Full text

Turn on search term navigation

http://www.nature.com/hortres

Web End =www.nature.com/hortres

ARTICLE

Subfunctionalization of cation/proton antiporter 1 genes in grapevine in response to salt stress in different organs

Yuanchun Ma1, Jiaoyang Wang1, Yan Zhong1, Fang Geng1, Grant R Cramer2 and Zong-Ming (Max) Cheng1,3

Cation/proton antiporter 1 (CPA1) proteins function as regulators of monovalent ions, pH homeostasis, and other developmental processes in plants. Better understanding of the expression and regulation of CPA1 in plant responses to salinity would help the development of scientific practices in crops worldwide. In this report, we characterized all seven CPA1 family genes in grapevine (Vitis vinifera) in response to short-term osmotic and NaCl stresses. We found that two of the seven genes have subfunctionalized to be differentially expressed in response to NaCl stress in the early stage in different organs, whereas the other five members seem to play little or no role in this response. Specifically, VIT_19s0090g01480 may control Na1 compartmentalization in grapevine roots; and VIT_05s0020g01960 may influence Na1 transfer in stems. Based on the dynamics of ion concentrations, electrolyte leakage rates, and CPA1 gene expression in root, stem, and leaf tissues under osmotic and NaCl stresses, we suggest how grapevine responds physiologically and molecularly to the osmotic and ion toxicity of NaCl stress in the short term. This work lays a foundation for future research on the CPA1 gene family regarding its evolutionary history and biological functions for modulating salt responsesin grapevine.

Horticulture Research (2015) 2, 15031; http://dx.doi.org/hortres.2015.31

Web End =doi:10.1038/hortres.2015.31 ; Published online: 15 July 2015

INTRODUCTIONSalinity is one of the major abiotic stresses that limits plant growth worldwide.1 More than 50% of all arable land is predicted to suffer serious salinization by the year 2050 because of salinity and drought effects.2 Salt stress primarily disrupts the homeostasis of the water potential and the ion distribution within the plant.3 High salinity causes damage to plants by water deficit due to osmotic stress and by ion toxicity from excessive Na1.4,5 Therefore, separating the effects of ion toxicity from those of osmotic stress caused by excess salinity is vital to understanding the mechanism of salt tolerance in plants. Plants can resist or tolerate salinity stress by maintaining a low Na1 concentration in the cytoplasm, such as by reducing Na1 influx, increasing Na1 efflux, or by Na1 compartmentalization.6,7

In plants, a low Na1 concentration in the cytoplasm is primarily maintained by the cation/proton antiporter (CPA) superfamily, which is one of the cation transporter families.8 The CPA proteins, which contain a conserved Na1/H1 exchanger domain, are associated with transporting monovalent cations across membranes. As secondary active transporters, CPAs function primarily as couplers of the efflux of diverse cations with inward movement of H1.9,10

Grapevine (Vitis vinifera L.) has been domesticated for approximately 8000 years11 and is one of the worlds most important fruit crops. In 2010, it was grown on approximately 7.1 million hectares.12 Grapevine is adapted to semiarid environments, where drought and salinity are common problems. Grapevine is considered moderately tolerant to salinity stress,1316 and this moderate

tolerance has been mainly attributed to salt exclusion or to restriction of toxic ions in the root system.17 Studies of grapevine salt tolerance have primarily focused on the selection of salt-tolerant rootstocks, physiological comparison of salt tolerance in different

grapevine cultivars,17,18 and recently, the development of high throughput assay methods.19 The only functional study on the CPA1 gene of grapevine investigated the role of VviNHX1 in fruit development20 rather than on responses to salinity. The grapevine genome contains seven members in the CPA1 gene family (VIT_01s0011g06550, VIT_15s0024g00280, VIT_07s0104g01280, VIT_05s0020g01960, VIT_14s0128g00020, VIT_14s0030g00710, and IT_19s0090g 01480), which are homologous to the Arabidopsis NHX genes (AtNHX1-8), and they have been implicated in grapevine salt tolerance.21,22

In this report, we determined the family-wide expression of VViCPA1 genes in response to both osmotic stress and salinity stress and linked it to the physiological responses. Based on the dynamics of ion concentrations, electrolyte leakage rate, and CPA1 gene expression in root, stem, and leaf tissues under osmotic and NaCl stress for 036 h, we suggest a process for the short-term responses to salt in grapevine. This research lays the foundation for further characterization of the grapevine CPA1 subfamily and their roles in the physiological responses to salinity and osmotic stress.

