In brief, 3 microgram of genomic DNA was fragmented by nebulization, the fragmented DNA is repaired, an ‘A’ is ligated to the 3’ end, Illumina adapters are then ligated to the fragments, and the sample is size selected aiming for a 350–400 base pair product. The size selected product is PCR amplified (each sample is tagged with a unique index during this procedure), and the final product is validated using the Agilent Bioanalyzer.
Targeted genes enrichment and sequencing
The amplified DNA was captured with biotinylated oligo-probes (MyGenostics GenCap Enrichment technologies). The probes were designed to tile along the non-repeated regions of ALK gene containing all the exons and introns (chr2:29415590–30144025). The capture experiment was conducted according to manufacturer’s protocol. In brief, 1μg DNA library was mixed with Buffer BL and GenCap gene panel probe (MyGenostics, MD, USA), heated at 95°C for 7 min and 65°C for 2 min on a PCR machine; 23μl of the 65°C prewarmed Buffer HY (MyGenostics, MD, USA) was then added to the mix, and the mixture was held at 65°C with PCR lid heat on for 22 hours for hybridization. 50 μl MyOne beads (Life Technology) was washed in 500μL 1X binding buffer for 3 times and resuspended in 80μl 1X binding buffer. 64 μl 2X binding buffer was added to the hybrid mix, and transferred to the tube with 80μl MyOne beads. The mix was rotated for 1 hour on a rotator. The beads were then washed with WB1 buffer at room temperature for 15 minutes once and WB3 buffer at 65°C for 15 minutes three times. The bound DNA was then eluted with Buffer Elute. The eluted DNA was finally amplified for 15 cycles using the following program: 98°C for 30 s (1 cycle); 98°C for 25 s, 65°C for 30 s, 72°C for 30 s (15 cycles); 72°C for 5 min (1 cycle). The PCR product was purified using SPRI beads (Beckman Coulter) according to manufacturer’s protocol. The enrichment libraries were sequenced on Illumina HiSeq 2000 sequencer for paired read 100bp.
Reverse transcription- PCR (RT-PCR).
RT-PCR was performed to examine the expression of the SPTBN1-ALK fusion gene by using primers as follows, Forward: GTAAAACGACGGCCAGTTGCTCAGCTTGTACTCAGGG and Reverse: GCACACTACAACCTGCAGAA. PCR product was further sequenced by Sanger sequencing.
Bioinformatics analysis
We performed SV detection using paired-end sequence data. Insert size distributions were obtained from the mapping results with unimodal insert size distributions. The read pairs were required to have a mapping quality greater than 30 with a separation distance exceeding 4 folds of standard deviation, or be in an unexpected orientation. We performed de novo assembly for all predicted deletions, insertions, inversions and translocations using Phrap (http://www.phrap.org). SAMtools was used to extract all mapped reads within 500–1,000 bp of each predicted breakpoint. Unmapped reads with mates mapping to the SV region were also included. For Phrap assembly, a kmer size of 25 and a minimal coverage of 2 were used to remove tips caused by potential sequencing errors. In addition, a read could not have 5 or more bp of unaligned bases on its ends. Reads supported the SV if the read crossed the breakpoint with at least 2 extra bases and the read did not align to the reference sequence.
Results
ALK IHC and FISH
A total of 808 cancer patients were enrolled in this study, including 169 ESCC, 182 GC and 457 CRC patients. For ESCC, GC and CRC patients, the mean ages were 58 (range 33–78), 58 (range 24–79) and 61 (range 23–85), respectively, and the male to female ratios were 4.1: 1, 3.7: 1 and 1.4: 1, respectively. All cases had evaluable IHC results (S1 Fig). Using a Ventana IHC assay, ALK protein was found to be expressed in 2 (0.44%) patients with CRC. One GC patient was partially IHC-positive, showing ALK cytoplasmic immunoreactivity in a proportion of cancer cells (Table 1).
[Figure omitted. See PDF.]
Table 1. ALK translocation status in 3 IHC-positive cases.
https://doi.org/10.1371/journal.pone.0144731.t001
Case one was a 56 years old female with elevated carcino-embryonic antigen (CEA) and carbohydrate antigen 19–9 (CA19-9). She was diagnosed with ascending colon cancer and right colectomy was performed. The histologic type of this patient was poorly differentiated adenocarcinoma. The tumor invaded through the muscularis propria into pericolorectal fat tissues. Regional lymph nodes were 5/21 positive and vascular invasion was observed. The pTNM stage was pT3N2M0. She passed away 7 months after the operation. The IHC results for this patient were positive (Fig 1A, 1B and 1C), showing cytoplasmic immunoreactivity for ALK protein expression.
