Mitochondrial control region diversity in Polish sheep breeds

Abstract

The aim of the study was to determine the genetic variability of the Polish sheep breeds Swiniarka, Wrzosówka, Pomorska, and Wielkopolska based on mitochondrial control region polymorphism. A comprehensive phylogenetic analysis and information about the genetic origin of the breeds were also obtained. The genetic variability of the breeds studied has been assessed based on the number of haplotypes, haplotype diversity, nucleotide diversity, the average number of nucleotide differences, the number of mutations, and phylogenetically informative sites. Sequence divergence between identified haplogroup A (HA) and haplogroup B (HB) was also calculated. Moreover, a neighbour-joining (NJ) haplotype tree was constructed based on Kimura's two-parameter genetic distance calculation. Finally, the history of the population was investigated by mismatch distribution and Fu's <i>F</i> statistics. The 559 bp long mitochondrial DNA (mtDNA) control region (CR) sequences of 143 sheep were analysed. The 65 haplotypes were defined by 45 parsimony informative sites. Among the four Polish breeds, Wrzosówka had the highest while Swiniarka the lowest values of haplotype (<i>H</i>_d) and sequence diversity (<i>π</i>) (<i>H</i>_d = 0.9735 and <i>π</i> = 0.0040 for Wrzosówka; <i>H</i>_d = 0.8975 and <i>π</i> = 0.0030 for Swiniarka). Five haplotypes were shared between breeds, whereas the remaining 60 were unique. The NJ phylogenetic tree has revealed that 61 haplotypes of all analysed breeds clustered into clade B while the remaining 4 haplotypes representing all but the Swiniarka breed pooled together with clade A. None of the other reported mitochondrial haplogroups were identified. The haplotypes representing HB formed a star-like network with the single central haplotype, which in association with extensive haplotype sharing reveals a weak structure of Polish breeds and the existence of gene flow between the breeds studied.

Arch. Anim. Breed., 59, 227233, 2016 www.arch-anim-breed.net/59/227/2016/ doi:10.5194/aab-59-227-2016 Author(s) 2016. CC Attribution 3.0 License.

Open Access

Archives Animal Breeding

Mitochondrial control region diversity in Polish sheep breeds

Anna Koseniuk and Ewa Sota

Department of Animal Genomics and Molecular Biology, National Research Institute of Animal Production, Krakowska 1, 32-083 Balice, Poland

Correspondence to: Anna Koseniuk ([email protected])

Received: 1 September 2015 Revised: 29 April 2016 Accepted: 13 May 2016 Published: 30 May 2016

Abstract. The aim of the study was to determine the genetic variability of the Polish sheep breedswiniarka, Wrzoswka, Pomorska, and Wielkopolska based on mitochondrial control region polymorphism. A comprehensive phylogenetic analysis and information about the genetic origin of the breeds were also obtained. The genetic variability of the breeds studied has been assessed based on the number of haplotypes, haplotype diversity, nucleotide diversity, the average number of nucleotide differences, the number of mutations, and phylogenetically informative sites. Sequence divergence between identied haplogroup A (HA) and haplogroup B (HB) was also calculated. Moreover, a neighbour-joining (NJ) haplotype tree was constructed based on Kimuras two-parameter genetic distance calculation. Finally, the history of the population was investigated by mismatch distribution and Fus F statistics. The 559 bp long mitochondrial DNA (mtDNA) control region (CR) sequences of 143 sheep were analysed. The 65 haplotypes were dened by 45 parsimony informative sites. Among the four Polish breeds, Wrzoswka had the highest whilewiniarka the lowest values of haplotype (Hd) and sequence diversity () (Hd = 0.9735 and = 0.0040 for Wrzoswka; Hd = 0.8975 and = 0.0030 forwiniarka). Five haplotypes

were shared between breeds, whereas the remaining 60 were unique. The NJ phylogenetic tree has revealed that 61 haplotypes of all analysed breeds clustered into clade B while the remaining 4 haplotypes representing all but thewiniarka breed pooled together with clade A. None of the other reported mitochondrial haplogroups were identied. The haplotypes representing HB formed a star-like network with the single central haplotype, which in association with extensive haplotype sharing reveals a weak structure of Polish breeds and the existence of gene ow between the breeds studied.