MATERIALS AND METHODS

Plant materialIn vitro grapevine plants (V. vinifera genotype PN40024, the sequenced genotype, kindly provided by Dr. Anne-Franoise Adam-Blondon, INRA, France) were cultured in vitro in glass baby food jars (10 cm tall, 6 cm in diameter) on 1/2 Murashige and Skoog salt medium supplemented with 0.3 mg L21 indole-3-butyric acid (IBA, Sigma, St. Louis, USA) and 2% sucrose. The jars were placed under a 16/8 h day/night photoperiod (100 mmol m22 s21)

between 23 6C and 25 6C in a culture room with fluorescent illumination of 125 mmol m22 s21. After 45 days, uniform plants were selected as the test material and were transferred into Hoagland solution (210 ppm N, 235 ppm K, 200 ppm Ca, 31 ppm P, 64 ppm S, 48 ppm Mg, 0.5 ppm B, 5 ppm Fe,

1The Laboratory of Fruit Crop Systems Biology, College of Horticulture, Nanjing Agricultural University, Nanjing, Jiangsu Province 210095, The Peoples Republic of China;

2Department of Biochemistry and Molecular Biology, University of Nevada, Reno, NV 89557, USA and 3Department of Plant Sciences, University of Tennessee, Knoxville, TN 37996, USACorrespondence: ZM Cheng (mailto:[email protected]

Web End [email protected], mailto:[email protected]

Web End [email protected] )

Received: 6 May 2015; revised: 4 June 2015; accepted 4 June 2015

Grapevine CPA1 gene family in response to salt stress

YC Ma et al

0.5 ppm Mn, 0.05 ppm Zn, 0.02 ppm Cu, 0.01 ppm Mo)23 for seven days. The temperature, humidity, and illumination were kept the same as above.

Determination of membrane permeabilityTo determine the extent of plasma membrane damage, the rate of electrolyte leakage (REL, expressed as %) was measured. NaCl was applied to the culture medium at three concentrations: 20, 120, and 250 mM. After 0 (without adding NaCl, as control), 1, 4, 8, 12, 24, and 36 h, 0.5 g of fresh root and leaf (middle of the plant) tissue were harvested. Root (cut into 1 cm) and leaf segments (cut into 1 cm2) were completely immersed in vials containing 10 mL of deionized water and placed into a vacuum (80 000 m Torr) at 25 6C for 40 min. Then, the vials were set aside in a dark place for 30 min; the electrical conductivity of the solution (EC1) was measured by a conductivity meter (BANTE 950; Shanghai, China).

The vial was then autoclaved at 120 6C for 20 min, and the electrical conductivity of the solution (EC2) was measured after equilibration to 25 6C.24,25 The relative conductivity (RC) was defined as RC 5 EC1/EC2. The REL was used as the index of injury and was calculated according to a previous study.26

REL(%)5100(RCt2RC0)/(12RC0); (1)

where RCt is the RC at a given treatment point (1, 4, 8, 12, 24, and 36 h) and RC0 is the RC for the control (0 h).

Determination of plant Na1, K1, Ca11, and Mg11 concentrations After NaCl (250 mM) treatment for 0, 1, 4, 8, 12, 24, and 36 h, approximately0.5 g of fresh root (including root tips) and leaf tissue were harvested and dried thoroughly at 80 6C for 48 h. The tissue was then ground and digested in concentrated 2/1 (v/v) HNO3/HClO4. The concentrations of Na1, K1, Ca11, and Mg11 in the samples were then determined by ICP-MS (Iris Intrepid II; Thermo Electron Corporation, Franklin, MA, USA) according to previous studies.2729

Quantitative real-time RT-PCR for grapevine CPA1 genesBecause the impact of salt stress on a plant has two components, osmotic stress and ion toxicity, we employed two treatments in an attempt to separate the effects of osmotic stress and ion toxicity: NaCl (250 mM), which was found to cause damage within 36 h, and the equivalent osmotic potential obtained using PEG 6000. Both were applied to Hoagland solution. The osmotic potential was determined by a FM-8P automatic freezing point osmometer (Shanghai Medical University Instrument, Shanghai, China) to ensure equal osmolarity of the two solutions. Hoagland solution served as the control solution. The plants were transplanted into Hoagland solution at 23 6C/25 6C (50% humidity, 16-h-light/8-h-dark cycle; 700 mmol m22 s21). Roots, stems (except shoot tip), and leaves (middle of the plant) were harvested after they were treated for 0, 1, 4, 8, 12, 24, and 36 h and then were frozen in liquid nitrogen.

18.00%

20 mM NaCI

16.00%

14.00%

12.00%

10.00%

8.00%

6.00%

4.00%

2.00%

0.00%

2.00%

80.00%

60.00%

70.00%

30.00%

Electrolyte leakage rate Electrolyte leakage rate Electrolyte leakage rate

Leaf

Root

Leaf

Root

Leaf

Root

0H 1H 4H 8H

12H 24H 36H

20 mM NaCI

250 mM NaCI

50.00%

20.00%

10.00%

40.00%

0.00% 10.00%

80.00%

0H 1H 4H 8H 12H 24H 36H

100.00%

90.00%

60.00%

70.00%

30.00%

50.00%

20.00%

10.00%

40.00%

0.00%

10.00%

Table 1. Primer sequences used for qPCR analysis and PCR amplification products

Gene F/R Primer sequence (59,39)

0H 1H 4H 8H 12H 24H 36H

Figure 1. Changes in the rate of electrolyte leakage (REL) in roots and in leaves, after treatment at three NaCl concentrations. (a) 20 mM, (b) 120 mM, (c) 200 mM. The values indicate the mean 6 SD (n 5 3).