[Figure omitted. See PDF.]
Fig 1. ALK fusion in colorectal cancer (Case one).
A-B, Immunohistochemistry showed cytoplasmic immunoreactivity for ALK protein expression (A, 20×; B, 200×). C, No immunoreactivity was found in normal tissue (200×). D, fluorescence in situ hybridization (FISH) performed with Vysis LSI ALK Dual color Break-Apart FISH probes detected ALK fusion as split red and green signals (arrows) (1000×).
https://doi.org/10.1371/journal.pone.0144731.g001
Case two was a 62 years old male with normal CEA and CA19-9 level. He was also diagnosed with ascending colon cancer and underwent a right colectomy. Pathologic result showed moderately differentiated carcinoma with no regional lymph node metastasis and vascular invasion. The pTNM stage was pT3N0M0. He received 10 rounds of chemotherapy (fluorouracil plus leucovorin and oxaliplatin). No recurrence of colorectal cancer was observed in 5 years of follow-up. The IHC results were positive for ALK protein expression (Fig 2A and 2B).
[Figure omitted. See PDF.]
Fig 2. ALK fusion in colorectal cancer (Case two).
A-B, Immunohistochemistry showed cytoplasmic immunoreactivity for ALK protein expression (A, 20×; B, 200×). C, fluorescence in situ hybridization (FISH) performed with Vysis LSI ALK Dual color Break-Apart FISH probes detected ALK fusion as split red and green signals (arrows) (1000×). D, Real-time PCR detection of EML4-ALK fusions. Graph from the real-time PCR showed change in the normalized reporter signal (delta Rn) against PCR cycle number. The grey curve stands for internal control and the blue curve stands for the EML4-ALK fusion.
https://doi.org/10.1371/journal.pone.0144731.g002
Case three was a 72 years old female. She was diagnosed with gastric cancer. Post-operative histological diagnosis was poorly differentiated adenocarcinoma with neuroendocrine differentiation. Regional lymph nodes were involved. She passed away 4 months after the operation. IHC result of this patient was partially positive (Fig 3A, 3B and 3C), showing cytoplasmic immunoreactivity for ALK protein expression in cancer cells with neuroendocrine differentiation.
[Figure omitted. See PDF.]
Fig 3. ALK fusion in gastric cancer (Case three).
A, Immunohistochemistry showed cytoplasmic immunoreactivity for ALK protein expression in a proportion of cancer cells (20×). B-C, ALK protein was only expressed in tumor cells with neuroendocrine differentiation, but not expressed in gastric adenocarcinoma cells, indicating intratumoral heterogeneity (A, 20×; B, 200×). D, fluorescence in situ hybridization (FISH) performed with Vysis LSI ALK Dual color Break-Apart FISH probes showed FISH-negative result as intact fused signals. (1000×).
https://doi.org/10.1371/journal.pone.0144731.g003
Of the three IHC-positive cases, the two CRC cases demonstrated FISH patterns of ALK rearrangement, with predominantly isolated 3’ and 5’ ALK signals (Figs 1D and 2C). The GC case showed a FISH-negative result, with intact fused signals (Fig 3D).
qRT-PCR
We extracted total RNA from all three cases. AmoyDx EML4-ALK Fusion Gene Detection Kit was used to perform qRT-PCR. The results showed that only one CRC case (the Case two) had the EML4-ALK gene rearrangement (variant 1) (Fig 2D). The RT-PCR products were confirmed by Sanger sequencing (data not shown).
Targeted gene sequencing
We isolated genomic DNA from the IHC-positive CRC case one and the GC case for targeted gene enrichment and sequencing. In the CRC case one which is both IHC and FISH positive, we identified a novel ALK fusion partner, spectrin beta non-erythrocytic 1 (SPTBN1). It was fused in the 18–19 intron of ALK and 6–7 intron of SPTBN1 (Fig 4). Expression of the SPTBN1-ALK fusion was detected by RT-PCR, and confirmed by direct sequencing (Fig 4). In the GC case which is partially IHC-positive and FISH-negative, gene sequencing result showed no ALK rearrangement. No mutation was found in all exons and introns of ALK in both cases.