1 Introduction

In animal tissues, mitochondrial DNA (mtDNA) is characterized by very high polymorphism within species, a lack of recombination, and maternal inheritance. Moreover, very often it is the only genetic material that can be obtained from degraded or archaeological biological material. The analysis of both the conserved sequence of mitochondrial genes and the non-coding part of mtDNA, called the control region or displacement loop (D-loop), has been applied inter alia in phylogenetic studies.mtDNA has been used to investigate the history of modern domestic animals, i.e. to identify wild ancestors and to dene domestication centres (Bruford et al., 2003). Studies of cattle (Loftus et al., 1994; Bradley et al., 1996), goats (Luikart

et al., 2001), pigs (Giuffra et al., 2000), sheep (Hiendleder et al., 2002), and poultry (Rosenberg et al., 2001) have revealed that each has multiple maternal origins. The identication in modern breeds of different maternal lineages showed independent domestication events of originally wild populations. So far, ve maternal lineages have been identied in sheep: haplogroup A originated from Asia, haplogroup B from Europe, and haplogroups C, D, and E from the Near East (Meadows et al., 2007).

The present study analyses four Polish sheep breeds which have different phenotypic characteristics. These breeds have been included in the genetic resources programme in Poland because they are threatened by extinction.

Published by Copernicus Publications on behalf of the Leibniz Institute for Farm Animal Biology.

228 A. Koseniuk and E. Sota: Mitochondrial control region diversity in Polish sheep breeds

Table 1. Primers used for the amplication and sequencing of the D-loop of Polish sheep.

Primer Primer sequence 5[prime]3[prime] Breed* PCR product References name size (bp)

1MTFR F AGAAGCTATAGCCCCA pom, 600 Pedrosa et al. (2005)

R ACTTAAAGCAAGGCAC swin, wrzWLKFR F GGGGGAAGCGTGTTAAAAAT wlk 600 Designed according to the

R TCCACAAGCCCACATAACAA NCBI sequence No. AF010406

* pom Pomorska; swin winiarka; wrz Wrzoswka; wlk Wielkopolska.

winiarka is an old, native, and primitive sheep breed which used to be very common in central and western Europe. In the interwar period it formed the majority of the primitive sheep population and was used for developing the noble lines of crossbred sheep. Even such features of winiarka as high resistance to various diseases (especially to foot rot), and the fact that they are undemanding in feed and well adapted to harsh living conditions did not prevent the breed from near extinction in the 1980s. Since then, winiarka has been successfully restored from only a few individuals found in eastern Poland.

Another breed, Wrzoswka (Heath sheep), is one of the oldest surviving primitive Polish sheep breeds. Before the Second World War, Wrzoswka was present in large numbers in north-eastern Poland. After the war a rapid decline in the population of Wrzoswka was observed resulting in the near extinction of the breed, which was then successfully restored. According to data from 2014, the population of Polish Wrzoswka sheep comprises 8343 animals (NRIAP, 2015). Wrzoswka is prolic and reared for wool production as well as its delicate meat. It is also recognized to be disease resistant as well as adaptable to difcult conditions.

The Pomorska (Pomeranian sheep) breed is reared at the Baltic Sea in Pomerania and Mecklenburg. This long-wool-type sheep is characterized by low nutritional requirements, resistance to many diseases, and good adaptation to tough environmental conditions. Such features allow Pomeranian sheep to be kept in cool and damp coastal areas. Pomeranian sheep are suitable for the traditional breeding system based on grazing in small ocks. Due to its versatile utility, it is mainly bred for meat, milk, or wool. In 2014 the population of Pomeranian sheep, comprising 7621 animals, was the second largest of all native breeds (NRIAP, 2015).

Another common Polish native sheep breed is Wielkopolska, with over 7000 animals in 2014, participating in the genetic resources programme (NRIAP, 2015). The Wielkopolska sheep was bred in the years 19481976, based on the primary population of whitewiniarka and improved winiarka. This lowland wool- and meat-type sheep was intended for farming and less intensive breeding in either small or large ocks. The most important advantage of Wielkopolska sheep is good wool quality, rapid weight gain, and, unlike Merino sheep, low nutritional requirements.

To date, the majority of surveys on the genetic diversity among Polish sheep have been conducted on blood groups and blood plasma proteins polymorphisms (Rychlik et al., 2007, 2009, 2011; Rychlik and Krawczyk, 2009, 2010) as well as autosomal short tandem repeat variations (STR, microsatellites) (Radko et al., 2006; Kawecka and Pirkowska, 2011). Few inquiries have been undertaken on the mitochondrial cytochrome b gene (Karpiski et al., 2006; Prusak et al., 2005).

The aim of the study was to determine the genetic variability of four Polish sheep breeds based on mitochondrial control region polymorphism. Moreover, a comprehensive phylogenetic analysis of the sheep breeds was conducted and information was obtained about their genetic origin.

2 Materials and methods

2.1 Sample collection and DNA isolation

A total of 143 blood samples was taken from sheep belonging to four Polish sheep breeds: Wrzoswka (wrzos, n = 33;

ewes: 22; rams: 11; 2 ocks),winiarka (swin, n = 35; ewes:

29; rams: 6; 2 ocks), Pomorska (pom, n = 40; ewes: 32;

rams: 8; 3 ocks), and Wielkopolska (wlk, n = 35; ewes: 32;

rams: 3; ock). The blood samples were taken by an authorized person observing routine procedure for ovine pedigree verication, for which the permission of the Polish Ethics Committees for Experiments with Animals is not required.The individuals were unrelated according to breeding documentation. Total genomic DNA was extracted from blood samples using a DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturers instruction.

2.2 Polymerase chain reaction and sequencing

In Table 1 three sets of primers are given, which were used for both polymerase chain reaction (PCR) and sequencing. The rst one (1MTF 5[prime]AGAAGCTATAGCCCCA and 1MTFR 5[prime] ACTTAAAGCAAGGCAC), according to Pedrosa et al. (2005), was used for samples of all but the Wielkopolska breed. The second set of primers (WLK_F 5[prime] GGGGGAAGCGTGTTAAAAAT, WLK_R 5[prime] TCCA

CAAGCCCACATAACAA) was designed using the Primer3 program (Koressaar and Remm, 2007; Untergasser et al.,

Arch. Anim. Breed., 59, 227233, 2016 www.arch-anim-breed.net/59/227/2016/

A. Koseniuk and E. Sota: Mitochondrial control region diversity in Polish sheep breeds 229

Table 2. PCR cycling conditions used for the amplication of the control region of sheep.

Step Primer nameMTFR WLKFR Temp[ C]

Time No. of cycles

Initial denaturation 95 15 min 1 95 15 min 1 Denaturation 94 40 s 30 94 40 s 30 Annealing 57 40 s 60 40 s Elongation 72 1 min 72 1 minFinal elongation 72 10 min 1 72 10 min 1

Table 3. Genetic diversity parameters and Fus F statistics in analysed sheep.

Breed Na Hb

n Hc

d [Pi1]d ke Mf

Time No. of cycles

Temp [ C]

gs F h

s

Wrzoswka 33 21 0.9735 0.0040 5.8674 39 35 8.385**

winiarka 35 14 0.8975 0,0030 2.7462 17 10 5.199**

Pomorska 40 20 0.9269 0.0041 5.5794 32 26 5.678*

Wielkopolska 35 17 0.9345 0,0036 3.4386 30 13 7.227**

All breeds 143 65 0.9720 0.0037 4.7476 55 45

* p < 0.05; ** p < 0.01. a Number of sequences. b Observed haplotypes (Hn). c Haplotype diversity. d Population nucleotide diversity. e Average number of nucleotide differences. f Mutation sites. g Phylogenetically informative sites. h Fus Fs statistics.

s P

population expansion was investigated with mismatch distribution (DnaSp 5.0) and Fus Fs statistics (Fu, 1997) computed by Arlequin (Excofer et al., 2005). Only phylogenetically informative polymorphism was calculated in the survey. However, all mutation types including singletons remain in the sequences submitted to GenBank under the accession numbers KT158312KT158460 (NCBI, 2015).

3 Results

3.1 mtDNA variation in Polish sheep

In the survey 559 bp long mtDNA control region (CR) sequences were obtained spanning Ovis aries reference sequence AF010406 (Hiendleder et al., 1998) from 15959 to 16518 bp. The analysis of combined data sets of 143 sequences revealed 55 polymorphic sites, of which 45 were phylogenetically informative, while the remaining 10 were singletons. The structure of transversion to transitions was 105 : 4, and no indel was noticed. As it is de

picted in Table 3, the overall values for haplotype and nucleotide diversities were 0.9720 and 0.0037 respectively.Among the four Polish breeds, Wrzoswka showed the highest values of genetic diversity in terms of haplotype(0.9735) and nucleotide (0.0040) diversity, the average number of nucleotide differences (5.8674), the number of mutations (39), and phylogenetically informative sites (35).The lowest values of these parameters were reported for winiarka (Hd = 0.8975; = 0.0030; k = 2.7462; Ms = 17;

and Ps = 10). Pomorska and Wielkopolska were similar in

www.arch-anim-breed.net/59/227/2016/ Arch. Anim. Breed., 59, 227233, 2016

2012) from the complete ovine mtDNA sequence (Gene Bank Acc No. AF010406; Hiendleder et al., 1998) exclusively for samples of the Wielkopolska breed since non-specic PCR products had been obtained using the 1MTF/R primer set. Amplication reactions were carried out in a 25 L volume PCR mix containing 1 [notdef] PCR buffer,

2.5 mM MgCl2, 200 M dNTPs, 0.5 U Taq DNA polymerase (HotStar Taq, Qiagen), 0.125 mol of each primer, and 20 ng of DNA template. PCR thermal conditions were specied in Table 2. PCR products were bidirectionally sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies, USA) and underwent capillary electrophoresis on a 3130xl Genetic Analyser (Life Technologies, USA).

2.3 Data analysis

The obtained sequences were inspected manually and aligned with an Ovis aries reference sequence of haplogroup B (AF010406) (Hiendleder et al., 1998) using BioEdit. For each breed, DnaSP 5.0 (Librado and Rozas, 2009) was used to sort haplotypes, haplotype diversity (Hd), nucleotide diversity (), the average number of nucleotide differences (k), the number of mutations (Ms), and phylogenetically informative sites (Ps). In addition, the average number of nucleotide differences (K) and the average number of nucleotide substitutions per site (D) between two identied haplogroups were calculated.

MEGA 6 software (Tamura et al., 2013) served to evaluate Kimuras two-parameter genetic distance (Kimura, 1980) and construct the neighbour-joining (NJ) haplotype tree. The

230 A. Koseniuk and E. Sota: Mitochondrial control region diversity in Polish sheep breeds

Table 4. Control region diversity between two mtDNA lineages.

Population Ha

n Kb Dc Shared mutations

Haplogroup A 4 0.2706 14.885 6

Haplogroup B 61

a Number of haplotypes.b Average number of nucleotide substitutions per site between the haplogroups.

c Average number of nucleotide differences between the haplogroups.

Clade B

terms of haplotype diversity (0.9269 and 0.9345 respectively) but very different regarding other genetic diversity assessments (k = 5.5794, Ms = 32, and Ps = 26 for Pomorska

and k = 3.4386, Ms = 30, and Ps = 13 for Wielkopolska).

The analysis of two mtDNA lineages (type A and B) revealed high sequence diversity (K = 0.2706, D = 14.885), which is

shown in Table 4.

3.2 Phylogenetic analyses

The 65 haplotypes were dened by 45 parsimony informative sites. Only 5 haplotypes were shared between breeds (hap_1: pom/wrz; hap_3: swin/wlk/pom; hap_6: swin/wlk; hap_3: swin/wlk/pom and hap_39: wrz/wlk), whereas the remaining 60 were unique. As is shown in Fig. 1, the NJ phylogenetic tree revealed that 61 haplotypes of Polish sheep sequences clustered into clade B and the remaining 4 into clade A. These four haplotypes, which pooled together with cluster A, included two sequences of Wrzoswka, ve sequences of Pomorska, and one sequence of Wielkopolska breed. All haplotypes ofwiniarka clustered only into haplogroup B. Type B haplotypes formed a star-like tree with one central haplotype (hap_13). The mismatch analysis of all haplotype distributions gave signicantly negative results. The histograms of mismatch distribution revealed two distinct peaks for all but thewiniarka breed (data not shown). The Fs (Fu, 1997) neutrality test for all breeds gave a significant (p < 0.05) negative value.

4 Discussion

The exclusive presence of two mtDNA lineages (i.e. haplogroups A and B) is characteristic of Polish sheep breeds, which is in agreement with the results from most other European populations sampled to date (Tapio et al., 2006; Meadows et al., 2007). The vast majority of Polish breed haplo-types represent haplogroup B. A few samples also showed the presence of maternal lineage A, suggesting introgression from Asian breeds. It is worth noting that no other reported haplogroups were observed in the investigated Polish sheep population. However, so far, the presence of haplogroup C in breeds from Europe has been found only among the Portuguese breeds (Pereira et al., 2006).

Wielkopolska

Pomorska

Wrzoswka

Clade A

Figure 1. Unrooted neighbour-joining haplotype tree constructed from Kimura two-parameter distance of the 65 haplotypes of the Polish sheep breeds studied; bootstraps of 1000 replicates were used to test the robustness of the tree.

These two haplogroups are sufciently divergent in the Polish population as it has been depicted in Table 4. This is conrmed by a high average number of mutational changes and sequence divergence between groups which were similar to that observed by Pardeshi et al. (2007) but unlike the results of Meadows et al. (2007).

The history of the population has been investigated by mismatch distribution and Fus F statistics (Fu, 1997). Assuming that population growth affects the distribution of nucleotide changes among homologous DNA sequences the study of histograms of mismatch distribution should give an insight into the history of the population. The mismatch distribution of the population which underwent a recent burst of

Arch. Anim. Breed., 59, 227233, 2016 www.arch-anim-breed.net/59/227/2016/

A. Koseniuk and E. Sota: Mitochondrial control region diversity in Polish sheep breeds 231

expansion is illustrated in the form of a bell-shape histogram, whereas the histogram of the steady-state population with a constant population size is ragged (Hartl, 2004). The analysis of mismatch distribution of the worldwide sheep population has shown that the haplogroups A and B have each experienced a recent population expansion from a one-line pedigree (Guo et al., 2005). The double-pick histograms of mismatch distribution for all but thewiniarka breed conrm descent from two maternal lineages of Wrzoswka, Pomorska, and Wielkopolska.

The results regardingwiniarka and Wrzoswka are in accordance with Tapio et al. (2006), who studied mitochondrial control region and cytochrome b polymorphism in 406 sheep from Europe and Asia. Among them four samples of the Wrzoswka and two of thewiniarka breed were found.All of them were pooled together with haplogroup B with the exception of one sample belonging to the Wrzoswka breed. This breed is descended from short-tailed sheep formerly present on the Scandinavian peninsula and in Great Britain and Ireland. The sheep population from this region also represents two types of CR sequence (Meadows et al., 2005). The ancestors of Polish Wrzoswka may have migrated to Poland by land along the Scandinavian peninsula, Finland, and Lithuania, Latvia, and Estonia. Sheep representing the Asian type of CR sequence to Pomeranian sheep the breed which was reared and is still kept in the coastal region of Poland may have been introduced in a similar way. The most surprising results are for Wielkopolska andwiniarka sheep, from which Wielkopolska originates. The presence of both haplogroups in the Wielkopolska breed could be explained in two ways. Firstly, during the development of the Wielkopolska breed or later, females of breed(s) other winiarka which represented haplogroup A were probably introduced. Secondly, the primarywiniarka breed was probably much more genetically variable and may have had both mtDNA sequence types. It is highly likely that the individuals of haplogroup A were lost due to a rapid reduction in the breed population in the 1980s. Consequently, the few individuals from which the breed was restored represented only haplogroup B.

Another test for population expansion is Fus F test of neutrality, which serves to identify the number of mutations in a population under expansion. In the surveys performed elsewhere, the results of F statistics were negative for haplogroups A, B, and C, but statistically signicant only for the haplogroup A (HA) and haplogroup B (HB; Guo et al., 2005; Meadows et al., 2007), which means that these last two lineages are not a constant population regarding mtDNA.Fus test of neutrality for the population of Polish breeds is in accordance with these results. The results of both mismatch distribution and Fus statistics reect the strong reduction in sheep number in Poland which occurred in the 1990s.

The NJ phylogenetic tree formed two separate clades representing haplogroups B (more frequent) and A. The haplotypes representing HB formed a star-like network with a

single central haplotype, which in association with extensive haplotype sharing reveals a weak structure of Polish breeds and the existence of gene ow between the breeds studied.

The mean values of haplotype and nucleotide variation in all Polish sheep breeds are higher compared to the rate of European breeds. However, they are not as high as those of Asian populations (Pardeshi et al., 2007). The low genetic variation in the Wrzoswka and Pomorska breeds assessed by blood groups, serum proteins (Rychlik et al., 2007, 2009;Rychlik and Krawczyk, 2010), and microsatellites sequences (Radko et al., 2006; Kawecka and Pirkowska, 2011) contrasts with these results. This discrepancy may result from differences between the genetic markers used, such as much higher polymorphism of mtDNA than nuclear DNA. It also reects the female majority compared to a limited number of males used for reproduction. The lowest nucleotide variability expressed by blood groups, serum proteins (Rychlik et al., 2009), and mitochondrial control region was found for winiarka sheep. This may be caused by a relatively small number of sheep and rigorous selection for breed characteristics during the period when thewiniarka breed was restored.

5 Conclusions

This study has provided comprehensive information about the genetic origins of Polish local sheep breeds and conducted a phylogenetic analysis of them. Two maternal lineages (haplogroup A and B) from which the Polish sheep population descended were identied. None of the other reported mitochondrial haplogroups were identied. Moreover genetic diversity of all but thewiniarka breed is higher than that obtained for European populations but lower than that of Asian sheep breeds. The lowest genetic diversity was found forwiniarka.

Data availability

Data obtained during this research are openly available through the National Center for Biotechnology Information (NCBI, 2015) under accession numbers KT158312KT158460: http://www.ncbi.nlm.nih.gov/nuccore/KT158312

Web End =http://www.ncbi.nlm.nih.gov/ http://www.ncbi.nlm.nih.gov/nuccore/KT158312

Web End =nuccore/KT158312 to KT158460. Data regarding the number of sheep included in Genetic Resources Programme in Poland are publicly available through The National Research Institute of Animal Production (NRIAP, 2015) at http://owce.bioroznorodnosc.izoo.krakow.pl

Web End =http://owce.bioroznorodnosc.izoo.krakow.pl .

Acknowledgements. The study was supported by Ministry of Science and Higher Education grant No. N N311 541840.

Edited by: S. MaakReviewed by: T. Gruszecki and one anonymous referee

www.arch-anim-breed.net/59/227/2016/ Arch. Anim. Breed., 59, 227233, 2016

232 A. Koseniuk and E. Sota: Mitochondrial control region diversity in Polish sheep breeds

References

Bradley, D. G., MacHugh, D. E, Cunningham, P., and Loftus, R. T.: Mitochondrial diversity and the origins of African and European cattle, P. Natl. Acad. Sci. USA, 93, 51315135, 1996.

Bruford, M. W., Bradley, D. G., and Luikart, G. DNA markers reveal the complexity of livestock domestication, Nat. Rev., 4, 900910, 2003.

Excofer, L., Laval, G., and Schneider, S.: Arlequin ver. 3.0: An integrated software package for population genetics data analysis, Evol. Bioinform., 1, 4750, 2005.

Fu, Y.-X.: Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection, Genetics, 147, 915925, 1997.

Giuffra, E., Kijas, J. M. H., Amarger, V., Carlborg, ., Jeon, J.-T., and Andersson, L.: The origin of the domestic pig: independent domestication and subsequent introgression, Genetics, 154, 17851791, 2000.

Guo, J., Du, L. X., Ma, Y. H., Guan, W. J., Li, H. B., Zhao, Q. J., Rao, X., and Li, S. Q.: A novel maternal lineage revealed in sheep (Ovis aries), Anim. Genet., 36, 331336, 2005.

Hartl, D. L.: The origin of malaria: mixed messages from genetic diversity, Nat. Rev. Microbiol., 2, 1522, 2004.

Hiendleder, S., Lewalski, H., Wassmuth, R., and Janke, A.: The complete mitochondrial DNA sequence of the domestic sheep (Ovis Aries) and comparison with the other major ovine haplo-type, J. Mol. Evol., 47, 441448, 1998.

Hiendleder, S., Kaupe, B., Wassmuth, R., and Janke, A.: Molecular analysis of wild and domestic sheep questions current nomenclature and provides evidence for domestication from two different subspecies, P. Roy. Soc. Lond. B Bio., 269, 893904, 2002.Karpiski, M., Junkuszew, A., Drozd, L., and Gruszecki, T. M.: A phylogenetic comparison of wild sheep (Ovis musimon) and domestic sheep (Ovis aries) represented by BCP synthetic line using mitochondrial cytochrome b gene sequence analysis, Arch.Tierzucht, 49, 310-316, 2006.

Kawecka, A. and Pirkowska, K.: Characteristics of the genetic structure of native sheep breeds, Ann. Anim. Sci., 11, 371382, 2011.

Kimura, M.: A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences, J. Mol. Evol., 16, 111120, 1980.

Koressaar, T. and Remm, M.: Enhancements and modications of primer design program Primer3, Bioinformatics, 23, 12891291, 2007.

Librado, P. and Rozas, J.: Dnasp V5: a software for comprehensive analysis of DNA polymorphism data, Bioinformatics, 25, 1451 1452, 2009.

Loftus, R. T, Machugh, D. E, Bradley, D. G., Sharp, P. M., and

Cunningham, P.: Evidence for two independent domestications of cattle, P. Natl. Acad. Sci. USA, 9, 27572761, 1994.Luikart, G., Gielly, L., Excofer, L., Vigne, J.-D., Bouvet, J., and Taberlet, P.: Multiple maternal origins and weak phylogeo-graphic structure in domestic goats, P. Natl. Acad. Sci. USA, 98, 59275932, 2001.

Meadows, J. R. S., Cemal, I., Karaca, O., Gootwine, E., and Kijas,J. W.: Five ovine mitochondrial lineages identied from sheep breeds of the near east, Genetics, 175, 13711379, 2007.

Meadows, J. R. S., Li, K., Kantanen, J., Tapio, M., Sipos, W., Pardeshi, V., Gupta, V., Calvo, J. H., Whan, V., Norris, B., and Kijas, J., W.: Mitochondrial sequence reveals high levels of gene ow between breeds of domestic sheep from Asia and Europe, J. Hered., 96, 494501, 2005.

National Center for Biotechnology Information (NCBI): Ovis aries isolates, D-loop, partial sequences; mitochondrial, available at: http://www.ncbi.nlm.nih.gov/nuccore/KT158312

Web End =http://www.ncbi.nlm.nih.gov/nuccore/KT158312 to KT158460, last access: 31 October 2015.

National Research Institute of Animal Production (NRIAP): Sheep Biodiversity, Genetic Resources Programme, available at: http://owce.bioroznorodnosc.izoo.krakow.pl

Web End =http: http://owce.bioroznorodnosc.izoo.krakow.pl

Web End =//owce.bioroznorodnosc.izoo.krakow.pl , 2015.

Pardeshi, V. C., Kadoo, N. Y., Sainani, M. N., Meadows, J. R. S., Kijas, J. W., and Gupta, V. S.: Mitochondrial haplotypes reveal a strong genetic structure for three Indian sheep breeds, Anim. Genet., 38, 460466, 2007.

Pedrosa, S., Uzun, M., Arranz, J.-J., Gutierrez-Gil, B., San Primitivo, F., Bayon, Y. Evidence of three maternal lineages in near eastern sheep supporting multiple domestication events, P. R. Soc. B, 272, 22112217, 2005.

Pereira, F., Davis, S. J. M., Pereira, L., McEvoy, B., Bradley, D. G., Amorim, A. Genetic signatures of a mediterranean inuence in Iberian peninsula sheep husbandry, Mol. Biol. Evol., 23, 1420 1426, 2006.

Prusak, B., Grzybowski, T., and Bednarek, J.: Cytochrome b gene (cytb) in analysis of anonymous biological traces and its application in veterinary diagnostics and animal conservation, Anim. Sci., 23, 229236, 2005.

Radko, A., Rychlik, T., and Sota, E.: Genetic characterization of the wrzoswka sheep breed on the basis of 14 microsatellite DNA markers, Med. Weter., 62, 10731075, 2006.

Rosenberg, N. A., Burke, T., Elo, K., Feldman, M. W., Freidlin, P. J., Groenen, M. A., Hillel, J., Mki-Tanila, A., Tixier-Boichard, M., Vignal, A., Wimmers, K., and Weigend, S.: Empirical evaluation of genetic clustering methods using multilocus genotypes from 20 chicken breeds, Genetics, 159, 699713, 2001.

Rychlik, T. and Krawczyk, A.: Class I marker polymorphism in polish mountain sheep of coloured and white varieties, Ann. Anim. Sci., 9, 383391, 2009.

Rychlik, T. and Krawczyk, A.: Estimation of genetic variation in

Pomeranian sheep population included in the Genetic Resources Conservation Programme, Rocz. Nauk. PTZ., 6, 5562, 2010. Rychlik, T., Krawczyk, A., and Sikora, J.: Blood group and blood protein polymorphism in a conservation ock of Wrzoswka Sheep, Ann. Anim. Sci., 7, 227235, 2007.

Rychlik, T., Radko, A., and Krawczyk, A.: Preliminary evaluation of the genetic structure ofwiniarka sheep based on blood groups and polymorphic protein variants, Ann. Anim. Sci., 9, 35 42, 2009.

Rychlik, T., Pakulski, T., and Krawczyk, A.: Monitoring genetic variation in a conservation ock of coloured merino sheep based on blood group and protein polymorphism, Ann. Anim. Sci., 11, 4152, 2011.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S.: MEGA6: Molecular Evolutionary Genetics Analysis version 6.0, Mol. Biol. Evol., 30, 27252729, 2013.

Arch. Anim. Breed., 59, 227233, 2016 www.arch-anim-breed.net/59/227/2016/

A. Koseniuk and E. Sota: Mitochondrial control region diversity in Polish sheep breeds 233

Tapio, M., Marzanov, N., Ozerov, M., Cinkulov, M., Gonzarenko,G., Kiselyova, T., Murawski, M., Viinalass, H., and Kantanen,J.: Sheep mitochondrial DNA variation in European, Caucasian, and Central Asian areas, Mol. Biol. Evol., 23, 17761783, 2006.

Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth,B. C., Remm, M., and Rozen, S. G.: Primer3 new capabilities and interfaces, Nucleic Acids Res., 40, PMC3424584, doi:http://dx.doi.org/10.1093/nar/gks596

Web End =10.1093/nar/gks596 http://dx.doi.org/10.1093/nar/gks596

Web End = , 2012.

www.arch-anim-breed.net/59/227/2016/ Arch. Anim. Breed., 59, 227233, 2016