Product (bp)

VIT_15s0024g00280 F CAGCAATAGTTGTTTTGACGGTTTTGTTG 287

R GTCTTCTTGTTCTTCATCATCTCCAGTTTG VIT_07s0104g01280 F AGTACACTGGTGTTTGGCTTGATGAC 232

R AGTAATGGTGGACGGTATGAGTTGGG VIT_05s0020g01960 F AAATGTACCCCGCCCCACCAG 181

R ACCTTCTCATCGCCATTGACCAAG VIT_14s0128g00020 F CGACACAGGACTCTGCCCTAATG 236

R GTTACTTGCCTTTGGACTTGGTTGATTG VIT_14s0030g00710 F TTTCCCACGCCCTAGTAGCCTTC 295

R AACGCATTCTCATCAGCCACACC VIT_19s0090g01480 F CGTGTAGAGATCAGTCTGCCTGCTAG 168

R CCAATGCTGTGCTGTCTCCAACTATAAC VIT_01s0011g06550 F ACTCCAAGGTACACCACACACAAAAG 170

R GATGGGTACAATCATAATGCTGTAGAACG

Total RNA was extracted from the frozen samples using a protocol with cetyltrimethylammonium bromide (CTAB) and lithium chloride precipitation,30,31 and then the RNA was purified with RNase-free DNase I (TaKaRa,

Dalian, China). The concentration of RNA was measured with a One Drop TM OD-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, USA), and purity was determined by the optical density (OD) absorption ratio OD 260 nm/OD 280 nm. RNA integrity was monitored by electrophoresis on 1.0% agarose gels by staining with ethidium bromide. For cDNA synthesis, high quality total RNA was reverse transcribed with oligdT and random primers using the PrimeScript RT reagent Kit (TaKaRa, Dalian, China). The first-strand cDNA samples were stored at 220 6C before being examined as templates.

Gene-specific primers for the grapevine CPA1 genes were designed according to the predicted mRNA sequences using Beacon Designer 7.0 software (Premier Biosoft International, CA, USA). To certify the specificity of the primers, all of the primers had at least one nucleotide difference in

Horticulture Research (2015) 2015 Nanjing Agricultural University

Grapevine CPA1 gene family in response to salt stress YC Ma et al

the 39-end of the open reading frame and were tested with PCR amplification and gel electrophoresis. The PCR amplification products were sequenced at least three times, and the maximum deviation was less than 3 base pairs. The sequences of the primers and their products are listed in Table 1.

For the quantitative real-time RT-PCR (qPCR) assay, the method has been described in detail previously by our lab.32 In brief, cDNA was diluted with distilleddeionized (dd) H2O to 100 ng ml21 and measured with a One Drop

TM OD-1000 spectrophotometer to determine the transcript concentration

of each sample. qPCR reactions were performed with SYBR Premix Ex TaqTM (TaKaRa Code: DRR420A, TaKaRa, Dalian, China) on an ABI PRISM 7300 Real-time PCR System (Roche, Penzberg, Germany). A house-keeping gene (actin-101-like, VIT_12s0178g00200) was used as an internal control for qPCR,33

which was previously used in our lab as a reliable internal reference gene.32

Each qPCR reaction was performed in a total volume of 20 ml including 1 ml of template, 10 ml SYBR Premix Ex TaqTM, 0.2 ml of each primer, and 8.6 ml ddH2O. The PCR was performed as follows: denaturation for 4 min at 95 6C, followed by 40 cycles of 95 6C for 20 s, 60 6C for 20 s, and 72 6C for 43 s. A

Na+ concentration

K+ concentration

Ion concentration of fresh

weight (mg/g)

Leaf

Stem

Root

Leaf

Stem

Root

Ion concentration of fresh

weight (mg/g)

1H 4H 8H

Ca2+ concentration

12H 24H 36H

Leaf

Stem

Root

1H 4H 8H 12H 24H 36H

0 0H 1H 4H 8H 12H 24H 36H

c d

Mg2+ concentration

4.5

Ion concentration of fresh

weight (mg/g)

K+ / Na+ratio

Ion concentration of fresh

weight (mg/g)

3.5

Leaf

Stem

Root

Leaf

Stem

Root

2.5

1.5

0.5

1H 4H 8H 12H 24H 36H

Figure 2. The effects of 250 mM NaCl on concentrations of ions in different tissues. (A) Of ions concentrations in different tissues. (B) The ratio of K1/Na1 in different tissues. The values indicate the mean 6 SD (n 5 3).

2015 Nanjing Agricultural University Horticulture Research (2015)

Grapevine CPA1 gene family in response to salt stress

YC Ma et al

VIT_07s0104g01280-PEG VIT_07s0104g01280-NaCl

VIT_19s0090g01480-NaCl

1.2

Expression level

10.80.60.4

Expression level

12H 24H 36H

2.5 2

1.5 1

0.5 0

3.5

2.5

21.510.50

0H 1H 4H 8H 12H 24H 36H

Expression level

0.2 0

5 4 3 2 1 0

0H 1H 4H 8H

VIT_19s0090g01480-PEG

VIT_15s0024g00280-PEG

VIT_05s0020g01960-PEG VIT_05s0020g01960-NaCl

VIT_14s0030g00710-PEG VIT_14s0030g00710-NaCl

VIT_01s0011g06550-PEG VIT_01s0011g06550-NaCl

VIT_14s0128g00020-PEG VIT_14s0128g00020-NaCl

Expression level

5 4 3 2 1 0

0H 1H 4H 8H 12H 24H 36H 0H 1H 4H 8H 12H 24H 36H

VIT_15s0024g00280-NaCl

Expression level

4 3 2 1 0

Expression level

1H 4H 8H 12H 24H 36H

0 0H 1H 4H 8H 12H 24H 36H

0H 1H 4H 8H 12H 24H 36H

0 0H 1H 4H 8H 12H 24H 36H

0H 1H 4H 8H 12H 24H 36H

Expression level

15 10

5 0

Expression level

15 10

5 0

Expression level

5 4 3 2 1 0

4 3 2 1 0

Expression level

43 21 0

0H 1H 4H 8H 12H 24H 36H

Expression level

4 2 0

1H 4H 8H 12H 24H 36H

Leaf Stem Root

Figure 3. qPCR analysis of the expression of VviCPA1 genes in grapevine leaves, stems, and roots in response to PEG and NaCl. The data are expressed as the mean 6 SD (n 5 3).

Horticulture Research (2015) 2015 Nanjing Agricultural University

Grapevine CPA1 gene family in response to salt stress YC Ma et al

negative control reaction without a template was always included for each primer combination. All reactions were performed in triplicate. Three biological replicates were performed for each time point. The qPCR data were analyzed according to 22DDCt method, where control

DDCt~(Ct:target gene { Ct:actin):treatment

{ (Ct:target gene { Ct:actin):control

The error bars represent the standard deviation of the mean.34

Statistical analysisAll data were obtained from three independent experiments with three biological replicates, if applicable. Statistical analyses were performed using the software SPSS (Statistical Package for the Social Sciences) version 13.0 (Chicago, IL, USA) and Excel.

RESULTS AND DISCUSSION

Relative electrolyte leakage rateMembrane permeability can be measured using the rate of REL, which was determined as described by Lutts and Blum.24,25

Figure 1 shows that the extent of change in REL in roots was greater than that in leaves among the three different NaCl concentrations. During NaCl stress, defense mechanisms of the root may start when the NaCl concentration reaches a critical threshold, thus helping prevent leaf damage. From 0 to 4 h in 20 mM NaCl (Figure 1a), the REL in leaves was greater than that in roots. However, from 4 to 24 h in 20 mM NaCl; 4 to 8 h, 12 to 24 h in 120 mM NaCl (Figure 1b); and 0 to 1 h, 8 to 24 h in 250 mM NaCl (Figure 1c), the REL increased drastically in roots and gently decreased in leaves. When the NaCl accumulation reached a critical threshold

a Leaf-1H Leaf-4H

Leaf-8H Leaf-12H

Leaf-24H Leaf-36H

Expression level

7 6 5 4 3 2 1 0

Expression level

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

VIT_15s0024g00280

0 VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

Expression level

6543210

Expression level

65 4 32 10

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

Expression level

16 14 12 10

8 6 4 2 0

Expression level

14 12 10

8 6 4 2 0

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

CK PEG NaCl

Figure 4. qPCR analysis of the expression of VviCPA1 genes in different organs of grapevine. Gene expression levels in leaves (a), stems (b), and roots (c). The values are expressed as the mean 6 SD (n 5 3).

2015 Nanjing Agricultural University Horticulture Research (2015)

Grapevine CPA1 gene family in response to salt stress

YC Ma et al

that the roots may not tolerate, the stress would be partially transferred from roots to leaves, as suggested by the REL decrease in roots and increase in leaves (18 h at 250 mM NaCl, and 812 h at 120 mM NaCl). We inferred that there was a NaCl defense mechanism in grapevine root, which was also proposed by Antcliff.17

Based on these results, we chose 250 mM NaCl as the stress treatment in the qPCR experiments and ion concentration analysis.

Ion concentration analysisThe effects of 250 mM NaCl on ion concentrations in different tissues are shown in Figure 2A. Concentrations of Na1 increased in leaves, stems, and roots, and the Na1 concentration changes were less significant in leaves than in roots and stems (Figure 2A-a). Na1 levels were higher in roots than in stems, with the lowest Na1 concentration in the leaves (Figure 2A-a). Roots are considered to be the main organ for Na1 accumulation, and stems can control the transport of Na1 to leaves. The concentration of K1 in all tissues

was decreased (Figure 2A-b). Especially in roots, the K1 concentration increased first and then decreased. Leaves showed the opposite trend to that in roots, which suggests that K1 was transported to leaves as the stress intensified (Figure 2A-b). Ca11 concentrations showed a significant increase after 24 h in roots, but they varied greatly in leaves between 8 h and 24 h (a significant decrease first, then a significant increase) (Figure 2A-c). In stems, Ca11 showed a significant decrease after 12 h (Figure 2A-c). The trend of Mg11

change was similar to the K1 change in roots (Figure 2A-d).

In addition, the K1/Na1 ratio (Figure 2B) decreased over time in roots and stems; however, in leaves it was the highest before 8 h. This indicates that although the absorption of Na1 did not decline, the transportation of Na1 to leaves was restricted. In roots and stems, there were significant negative correlations between Na1 and K1 in roots (r 5 20.826, p , 0.05) and in stems (r 5 20.944, p ,0.01); however, there was no correlation between Na1 and K1 concentration in leaves. We inferred that there was competition

b Stem-1H Stem-4H

Stem-8H Stem-12H

Stem-24H Stem-36H

Expression level

7 6 5 4 3 2 1 0

Expression level

14 12

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

VIT_15s0024g00280

0 VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

14 12

Expression level

VIT_15s0024g00280

0 VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

30 25

Expression level

16 14 12 10

8 6 4 2 0

Expression level

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

VIT_15s0024g00280

0 VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

CK PEG NaCl

Figure 4b. Continued

Horticulture Research (2015) 2015 Nanjing Agricultural University

Grapevine CPA1 gene family in response to salt stress YC Ma et al

between Na1 and K1 in the absorption and transportation responses to NaCl stress in grapevine.

VviCPA1 gene expressionCPA1 genes have been widely demonstrated to be involved in NaCl responses and tolerance in plants,3539 but limited information on

CPA1 gene expression in response to NaCl stress is available in grapevine. A previous global gene expression analysis of V. vinifera cv Cabernet Sauvignon in 120 mM NaCl, osmotic stress adjusted by polyethylene glycol (PEG) or cold (5 6C) stress prior to the whole-genome sequence release40 showed three responsive CPA1 genes: three CPA1s (VIT_05s0020g01960, VIT_14s0030g00710, VIT_ 19s0090g01480) and three CPA2s (VIT_08s0007g00020, VIT_ 15s0046g03390, VIT_02s0025g00820). Figure 3 shows the expression pattern of the VviCPA1s, measured by qPCR, in response to short-term NaCl stress in three different grapevine tissues (root, stem, and mature leaf). Because NaCl stress also creates osmotic

stress, we also treated grapevines with PEG6000 at osmolarity equivalent to 250 mM NaCl.

All VviCPA1s except VIT_07s0104g01280 exhibited tissue-specific expression in response to the two treatments. VIT_07s0104g01280 showed similar expression trends in leaf, stem, and root tissues during either PEG or NaCl treatment from 0 h to 12 h, but it showed a significant difference (p , 0.5) after 12 h in stems (Figure 3a). The majority of VviCPA1s exhibited low levels of expression in roots after both treatments, whereas VIT_19s0090g01480 showed significantly higher expression after 12 h in response to NaCl than in response to PEG treatment (p , 0.05) (Figure 3b). VIT_15s0024g00280, VIT_ 05s0020g01960, VIT_14s0030g00710, and VIT_01s0011g06550 showed different expression patterns after PEG and NaCl treatment among the three tissues (Figure 3cf). Some of the differences occurred only after 12 h, such as that of VIT_07s0104g01280 (Figure 3a). However, VIT_14s0030g00710 exhibited similar trends in response to PEG and NaCl treatments among the three tissues (Figure 3e).

Root-1H Root-4H

Root-8H Root-12H

Root-24H Root-36H

Expression level

1.81.61.41.2 1

0.80.60.40.2 0

1.8

Expression level

1.2 1

0.80.60.40.2 0

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

1.61.41.210.80.60.40.20

32.5 2

1.5

1.8

Expression level

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

3.5

10.5 0

3.5

Expression level

32.5 2

1.5

Expression level

10.5 0

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

VIT_15s0024g00280

VIT_07s0104g01280

VIT_05s0020g01960

VIT_14s0128g00020

VIT_14s0030g00710

VIT_19s0090g01480

VIT_01s0011g06550

CK PEG NaCl

Figure 4c. Continued

2015 Nanjing Agricultural University Horticulture Research (2015)

Grapevine CPA1 gene family in response to salt stress

YC Ma et al

Compared with the other VviCPA1s, VIT_05s0020g01960, VIT_14s0128g00020, and VIT_14s0030g00710 showed higher expression levels in leaves (Figure 4a), whereas VIT_05s0020g01960 showed the highest level of expression at 24 h after NaCl treatment, increasing nearly 13-fold. Along with a previous report21 that VIT_14s0128g00020 is involved in the process of K1 absorption, we inferred that VIT_05s002 0g01960, VIT_14s0128g00020, and VIT_14s0030g00710 participate in the movement of monovalent cations (mainly K1 and Na1), like other plant NHX-type genes.41 In stems (Figure 4b), VIT_05s0020g01960 and VIT_01s0011g06550 exhibited higher expression levels in later periods of NaCl stress than those of PEG treatment. The highest expression level in stems was that of VIT_05s0020g01960 in response to NaCl at 36 h, which was nearly 25-fold that of the control. Because Na1 is reabsorbed and transferred by xylem parenchyma cells,42,43 we inferred

that VIT_05s0020g01960 may be more highly expressed in xylem parenchyma cells for Na1 transfer. In roots, the highest level of expression was observed for VIT_19s0090g01480 in response to NaCl at 24 h with only a 3.5-fold increase of expression, and its expression level was higher in response to NaCl than in response to PEG at any time of treatment (Figure 4c). Therefore, VIT_19s0090g01480 was closely associated with the response to NaCl in roots. After NaCl treatment, the expression level of most VviCPA1s except VIT_19s0090g01480 was relatively low in roots (Figure 4c), whereas the ion content profiles showed that Na1 primarily accumulated in roots (Figure 2A-a), and REL changed greatly in roots (Figure 1).

Because there was no linear relationship between REL and Na1,

according to the orthologous relationship of VIT_19s0090g01480

with characterized genes in other species, like PeNHXs in Populus,36 we inferred that VIT_19s0090g01480 may transport Na1 into the root vacuoles to alleviate Na1 toxicity in other organs. After NaCl treatment for 24 h, the expression level of VIT_05s0020g01960 was up-regulated to its highest level in stems (Figure 4c). Therefore, we concluded this may be one of the reasons why REL appeared to decline between 24 h and 36 h, during which time the expression of VIT_05s0020g01960 appeared to increase.

SUMMARYOur study systemically determined the expression of grapevine CPA1 gene family members, REL values, and changes of ion concentrations during the first 36 h of osmotic stress (exerted by PEG) or NaCl stress in different organs. The seven CPA1 family members diverged into two groups in response to NaCl. Five genes, VIT_14s0128g00020, VIT_14s0030g00710, VIT_ 01s0011g06550, VIT_07s0104g01280, and VIT_15s0024g00280, appear to play minor or no roles in response to short-term NaCl stress because of their low expression. The other two genes, VIT_19s0090g01480 and VIT_05s0020g01960, have subfunctionalized in the evolutionary history and appear to function in concert to modulate the responses to NaCl stress in different tissues and in different stress stages. VIT_19s0090g01480 was induced strongly by Na1 as the first responder in roots. After NaCl treatment for 24 h, the expression level of VIT_05s0020g01960 was up to the highest level in roots in correspondence with the REL, whereas VIT_05s0020g01960 was highly induced in stem and leaf tissues in later stages in correspondence with the REL decrease in roots, suggesting that

0H-1H

Leaf: PM was not damaged; REL had no change; K+ decreased; Na+ had no change; The expressions of Genes A, B, C were upregulated.

Leaf: PM was damaged; REL increased; Na+ increased; K+ had not change; Genes A,B,C still keep high expression.

Leaf: REL always increased; Na+ keep accumulating. Genes A,B,C keepup regulation, especially Gene B.

Leaf: Na+ accumulated ;REL keep increasing; Stress was getting worse; Genes A,B,C keep high express levels.

1H-8H

8H-24H

24H-36H

Stem: K+ decreased; Na+ had no change; Genes B,C had a high expression levels.

Stem: Na+ begin accumulating; K+ keep decreasing; Genes B and C keep high expression levels; Gene D also participated.

Stem: Na+ keep accumulated; Genes B and C keep high expression; Genes D and E had high expression.

Stem: Na+ accumulated; Genes B and C keep high express ion levels.

Root: PM was damaged; REL certainly raised. K+ and Na+ increased; Gene D had a high expression levels.

K+ Na+

VIT_14s0128g00020 VIT_05s0020g01960 VIT_14s0030g00710 VIT_19s0090g01480 VIT_01s0011g06550

Root: REL gradually restored; K+ decreased; Na+ keep accumulating; Gene D was more active.

Root: Na+ still accumulated; REL increased again. Gene D keep more active, and Gene B had a high expression level.

Root: Na+ still accumulated; REL restored a little, but still high; Gene D still keep high expression levels.

Figure 5 A summary of sequential physiological events and VviCPA1 gene involvement during the first 36 h of NaCl treatment of in vitro grapevine plants.

Horticulture Research (2015) 2015 Nanjing Agricultural University

Grapevine CPA1 gene family in response to salt stress YC Ma et al

VIT_05s0020g01960 is involved Na1 transport from roots to stem and leaf tissue.

Based on the expression profiles in different organs and various stages during the first 36 h and on the ion concentrations and REL in various tissues, we summarized a sequence of physiological events and VviCPA1 gene participation during the first 36 h of NaCl treatment of in vitro grapevine plants, with details described in the legend of Figure 5.

ACKNOWLEDGMENTSThis project was funded by the National Agriculture Ministry 948

Project (#2011-G21), China and by the Priority Academic Program Development of Modern Horticultural Science in Jiangsu Province, China.

AUTHORS RESPONSIBILITIESYuanchun Ma and Jiaoyang Wang performed the main experiment,

Yuanchun Ma and Yan Zhong wrote the main manuscript text and Yuanchun Ma and Fang Geng prepared Figures 15. Grant R. Cramer was mainly responsible for modifying the articles language and grammar; Zong-Ming (Max) Cheng designed the experiment, provided financial support and revised the manuscript.

REFERENCES

1 Cramer G, Urano K, Delrot S et al. Effects of abiotic stress on plants: a systems biology perspective. BMC Plant Biol 2011; 11: 114.

2 Wang W, Vinocur B, Altman A. Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta 2003; 218: 114.

3 Munns R, Tester M. Mechanisms of salinity tolerance. Annu Rev Plant Biol 2008; 59: 651681.

4 Zhu JK. Regulation of ion homeostasis under salt stress. Curr Opin Plant Biol 2003; 6: 441445.

5 Hasegawa PM. Sodium (Na1) homeostasis and salt tolerance of plants. Environ Exp Bot 2013; 92: 1931.

6 Tester M, Davenport R. Na1 tolerance and Na1 transport in higher plants. Ann Bot 2003; 91: 503527.

7 Bassil E, Blumwald E. The ins and outs of intracellular ion homeostasis: NHX-type cation/H1 transporters. Curr Opin Plant Biol 2014; 22: 16.

8 Maser P, Thomine S, Schroeder JI et al. Phylogenetic relationships within cation transporter families of Arabidopsis. Plant Physiol 2001; 126: 16461667.

9 Brett CL, Donowitz M, Rao R. Evolutionary origins of eukaryotic sodium/proton exchangers. Am J Physiol Cell Physiol 2005; 288: C223C239.

10 Fujisawa M, Ito M, Krulwich TA. Three two-component transporters with channel-like properties have monovalent cation/proton antiport activity. Proc Natl Acad Sci U S A 2007; 104: 1328913294.

11 Aradhya MK, Dangl GS, Prins BH et al. Genetic structure and differentiation in cultivated grape, Vitis vinifera L. Genet Res 2003; 81: 179192.

12 Bouby L, Figueiral I, Bouchette A et al. Bioarchaeological insights into the process of domestication of grapevine (Vitis vinifera L.) during Roman times in Southern France. PLoS One 2013; 8: e63195.

13 Walker RR, Blackmore DH, Clingeleffer PR et al. Rootstock effects on salt tolerance of irrigated field-grown grapevines (Vitis vinifera L. cv. Sultana). 1. Yield and vigour inter-relationships. Aust J Grape Wine Res 2002; 8: 314.

14 Shani U, Waisel Y, Eshel A et al. Responses to salinity of grapevine plants with split root systems. New Phytol 1993; 124: 695701.

15 Hawker JS, Walker RR. The effect of sodium chloride on the growth and fruiting of Cabernet Sauvignon vines. Am J Enol Viticult 1978; 29: 172176.

16 Gil M, Esteruelas M, Gonzlez E et al. Effect of two different treatments for reducing grape yield in Vitis vinifera cv Syrah on wine composition and quality: berry thinning versus cluster thinning. J Agr Food Chem 2013; 61: 49684978.

17 Antcliff AJ, Newman RP, Barrett HC. Variation in chloride accumulation in some American species of grapevine. Vitis 1983; 22: 357362.

18 Oki LR, Lieth JH. Effect of changes in substrate salinity on the elongation of Rosa hybrida L. Kardinal stems. Sci Hortic 2004; 101: 103119.

19 Hopper DW, Ghan R, Cramer, GR. A rapid dehydration leaf assay reveals stomatal response differences in grapevine genotypes. Hort Res 2014; 1: 2.

20 Hanana M, Cagnac O, Yamaguchi T et al. A grape berry (Vitis vinifera L.) cation/proton antiporter is associated with berry ripening. Plant Cell Physiol 2007; 48: 804811.

21 Chanroj S, Wang G, Venema K et al. Conserved and diversified gene families of monovalent cation/h(1) antiporters from algae to flowering plants. Front Plant Sci 2012; 3: 25.

22 Ma Y, Wang J, Zhong Y, Grant RC et al. Genome-wide analysis of the cation/ proton antiporter (CPA) super family genes in grapevine (Vitis vinifera L.). Plant Omics J 2015; 8: 300311.

23 Epstein E. Mineral nutrition of plants: principles and perspectives. Hoboken: John Wiley & Sons Ltd, 1972: 325344.

24 Blum A, Ebercon A. Cell membrane stability as a measure of drought and heat tolerance in wheat. Crop Sci 1981; 21: 4347.

25 Lutts S, Kinet JM, Bouharmont J. NaCl-induced senescence in leaves of rice (Oryza sativa L) cultivars differing in salinity resistance. Ann Bot 1996; 78: 389398.

26 Flint HL, Boyce BR, Beattie DJ. Index of injury a useful expression of freezing injury to plant tissues as determined by the electrolytic method. Can J Plant Sci 1967; 47: 229230.

27 Schmidt AC, Reisser W, Mattusch J, Popp P, Wennrich R. Evaluation of extraction procedures for the ion chromatographic determination of arsenic species in plant materials. J Chromatogr A 2000; 889: 8391.

28 Krachler M, Mohl C, Emons H et al. Influence of digestion procedures on the determination of rare earth elements in peat and plant samples by USN-ICP-MS. J Anal Atom Spectrom 2002; 17: 844851.

29 Krupp E, Milne B, Mestrot A et al. Investigation into mercury bound to biothiols: structural identification using ESIion-trap MS and introduction of a method for their HPLC separation with simultaneous detection by ICP-MS and ESI-MS. Anal Bioanal Chem 2008; 390: 17531764.