[Figure omitted. See PDF.]
Fig 4. A novel fusion gene SPTBN1-ALK.
A, Targeted sequencing analysis revealed a novel fusion gene SPTBN1-ALK which created by invertion between two breakpoints in the intron 7 of SPTBN1 gene and the intron 19 of ALK gene. Sanger sequencing of reverse transcription-PCR product confirmed the fusion of SPTBN1-ALK gene, as showed in the lower panel. B, Functional domain analysis of SPTBN1, ALK, and SPTBN1–ALK fusion protein sequences. ALK, anaplastic lymphoma kinase; SPTBN1, spectrin, beta, non-erythrocytic 1; CH, calponin homology domain; PH, pleckstrin homology domain; TM, transmembrane domain.
https://doi.org/10.1371/journal.pone.0144731.g004
Discussion
In our previous study, we performed a novel fully automated IHC assay using a pre-diluted Ventana anti-ALK (D5F3) Rabbit monoclonal primary antibody, together with the Optiview DAB detection and amplification kit. This method showed high sensitivity and specificity of 100% and 98% respectively, for detecting ALK rearrangement in primary lung adenocarcinoma[3]. To observe the incidence rate of ALK fusion in other types of solid tumors, which might be eligible to targeted kinase inhibition, we used the automated IHC assay and combined it with FISH, qRT-PCR, targeted gene enrichment and sequencing for the detection of ALK rearrangement in digestive tract tumors. The results of IHC were often consistent with those of FISH and gene sequencing. The two IHC-positive cases of CRC were also FISH positive. For case one, ALK rearrangement was confirmed by gene sequencing and a novel fusion partner, SPTBN1, was discovered. For case two, qRT-PCR result showed EML4-ALK gene fusion. The GC case that was partially positive by IHC was FISH negative. The positive signal was located only in the neuroendocrine tumor cells found in this GC sample. Focal ALK IHC positivity with heterogeneous intensity has been observed without ALK gene alteration in pulmonary neuroendocrine carcinoma[15]. The aberrant expression is most likely caused by a wild-type ALK.
Stransky et al described the landscape of kinase fusions in cancer, including ALK alterations. Nearly 1% lung cancer harbored known ALK fusions, while in digestive tract cancer, the fusion rate was relatively low (0.15%, 1/662). One ALK fusion gene was found in rectal cancer, with SMEK2 as a novel fusion partner[16]. Using FISH or gene sequencing, recent studies have also reported gene fusions involving ALK in CRC but with a very low incidence rate of 0.8% and 2.5%[2, 17]. The frequency of ALK fusions is lower in CRCs from Chinese population. It is known that differences in genetic and environmental factors are associated with different incidences of gastrointestinal cancers including gastric cancer, esophageal cancer and colon cancer. Mutagen exposure leads to different mutational patterns of single base substitutions. It is possible that ALK fusion frequency is also associated with food spectrum and potential mutagens in different populations. In NSCLC, ALK gene fusions have a relatively high incidence rate, with echinoderm microtubule-associated protein-like 4 (EML4) as a predominant fusion partner; thus, it is reasonable to use RT-PCR and FISH as routine screening methods for genetic diagnosis. In contrast, ALK gene fusion partners are diverse in CRC; hence, RT-PCR is not an appropriate screening tool, as novel ALK fusion partners would not be detected. In the other hand, because of the low incidence rate, using FISH as a routine diagnosis method is not economically rational. Conversely, IHC is economical and effective for detecting ALK gene fusion in CRC. It turned out to be a potential screening method, which is followed by FISH, qRT-PCR and gene sequencing verification. CRC is one of the most common cancers worldwide, utilizing this process to define the ALK gene-altered subset will benefit a great number of patients with CRC.
Because molecular targeted therapy is effective and well tolerated, it is becoming increasingly important[18–20]. Accumulating studies have been focused on diagnostic methods of genetically defining subsets of patients suitable for targeted therapy. In CRC, KRAS mutation status is employed to exclude a subset of patients from anti-epithelial growth factor receptor (anti-EGFR) therapy[21]. With regard to the ALK gene, its alteration can predict a good response to crizotinib therapy in NSCLC[11]. In patients harboring ALK rearrangements, crizotinib was found to be superior to standard chemotherapy[22]. Although crizotinib is initially approved as a targeted therapy for NSCLC, a study focusing on inflammatory myofibroblastic tumors reported a partial response to it in a patient with ALK translocation, while there was no observed activity in another patient without the translocation[23]. There is also a phase 1b single-arm study about crizotinib therapy in patients with ALK-positive non-NSCLC tumors (NCT01121588). Crizotinib was also able to inhibit proliferation and ALK-mediated signaling in a neuroblastoma cell line[9]. These findings all suggest that crizotinib is a potential therapy for genetically identified patients with ALK alterations in solid tumors other than NSCLC.
We identified a novel ALK fusion partner SPTBN1. Like the ALK gene, SPTBN1 is also located on human chromosome 2[24]. This gene encodes a 247-kDa cytoskeletal protein[25]. It forms heterodimers termed spectrins with α-spectrins via antiparallel helical association[26]. SPTBN1 can bind to membrane phospholipids[27]. In solid tumors, SPTBN1 plays a major role in stabilizing cell-to-cell and cell-to-matrix adhesion[28]. Spectrin dimers link the plasma membrane to the actin cytoskeleton, thereby determining cell shape and organizing organelles. SPTBN1 gene fusions have been reported in atypical myeloproliferative disorders (MPDs) and atypical chronic myeloid leukemia[29, 30]. In one MPDs case, SPTBN1 was fused to the platelet-derived growth factor receptor beta gene (PDGFRB), a member of the type III receptor tyrosine kinase family. The patient’s bone marrow test results showed morphologic and molecular remission after 6 months of imatinib mesylate therapy[29].
To our knowledge, the SPTBN1-ALK fusion gene has not been reported in cancer previously. This fusion may cause constitutive activation of ALK as in the MPDs case mentioned above, which may lead to the patient’s benefit from crizotinib therapy, although further functional studies of this novel fusion are warrented. SPTBN1-ALK, together with other ALK fusion genes, might become a potential target for crizotinib therapy. Future studies should pay more attention to the ALK gene alterations in solid tumors in addition to lung cancer.
Supporting Information
[Figure omitted. See PDF.]
S1 Fig. Immunohistochemistry (IHC) detection of aberrant Anaplastic Lymphoma Kinase (ALK) expression.
https://doi.org/10.1371/journal.pone.0144731.s001
(TIF)
S1 Table. ALK fusions in different cancer type.
https://doi.org/10.1371/journal.pone.0144731.s002
(DOC)
Acknowledgments
This study was supported by grants from the Natural Basic Research Program of China (973 program 2014CB542002) and the National Natural Science Foundation of China (31470073), National Natural Science Foundation of China (81201967), the Beijing Natural Science Foundation (7144238) and Beijing Nova Program (No. 2009A69).
Author Contributions
Conceived and designed the experiments: JMY CL J. Wang LG TQ YL LS HTZ DBZ J. Wu JWL JJZ YCJ NL HZ. Performed the experiments: JMY CL J. Wang LG TQ YL LS HTZ DBZ J. Wu JWL JJZ YCJ NL HZ. Analyzed the data: JMY CL J. Wang LG TQ YL LS HTZ DBZ J. Wu JWL JJZ YCJ NL HZ. Contributed reagents/materials/analysis tools: JMY CL J. Wang LG TQ YL LS HTZ DBZ J. Wu JWL JJZ YCJ NL HZ. Wrote the paper: JMY CL J. Wang LG TQ YL LS HTZ DBZ J. Wu JWL JJZ YCJ NL HZ.
Citation: Ying J, Lin C, Wu J, Guo L, Qiu T, Ling Y, et al. (2015) Anaplastic Lymphoma Kinase Rearrangement in Digestive Tract Cancer: Implication for Targeted Therapy in Chinese Population. PLoS ONE 10(12): e0144731. https://doi.org/10.1371/journal.pone.0144731
1. Morris SW, Kirstein MN, Valentine MB, Dittmer KG, Shapiro DN, Saltman DL, et al. Fusion of a kinase gene, alk, to a nucleolar protein gene, npm, in non-hodgkin's lymphoma. Science 1994;263:1281–1284. pmid:8122112
2. Lipson D, Capelletti M, Yelensky R, Otto G, Parker A, Jarosz M, et al. Identification of new alk and ret gene fusions from colorectal and lung cancer biopsies. Nat Med 2012;18:382–384. pmid:22327622
3. Ying J, Guo L, Qiu T, Shan L, Ling Y, Liu X, et al. Diagnostic value of a novel fully automated immunochemistry assay for detection of alk rearrangement in primary lung adenocarcinoma. Ann Oncol 2013;24:2589–2593. pmid:23904459
4. Coffin CM, Patel A, Perkins S, Elenitoba-Johnson KS, Perlman E, Griffin CA. Alk1 and p80 expression and chromosomal rearrangements involving 2p23 in inflammatory myofibroblastic tumor. Modern Pathol 2001;14:569–576.