30 Chang S, Puryear J, Cairney J. A simple and efficient method for isolating RNA from pine trees. Plant Mol Biol Rep 1993; 11: 113116.

31 Gonzalez-Mendoza D, Moreno AQ, Zapata-Perez O. An improved method for the isolation of total RNA from Avicennia germinans leaves. Z Naturforsch C 2008; 63: 124126.

32 Wang M, Vannozzi A, Wang G, et al. Genome and transcriptome analysis of the grapevine (Vitis vinifera L.) WRKY gene family. Hort Res 2014; 1:14016.

33 Reid KE, Olsson N, Schlosser J et al. An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development. BMC Plant Biol 2006; 6: 27.

34 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001; 25: 402408.

35 Galvez FJ, Baghour M, Hao G et al. Expression of LeNHX isoforms in response to salt stress in salt sensitive and salt tolerant tomato species. Plant Physiol Biochem 2012; 51: 109115.

36 Ye CY, Zhang HC, Chen JH et al. Molecular characterization of putative vacuolar NHX-type Na1/H1 exchanger genes from the salt-resistant tree Populus euphratica. Physiol Plant 2009; 137: 166174.

37 Fukuda A, Nakamura A, Tagiri A et al. Function, intracellular localization and the importance in salt tolerance of a vacuolar Na1/H1 antiporter from rice. Plant Cell Physiol 2004; 45: 146159.

38 Xia T, Apse MP, Aharon GS, Blumwald E. Identification and characterization of a NaCl-inducible vacuolar Na1/H1 antiporter in Beta vulgaris. Physiol Plant 2002; 116: 206212.

39 Zrb C, Noll A, Karl S et al. Molecular characterization of Na1/H1 antiporters (ZmNHX) of maize (Zea mays L.) and their expression under salt stress. J Plant Physiol 2005; 162: 5566.

40 Cramer G, Ergl A, Grimplet J et al. Water and salinity stress in grapevines: early and late changes in transcript and metabolite profiles. Funct Integr Genomics 2007; 7: 111134.

41 Pardo JM, Cubero B, Leidi EO et al. Alkali cation exchangers: roles in cellular homeostasis and stress tolerance. J Exp Bot 2006; 57: 11811199.

42 Kramer D, Lauchli A, Yeo AR et al. Transfer cells in roots of Phaseolus coccineus: ultrastructure and possible function in exclusion of sodium from the shoot. Ann Bot 1977; 41: 10311040.

43 Yeo AR, Kramer D, Liuchli A et al. Ion distribution in salt-stressed mature Zea mays roots in relation to ultrastructure and retention of sodium. J Exp Bot 1977; 28: 1729.

This license allows readers to copy, distribute and transmit the Contribution as long as it is attributed back to the author. Readers are permitted to alter, transform or built upon the Contribution as long as the resulting work is then distributed under this or a similar license. Readers are not permitted to use the Contribution for commercial purposes. Please read the full legal code for further details at http://creativecommons.org/licenses/by-nc-sa/3.0/legalcode

Web End =http://creativecommons.org/licenses/by-nc-sa/3.0/legalcode

2015 Nanjing Agricultural University Horticulture Research (2015)

Word count: 5968

Show less

Abstract

Translate

Cation/proton antiporter 1 (CPA1) proteins function as regulators of monovalent ions, pH homeostasis, and other developmental processes in plants. Better understanding of the expression and regulation of CPA1 in plant responses to salinity would help the development of scientific practices in crops worldwide. In this report, we characterized all seven CPA1 family genes in grapevine (Vitis vinifera) in response to short-term osmotic and NaCl stresses. We found that two of the seven genes have subfunctionalized to be differentially expressed in response to NaCl stress in the early stage in different organs, whereas the other five members seem to play little or no role in this response. Specifically, VIT_19s0090g01480 may control Na ⁺ compartmentalization in grapevine roots; and VIT_05s0020g01960 may influence Na⁺ transfer in stems. Based on the dynamics of ion concentrations, electrolyte leakage rates, and CPA1 gene expression in root, stem, and leaf tissues under osmotic and NaCl stresses, we suggest how grapevine responds physiologically and molecularly to the osmotic and ion toxicity of NaCl stress in the short term. This work lays a foundation for future research on the CPA1 gene family regarding its evolutionary history and biological functions for modulating salt responses in grapevine.

Details

Title

Subfunctionalization of cation/proton antiporter 1 genes in grapevine in response to salt stress in different organs

Author

Ma, Yuanchun; Wang, Jiaoyang; Zhong, Yan; Geng, Fang; Cramer, Grant R; Cheng, Zong-ming (max)

Pages

15031

Publication year

2015

Publication date

Jul 2015

Publisher

Oxford University Press

e-ISSN

20527276

Source type

Scholarly Journal

Language of publication

English

DOI

https://doi.org/10.1038/hortres.2015.31

ProQuest document ID

1786283793

Subfunctionalization of cation/proton antiporter 1 genes in grapevine in response to salt stress in different organs

Jump to:

Full text

Abstract

Details

Suggested sources