5. Jazii FR, Najafi Z, Malekzadeh R, Conrads TP, Ziaee AA, Abnet C, et al. Identification of squamous cell carcinoma associated proteins by proteomics and loss of beta tropomyosin expression in esophageal cancer. World J Gastroenterol 2006;12:7104–7112. pmid:17131471
6. Chiarle R, Simmons WJ, Cai H, Dhall G, Zamo A, Raz R, et al. Stat3 is required for alk-mediated lymphomagenesis and provides a possible therapeutic target. Nature Medicine 2005;11:623–629. pmid:15895073
7. Bai RY, Ouyang T, Miething C, Morris SW, Peschel C, Duyster J. Nucleophosmin-anaplastic lymphoma kinase associated with anaplastic large-cell lymphoma activates the phosphatidylinositol 3-kinase/akt antiapoptotic signaling pathway. Blood 2000;96:4319–4327. pmid:11110708
8. Zou HY, Li Q, Lee JH, Arango ME, McDonnell SR, Yamazaki S, et al. An orally available small-molecule inhibitor of c-met, pf-2341066, exhibits cytoreductive antitumor efficacy through antiproliferative and antiangiogenic mechanisms. Cancer Res 2007;67:4408–4417. pmid:17483355
9. McDermott U, Iafrate AJ, Gray NS, Shioda T, Classon M, Maheswaran S, et al. Genomic alterations of anaplastic lymphoma kinase may sensitize tumors to anaplastic lymphoma kinase inhibitors. Cancer Res 2008;68:3389–3395. pmid:18451166
10. Kwak EL, Bang YJ, Camidge DR, Shaw AT, Solomon B, Maki RG, et al. Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med 2010;363:1693–1703. pmid:20979469
11. Shaw AT, Yeap BY, Solomon BJ, Riely GJ, Gainor J, Engelman JA, et al. Effect of crizotinib on overall survival in patients with advanced non-small-cell lung cancer harbouring alk gene rearrangement: A retrospective analysis. Lancet Oncol 2011;12:1004–1012. pmid:21933749
12. Bang YJ. Treatment of alk-positive non-small cell lung cancer. Arch Pathol Lab Med 2012;136:1201–1204. pmid:23020724
13. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin 2011;61:69–90. pmid:21296855
14. Bang YJ, Van Cutsem E, Feyereislova A, Chung HC, Shen L, Sawaki A, et al. Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of her2-positive advanced gastric or gastro-oesophageal junction cancer (toga): A phase 3, open-label, randomised controlled trial. Lancet 2010;376:687–697. pmid:20728210
15. Nakamura H, Tsuta K, Yoshida A, Shibata T, Wakai S, Asamura H, et al. Aberrant anaplastic lymphoma kinase expression in high-grade pulmonary neuroendocrine carcinoma. J Clin Pathol 2013;66:705–707. pmid:23618692
16. Stransky N, Cerami E, Schalm S, Kim JL, Lengauer C. The landscape of kinase fusions in cancer. Nat Commun 2014;5:4846. pmid:25204415
17. Aisner DL, Nguyen TT, Paskulin DD, Le AT, Haney J, Schulte N, et al. Ros1 and alk fusions in colorectal cancer, with evidence of intra-tumoral heterogeneity for molecular drivers. Mol Cancer Res 2013
18. Inoue A, Suzuki T, Fukuhara T, Maemondo M, Kimura Y, Morikawa N, et al. Prospective phase ii study of gefitinib for chemotherapy-naive patients with advanced non-small-cell lung cancer with epidermal growth factor receptor gene mutations. J Clin Oncol 2006;24:3340–3346. pmid:16785471
19. Demetri GD, von Mehren M, Blanke CD, Van den Abbeele AD, Eisenberg B, Roberts PJ, et al. Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors. N Engl J Med 2002;347:472–480. pmid:12181401
20. Curran MP. Crizotinib: In locally advanced or metastatic non-small cell lung cancer. Drugs 2012;72:99–107. pmid:22191798
21. Siena S, Sartore-Bianchi A, Di Nicolantonio F, Balfour J, Bardelli A. Biomarkers predicting clinical outcome of epidermal growth factor receptor-targeted therapy in metastatic colorectal cancer. J Natl Cancer Inst 2009;101:1308–1324. pmid:19738166
22. Shaw AT, Kim DW, Nakagawa K, Seto T, Crinó L, Ahn MJ, et al. Crizotinib versus chemotherapy in advanced alk-positive lung cancer. N Engl J Med 2013;368:2385–2394. pmid:23724913
23. Butrynski JE, D'Adamo DR, Hornick JL, Dal Cin P, Antonescu CR, Jhanwar SC, et al. Crizotinib in alk-rearranged inflammatory myofibroblastic tumor. N Engl J Med 2010;363:1727–1733. pmid:20979472
24. Watkins PC, Eddy RL, Forget BG, Chang JG, Byers MG, Rochelle R, et al. Assignment of the gene and rflp for non-erythroid beta-spectrin (sptbn1) to human chromosome-2p21. Cytogenetics and Cell Genetics 1989;51:1103–1103.
25. Goodman SR, Zimmer WE, Clark MB, Zagon IS, Barker JE, Bloom ML. Brain spectrin: Of mice and men. Brain Res Bull 1995;36:593–606. pmid:7757495
26. Yan Y, Winograd E, Viel A, Cronin T, Harrison SC, Branton D. Crystal-structure of the repetitive segments of spectrin. Science 1993;262:2027–2030. pmid:8266097
27. An X, Guo X, Gratzer W, Mohandas N. Phospholipid binding by proteins of the spectrin family: A comparative study. Biochem Biophys Res Commun 2005;327:794–800. pmid:15649416
28. Bennett V and Baines AJ. Spectrin and ankyrin-based pathways: Metazoan inventions for integrating cells into tissues. Physiol Rev 2001;81:1353–1392. pmid:11427698
29. Gallagher G, Horsman DE, Tsang P, Forrest DL. Fusion of prkg2 and sptbn1 to the platelet-derived growth factor receptor beta gene (pdgfrb) in imatinib-responsive atypical myeloproliferative disorders. Cancer Genet Cytogenet 2008;181:46–51. pmid:18262053
30. Grand FH, Iqbal S, Zhang L, Russell NH, Chase A, Cross NC. A constitutively active sptbn1-flt3 fusion in atypical chronic myeloid leukemia is sensitive to tyrosine kinase inhibitors and immunotherapy. Exp Hematol 2007;35:1723–1727. pmid:17764812
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2015 Ying et al. This is an open access article distributed under the terms of the Creative Commons Attribution License: http://creativecommons.org/licenses/by/4.0/ (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Background
Anaplastic lymphoma kinase (ALK) rearrangements define a subgroup of lung cancer which is eligible to targeted kinase inhibition. The aim of this study is to observe the incidence rate of ALK fusion in a large cohort of Chinese digestive tract cancer patients.
Patients and Methods
Tissue microarray (TMA) was constructed from 808 digestive tract cancer cases, including 169 esophageal squamous cell carcinoma, 182 gastric cancer and 457 colorectal cancer (CRC) cases. We tested all cases for ALK expression via a fully automated immunohistochemistry (IHC) assay. The IHC-positive cases were subjected to fluorescence in situ hybridization (FISH), real-time polymerase chain reaction (qRT-PCR), target gene enrichment and sequencing for confirmation of ALK gene rearrangement and discovery of novel fusion partner.
Results
Among the tested cases, 2 (0.44%) CRC cases showed positive both by IHC and FISH. By qRT-PCR, EML4–ALK fusion was found in one IHC-positive CRC case. In another IHC-positive CRC case, target gene enrichment and sequencing revealed ALK was fused to a novel partner, spectrin beta non-erythrocytic 1 (SPTBN1). One gastric cancer case showed partially positive IHC result, but no fusion was found by FISH and gene sequencing.
Conclusions
The incidence rate of ALK gene fusion in Chinese CRC patients was 0.44%,but not detectable in gastric and esophageal cancers. The novel SPTBN1 -ALK fusion, together with other ALK fusion genes, may become a potential target for anti-ALK therapy.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer