Arabidopsis acyl-acyl carrier protein synthetase AAE15 with medium chain fatty acid specificity is functional in cyanobacteria

Abstract

Cyanobacteria are potential hosts for the biosynthesis of oleochemical compounds. The metabolic precursors for such compounds are fatty acids and their derivatives, which require chemical activation to become substrates in further conversion steps. We characterized the acyl activating enzyme AAE15 of Arabidopsis encoded by At4g14070, which is a homologue of a cyanobacterial acyl-ACP synthetase (AAS). We expressed AAE15 in insect cells and demonstrated its AAS activity with medium chain fatty acid (C10-C14) substrates in vitro. Furthermore, we used AAE15 to complement a Synechocystis aas deletion mutant and showed that the new strain preferentially incorporates supplied medium chain fatty acids into internal lipid molecules. Based on this data we propose that AAE15 can be utilized in metabolic engineering strategies for cyanobacteria that aim to produce compounds based on medium chain fatty acids.

Kaczmarzyk et al. AMB Expr (2016) 6:7 DOI 10.1186/s13568-016-0178-z

Arabidopsis acyl-acyl carrier protein synthetase AAE15 withmedium chain fatty acid specicity is functional incyanobacteria

Danuta Kaczmarzyk1,2, Elton P. Hudson2 and Martin Fulda1*

Introduction

In recent years metabolic engineering has beneted from advances in gene synthesis and assembly that allow the implementation of complex biosynthetic pathways into a variety of microorganisms (Keasling 2012; Yadav etal. 2012; Seo etal. 2013). One focus of current research is the establishment of biosynthetic pathways for production a variety of oleo compounds such as fatty acids, alcohols, and alkanes in hosts such as yeast, Escherichia coli, and cyanobacteria (Steen etal. 2010; Lennen and Peger 2013; Peger etal. 2015; Savakis and Hellingwerf 2015). A cyanobacteria production host is particularly attractive, as their carbon and energy requirements are minimal. However, cyanobacteria-based production of fatty acids, fatty alcohols and alka(e)nes has been limited to several proof-of-principle studies (Liu et al. 2011; Tan et al. 2011; Ruffing and Jones 2012; Kaiser et al. 2013; Wang etal. 2013; Ruffing 2014; Yao etal. 2014). We strive for the utilization of cyanobacteria for the production of

oleochemical compounds. For biosynthetic production of oleochemicals, intrinsically synthesized fatty acids should serve as substrates for the diverse downstream metabolic pathways. In cyanobacteria, fatty acids are chemically activated by acyl-ACP synthetase (AAS) (Kaczmarzyk and Fulda 2010). Acyl-ACP synthetases can therefore play a critical role in metabolic engineering strategies for oleochemicals. In this work we were interested in the closer characterization of an Arabidopsis enzyme capable of generating acyl-ACPs and to evaluate its potential for pathway engineering in cyanobacteria.

In Arabidopsis enzymes capable of activating fatty acids belong to a superfamily of acyl-activating enzymes (AAEs), which consists of 63 members, and is divided into seven clades based on sequence similarities (Shockey et al. 2003). Clade I contains eleven members and long chain acyl-CoA synthetase (LACS; C16C20) activity has been conrmed for nine of these (Shockey etal. 2002). The conversion of very similar fatty acid substrates is reected by characteristic features of the amino acid sequences of the proteins of clade I. In particular, clade I AAEs dier from all other AAEs by the presence of an amino acid stretch separating two highly conserved sequence motifs. Interestingly, this amino acid linker is

*Correspondence: [email protected]

1 Department of Plant Biochemistry, Albrecht-von-Haller-Institute, Georg-August-University Goettingen, Goettingen, GermanyFull list of author information is available at the end of the article

2016 Kaczmarzyk et al. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/

Web End =http://creativecommons.org/licenses/by/4.0/ ), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Kaczmarzyk et al. AMB Expr (2016) 6:7

Page 2 of 9

remarkably longer in the two remaining proteins of clade I, for which initial tests were unable to proof LACS activity (Shockey et al. 2002). These proteins called AAE15 and AAE16 and encoded by At4g14070 and At3g23790, respectively, include an amino acid linker of approximately 70 amino acid residues, compared to about 40 amino acids found in eukaryotic LACSs (Shockey et al. 2002).

It was proposed previously that Arabidopsis AAE15 is a plastidial AAS (Koo et al. 2005). The conclusions were drawn from experiments in which plant extracts of Arabidopsis wild type and AAE15 and AAE16 knockout lines were incubated in the presence of radioactive labeled medium chain fatty acids. We showed later that acyl activating enzymes characterized by the presence of a linker motif of 6874 amino acid residues indeed have AAS activity (Kaczmarzyk and Fulda 2010). Sequences of this type could be found in sequenced genomes of almost all organisms performing oxygenic photosynthesis.

In a recent report, Beld etal. (2014) analyzed the activity of Arabidopsis AAE15 using a more direct approach. The enzyme was expressed in E. coli, and tested in acyl-CoA synthetase and AAS assays. It was concluded that AtAAE15 was a poor enzyme in both assays (Beld etal. 2014).

We were interested in further characterization of Arabidopsis AAE15, and its activity in Synechocystis sp. PCC6803. In this work, we expressed AAE15 heterologously in insect cells, puried it, and analyzed its enzymatic activity in vitro. We demonstrated AAS activity for AAE15 with some specicity for medium chain fatty acids (C10:0C14:0). Moreover, we expressed AAE15 in the background of an AAS deletion mutant of Synechocystis sp. PCC6803. This mutant is unable to incorporate exogenously added fatty acids into lipids, and secrete free fatty acids to the culture media (Kaczmarzyk and Fulda 2010). Feeding experiments with radiolabeled fatty acids conrmed medium chain fatty acid specicity of AAE15.

Materials andmethods

Heterologous expression oftagged AAE15 ininsect cells

For heterologous expression the Bac to Bac Baculovirus Expression System (Thermo Fisher Scientic) was used. Two variants of AAE15 (At4g14070) were cloned in frame with the N-terminal 6xHis tag of the pFastBacHT. The rst clone corresponds to the complete open reading frame including the native start codon. For the second clone the predicted plastidial targeting signal was removed, leading to an N-terminal deletion of 195 bps. The vector pUNI51 carrying At4g14070 served as a PCR template, and full length and truncated versions of the gene were amplied using a forward primer introducing a NcoI restriction site, and a reverse primer including the stop codon, introducing a NotI restriction site. The

primers sequences were 5-AGATCCATGGAAATTCGT CTGAAACCT-3 (forward 1), 5-AGTACCATGGCTT GCGAGTCAAAGGAAAAAGAAG-3 (forward 2), and 5-AGTAGCGGCCGCTTAACTGTAGAGTTGATCA ATC-3 (reverse). PCR products were cloned into pGEMT-vector (Promega), veried by sequencing, and subsequently transferred into pFastBacHT. The vectors were used to transform competent DH10Bac E. coli cells. Bacmid DNA was isolated and used to transfect Sf9 cells. A recombinant Baculovirus stock P1 was used to infect cells to produce a P2 Baculovirus stock, which was titered and used to infect insect cells for protein expression. Sf9 cells were infected at MOI 3 and grown at 27C as adherent cultures in T-75 culture asks using Sf-900 II SFM media supplemented with penicillin at 50UmL1,

and streptomycin at 50gmL1.

Isolation andpurication ofrecombinant protein frominsect cells

Cells from two T-75 asks were harvested 72 h after infection, washed once with PBS, and resuspended in 1 mL of extraction buer (50 mM TrisHCl pH 7.8, 150 mM NaCl). Cells were disrupted by sonication (2 30 s on ice) with Branson Sonier Cell Disruptor B15, and cell debris was removed by centrifugation at 3500g at 4C for 15min. Aliquots of the supernatant were saved for Western blot analysis and activity assays, and the remaining volume was centrifuged at 100,000g at 4C for 1h to isolate the membrane fraction. The membranes pellet was resuspended in 300L of solubilization buer (50mM TrisHCl, pH 7.8, 150mM NaCl, 2% Triton X-100), incubated at 4C overnight with agitation to release membrane-bound proteins, and claried by centrifugation at 100,000g at 4C for 30min. To purify His-tagged proteins the supernatant was applied to 800L of BD TALON resin (BD Biosciences) and agitated for 4h at 4 C to enable protein binding. The resin was transferred to a gravity-ow column and washed rst with the solubilization buer, and then with the same buer supplemented with 20mM imidazole to remove non-specifically bound proteins. The target protein was eluted with the solubilization buer containing 100mM EDTA. Fractions of 200 L were collected and dialyzed overnight against 400mL of the solubilization buer at 4C. Protein concentration in cellular lysates and membrane suspensions was determined using Bradford assays. Protein concentration in the sample of the puried protein was not determined.

Immunoblot analysis

Protein samples were separated on standard 10 % SDS polyacrylamide gels and transferred to the Optiran BA-S 83 membrane (Schleicher and Schuell). Membranes were

Kaczmarzyk et al. AMB Expr (2016) 6:7

Page 3 of 9

blocked with 3% BSA in TBST buer (10mM TrisHCl, 150 mM NaCl, 0.1 % Tween 20, pH 8.0), and probed with TetraHis-Antibody (Qiagen). As secondary antibody a peroxidase conjugated anti-mouse antibody was employed and the signals were detected by chemiluminescence using ECL Western Blotting Kit (Amersham).

Enzyme assays

The AAS activity was measured according to the protocol described before (Rock and Cronan 1981). The assay buer contained 2.5mM TrisHCl (pH 8.0), 2mM dithiothreitol, 0.25mM MgCl2, 5mM ATP, 10mM LiCl, 2%

Triton X-100, 15M acyl-carrier-protein (ACP; from E. coli K12), and 30M [1-14C] fatty acid (specic activity 53.760 mCi mmol1) in a total volume of 40 L. The assays were initiated by adding dened amounts of protein sample (50 g of total protein when crude cellular extracts were used as source of enzyme, and 10 L of puried protein), and were conducted at 37C for 30min. Transferring the assay volume to lter disks stopped the assays. The lter disks were dried and subsequently washed twice with 20mL of chloroform: methanol: acetic acid (3:6:1, v/v/v) to remove unreacted free fatty acids. Control assays using only free fatty acids demonstrated quantitative removal of the labelled fatty acids by the two washing steps. The radioactivity was determined by liquid scintillation counting (Liquid Scintillation Analyser 1900 TR, Fa. Canberra Packard).

To make sure that all fatty acid substrates are accessible to the enzyme, positive control assays were performed, in which puried AAS from Synechococcus elongatus PCC 7942 was used. Synechococcus AAS was characterized before, and showed broad substrate specicity (C12 C18) (Kaczmarzyk and Fulda 2010).

Lipid analytical methods

Pre-cultures of Synechocystis wild type and mutant strains were diluted to OD730 0.2 in 15mL BG11, and cultures were grown for 3days. Cells of 10mL culture were harvested, and washed twice in 0.1M NaHCO3. Intracellular and extracellular lipid extractions were performed according to the protocol established before (Bligh and Dyer 1959). Fatty acids were converted to their methyl esters according to modied protocols described earlier (Christie 1982; Stumpe etal. 2001). The fatty acid methyl esters were analyzed by gas chromatography using a Shimadzu GC-2010 gas chromatograph equipped with a Stabilwax column (Restek).

Fatty acid uptake assay

Cyanobacterial cells were collected from 10mL cultures at OD750 1 by centrifugation, resuspended in 2mL of fresh

BG11 medium, and transferred to a 2mL microcentrifuge

tubes. Radiolabeled [1-14C] fatty acids (lauric, specic activity 57 mCi mmol1, myristic 55 mCi mmol1, palmitic 60 mCi mmol1, stearic 58 mCi mmol1, oleic 56mCimmol1, linolenic 53.7mCimmol1; Amersham Biosciences) were individually added in amounts corresponding to 0.22Ci, and the tubes were placed on a platform shaker under light and incubated for 15h. Cells were pelleted and washed twice with 0.1 M NaHCO3. Total lipid extracts were prepared as follows: 1.5 mL chloroform: methanol (2:1, v/v) acidied with HCl were added to the cell pellets in 2mL tubes, and lipids were extracted for 4 h under shaking. Afterwards 500 L 0.45 % NaCl was added, the tubes were shaken briey, and centrifuged at 2000g for 2min for phase separation. The lower phase was transferred to a new tube, dried under a stream of nitrogen and resuspended in 20L of chloroform: methanol (1:1, v/v). Dierent lipid classes were separated by thin layer chromatography using acetone: toluene: water (91:30:8, v/v/v) as solvent and were visualized by uorography. Signals were detected with an image analyzer (FLA-3000, Fujilm).

Cyanobacteria strains andgrowth conditions

Liquid cultures of the glucose-tolerant Synechocystis sp. PCC 6803 and mutant strains were grown photoautotrophically in BG11 media buered to pH 7.8 with 25mM HEPES at 30C, with 45Es1m2 illumination in a climatic chamber (Percival Climatics SE-1100). For fatty acid proles analysis, cultures were grown under 1% (v/v) CO2 conditions. Mutant strains were cultivated in

BG11 containing an appropriate antibiotic for the selection (kanamycin 25 g mL1, and/or chloramphenicol 20gmL1). To prepare solid media 0.3% (w/v) sodium thiosulfate pentahydrate and 1.5% (w/v) agar were added to the buered BG11 media. The plates were incubated under illumination with 25Es1m2.

A aas deletion strain, in which a kanamycin resistance cartridge replaced part of the coding region of the gene slr1609, was created before (Kaczmarzyk and Fulda 2010). This strain was used as a host to overexpress homologous acyl activating enzyme from Arabidopsis thaliana: AAE15 (At4g14070).

In the rst strategy the Arabidopsis gene was introduced into the cyanobacterial genome via homologous recombination. To this end, expression constructs were prepared which contained a promoter of a kanamycin resistance gene, the Arabidopsis AAE15 gene, the terminator sequence of a native aas, and the chloramphenicol resistance gene as a selection marker. The whole assembly was anked by fragments of the kanamycin resistance gene, which served as homology regions for the recombination. The list of primers used for amplifying those blocks is provided in Table 1. The kanamycin resistant

Kaczmarzyk et al. AMB Expr (2016) 6:7

Page 4 of 9

Table 1 List ofprimers

Name Sequence

KanF1Sac ACGAGAGCTCGCCCCATCATCCAGCCAGA KanR1Xba CTGAATCTAGATATTCTTCTAATACCTGG KanF2Hind CTAGTAAGCTT GCGCCGGTTGCATTCGA KanR2Kpn TGAATGGTACC ATCATCCAGCCAGAAAGT KanProSpeF GACTAGTGAATCGCCCCATCATCCAGCCA KanProNcoR TCCATGGCACCCCTTGTATTACTGTTTATG AAE15F AGATCCATGGAAATTCGTCTGAAACCTAAE15R AGTAGCGGCCGCTTAACTGTAGAGTTGATCAATC SYN68TermFEcoNot GTAGAATTCGCGGCCGCTTAAGAACCTGTTTATA

AAGTCT SYN68TermRHind GAACTTGCCGCAAGCTTACTC JOANRT15 TTTCCCTGGTGATTTCTTCG JOANRT16 ATATGCCCTGGGAGGGTTAC DAKART01 CGATGGCTTGTTTCAGATCA DAKART02 ATGCGGTTGAAAAACTCAGG DAKART03 GCCACCCTGATCTACACCTC DAKART04 TTCTAGGGAGTGCCAACAGG

aas strain was transformed with a pUC19 vector carrying the expression construct, and after few rounds of re-streaking on BG11 agar plates containing chloramphenicol, fully segregated complementation strain aas:AAE15 was obtained. The complete segregation was conrmed by PCR.

In the second strategy the aas Synechocystis host was transformed with a replicative plasmid pJA2c, carrying AAE15, devoid of the plastidial targeting signal, under the control of psbA2 promoter. The pJA2c vector was constructed by Huang et al. (2010), and modied later (Anfelt etal. 2013), and contains chloramphenicol resistance gene as a selection marker. The primers used for amplication of AAE15 were as follows: forward (adding XbaI restriction site) 5-GACCTCTAGAATGTG CGAGTCAAAGGAAAAAGAAG-3, reverse (adding SpeI restriction site) 5-CTACACTAGTTTAACTGTAGA GTTGATCAATC-3.

RTqPCR

Synechocystis cells were collected from 6mL cultures at OD730 1, and total RNA was isolated with GeneJET RNA

Purication Kit (Thermo Scientic) according to manufacturers instructions with the following modications: lysozyme concentration in TE buer was 40 mg L1,

and cells were disrupted by vortexing with glass beads for 15 min. DNA was removed with RapidOut DNA Removal Kit (Thermo Scientic).

RT-qPCR was performed in the CFX96 Real-Time PCR Detection System (Bio-Rad) with iScript One-Step RT-PCR Kit with SYBR Green (Bio-Rad). All reactions

were performed in duplicate, and no-RT controls were included. As a reference gene rpoB (sll1787) encoding RNA polymerase beta subunit was used. The list of primers is provided in Table1.

Results

AAE15 has AAS activity invitro, withspecicity formedium chain fatty acids

To determine the in vitro enzymatic activity of AAE15, the protein fused to an N-terminal polyhistidine-tag was expressed in a Baculovirus system. Attempts to express the complete open reading frame in Sf9 cells resulted in either very low or undetectable amounts of recombinant protein. Removing the sequence encoding a predicted plastidial targeting peptide increased the expression level signicantly, and the construct yielded fusion protein of the expected size~79kD (Fig.1).

The crude protein extract of lysed cells expressing AAE15 was analyzed in enzymatic activity assays. The assays were conducted in the presence of ATP, ACP and [1-14C] labeled fatty acids. We tested nine linear fatty acids, ranging in chain length from 8 to 18 carbon atoms and containing between 0 to 3 double bonds. AAE15 demonstrated AAS activity with medium chain fatty acids (Fig.2a). Specic enzyme activities were 66.7 (SD 13.3), 102.7 (SD 3.6), and 157.2 (SD 9.2) pmolmin1mg1 total protein for decanoic, lauric and myristic acid substrates, respectively. This substrate specicity assay was repeated with puried AAE15 (Fig. 2b), and the result conrmed the specicity for medium chain length fatty

Kaczmarzyk et al. AMB Expr (2016) 6:7

Page 5 of 9

acids. Moreover, the data proved that AAE15 was able to activate other fatty acids as well, but with clearly reduced efficiency.

Complementation ofSynechocystis aas knockout withArabidopsis AAE15

In order to examine the activity of Arabidopsis AAE15 invivo, we performed feeding of radioactive fatty acids. A Synechocystis strain lacking its endogenous AAS (aas) was used as a host to express Arabidopsis AAE15. The AAE15 expression cassette was integrated into the chromosome of the cyanobacteria aas strain by homologous recombination to create aas:AAE15. Complete segregation of the newly generated strain was conrmed by PCR. Wild type Synechocystis and the aas strain served as positive and negative control, respectively in fatty acid uptake assays.

Cultures were grown in media supplemented with radiolabeled fatty acids, and subsequently total lipid extracts

of the cells were separated by thin layer chromatography in order to trace the fate of the supplemented fatty acids. All tested fatty acids were incorporated into dierent lipid classes in wild type cells, while in the aas mutant strain the label strictly remained in the fraction of free fatty acids. In absence of the endogenous AAS protein, the supplied free fatty acids were absolutely inaccessible to the cellular metabolism. The expression of AAE15 in the aas mutant strain could partially restore the wild type phenotype indicated by the incorporation of fatty acids into lipids (Fig.3). The intensities of the spots corresponding to monogalactosyl diacylglycerol (MGDG), the main lipid fraction in extracts, of the complemented strains were clearly weaker compared to those of wild type extracts, but they proved the capability of AAE15 to activate exogenously added free fatty acids (Table2). The endogenous AAS of Synechocystis mediated the incorporation of the dierent chain-length radiolabeled fatty acids with comparable efficiency, while aas:AAE15 preferentially incorporated lauric acid and myristic acid. Thus, the in vivo experiments conrmed the results of the invitro activity assays showing preference of AAE15 for medium chain fatty acids and demonstrated AAE15 activity in Synechocystis.

Expression ofArabidopsis AAE15, resulted inchanges inintracellular andextracellular free fatty acids pools inthe cyanobacterial aas strain

The fatty acid uptake assays demonstrated the ability of Arabidopsis AAE15 to activate exogenously added fatty acids of dierent carbon chain length. We next evaluated how the expression of AAE15 inuenced the fatty acid metabolism in cyanobacteria. We analyzed the secreted fatty acids of aas:AAE15 and compared this to aas, and wild type Synechocystis. The results showed that like aas, aas:AAE15 secreted large amounts of fatty acids into the culture medium (Fig. 4a). Total free fatty acids after 3days were 3.3 (SD 1.0) mgg1 of dry cell weight (DCW) for aas, and 2.6 (SD 0.7) mg g1 DCW for aas:AAE15 (Fig.4a). The intracellular pool of free fatty acids of aas:AAE15 was also similar to aas, namely an increased amounts of total free fatty acids and a signi-cant accumulation of 18:0 in comparison to the wild type was observed (Fig. 4b). Concentrations of internal free fatty acids were 2.7 (SD 0.3) mgg1 DCW for aas, 1.7 (SD 0.2) mgg1 DCW for aas:AAE15, and 0.5 (SD 0.1) mgg1 DCW for wild type. Interestingly, free stearic acid (C18:0) was 50% lower in the aas:AAE15 strain, compared to aas (Fig.4b). Overall, expression of AAE15 in the aas strain did not aect fatty acid proles and did not have a signicant complementation eect.

Since aas:AAE15 did not show signicant dierences to aas invivo, we attempted to increase AAE15

Kaczmarzyk et al. AMB Expr (2016) 6:7

Page 6 of 9

Table 2 Intensities ofspots representing FFA andMGDG

Radiolabeled fatty acids were fed to cells of Synechocystis sp. PCC6803 wild type (WT), the aas knockout mutant (aas), and the aas mutant complemented with Arabidopsis AAE15 (aas:AAE15)

WT aas aas:AAE15

FFA MGDG FFA MGDG FFA MGDG

12:0 137.4 989.7 36.6 0.3 49.7 57.5 14:0 82.1 252.2 273.3 0 260.9 139.6 16:0 372.4 968.3 2689 3.2 4171.5 10.1 18:0 1665.7 205.7 919.3 1.2 1090.7 2.3 18:1 88.4 294.8 642.9 1.1 687.1 2.9 18:3 32.6 223.8 63.3 0.8 61.2 3.1

expression levels by using a replicative plasmid, and a stronger promoter. Additionally, we removed the plastidial targeting sequence, to express exactly the version of the protein as it is found in plastids of Arabidopsis (Zybailov et al. 2008). Before, we observed that removing the transit peptide resulted in more robust expression levels in insect cells. The truncated AAE15 was then cloned into an episomal vector (pJA2c) under control of the strong promoter PpsbA2. This plasmid was transformed into aas to give aas:pJA2AAE15. We analyzed the expression level of AAE15 in mutant strains, and found that AAE15 expression was 170 fold higher in aas:pJA2AAE15 compared to aas:AAE15 (Table 3). The increased expression resulted in the complete reversion of the biochemical phenotypes of the aas strain when complemented with AAE15 (Fig. 4). The strain aas:pJA2AAE15 did not secrete free fatty acids and the prole of the intracellular free fatty acids was similar to wild type, with very low concentrations of free

stearic acid. The concentration of intracellular fatty acids 0.4 (SD 0.1) mgg1 DCW was also similar to wild type cells (Fig.4a, b). These results suggest that expression of AAE15 in aas:pJA2AAE15 was high enough to overcome its poor preference for long chain fatty acids. The prole of membrane bound fatty acids in wild type and mutant Synechocystis strains did not show any signicant dierences (Fig. 4c). Growth rates of all strains investigated did not show any signicant dierences either (Fig.5).

Discussion

In this work we characterized the Arabidopsis AAE15 enzyme in Synechocystis sp. PCC6803. We were particularly interested in evaluating the possibility to introduce modied substrate specicity into the cyano-bacterial fatty acid metabolism. To obtain rst insight into its enzymatic parameters we expressed Arabidopsis AAE15 in insect cells, and determined its AAS activity

Kaczmarzyk et al. AMB Expr (2016) 6:7

Page 7 of 9

Gene expression level foracyl activating enzymes

a,

invitro. In a recent report it was concluded upon heterologous expression in E. coli that the enzyme possesses poor activity in both acyl-CoA synthetase and AAS assays (Beld et al. 2014). In that study the full-length protein was expressed in the E. coli strain BL21. We propose that removing of the N-terminal transit peptide is

indicated considerably dierent substrate specicity compared to the Synechocystis endogenous AAS (Kaczmarzyk and Fulda, 2010).

The invitro data was conrmed by invivo experiments. When we replaced the native aas gene of Synechocystis by AAE15 and fed the mutant strain with labeled fatty acids the results again indicated a very clear preference for medium chain fatty acids. In contrast, the endogenous AAS activity of the Synechocystis wild type strain

Kaczmarzyk et al. AMB Expr (2016) 6:7

Page 8 of 9

mediated comparable incorporation of all oered fatty acids and showed no particular substrate specicity (Fig.3).

On the other hand, our data showed also that a more robust expression of AAE15 is able to complement the inactivation of the endogenous AAS protein in Synechocystis. When the truncated version of AAE15 lacking the plastidial targeting signal was expressed under control of the strong psbA2 promoter the fatty acid secretion phenotype of the cyanobacterial aas knockout strain was revoked, indicating that all fatty acids that could be detected in the culture media of the aas strain, were activated and recycled in the strain complemented, aas:pJA2AAE15.

The AAE15 enzyme could be a useful tool for metabolic engineering projects aimed at the biosynthesis of medium chain fatty acid-derived products. There has been growing interest in engineering microorganisms for fatty acid-derived chemicals and fuels (Steen etal. 2010; Lennen and Peger 2013; Peger etal. 2015; Savakis and Hellingwerf 2015). One of the challenges is to tailor the carbon chain length in order to obtain the desired properties of the nal fatty acid-derived products. For example, medium chain length fatty acids are extensively used for the production of soap and detergents (Dyer et al. 2008), and medium chain length alkanes are main components of jet fuel (Kallio etal. 2014). Reports addressing the chain length issue propose expression of acyl-ACP thioesterases with medium chain fatty acids specicity, as enzymes that can control the length of the end product (Zheng etal. 2012; Choi and Lee 2013; Howard etal. 2013; Liu etal. 2013; Torella etal. 2013; Youngquist etal. 2013) Enzymes involved in oleochemical biosynthesis pathways usually require a CoA- or ACP-activated derivative of the fatty acid substrate. In cyanobacteria, fatty acid metabolism relies on ACP-thioesters, which are the preferred substrates of acyl transferases (Weier etal. 2005) in lipid synthesis, and the acyl-ACP reductase of the alkane synthesis pathway (Schirmer etal. 2010). A strategy aimed at the production of medium chain length fatty alcohols in E. coli was published recently (Young-quist etal. 2013). An AAS such as AAE15 that can efficiently deliver activated medium chain fatty acids to downstream metabolic pathways is of signicant biotechnological interest.

Author details

1 Department of Plant Biochemistry, Albrecht-von-Haller-Institute, Georg-August-University Goettingen, Goettingen, Germany. 2 School of Biotechnology, Science for Life Laboratory, KTH-Royal Institute of Technology, Stockholm, Sweden.

Acknowledgements

This work was supported by the Deutsche Forschungsgemeinschaft (German Research Foundation; grant no. FU 430/31) and by the Swedish Foundation for Strategic Research (SSF) grant number RBP14-0013.

Competing interests

The authors declare that they have no competing interests.

Received: 5 January 2016 Accepted: 8 January 2016

References

Anfelt J, Hallstrm B, Nielsen J, Uhln M, Hudson EP. Using transcriptomics to improve butanol tolerance of Synechocystis sp. strain PCC 6803. Appl Environ Microbiol. 2013;79:741927. doi:http://dx.doi.org/10.1128/AEM.02694-13

Web End =10.1128/AEM.02694-13 .

Beld J, Finzel K, Burkart MD. Versatility of acyl-acyl carrier protein synthetases.

Chem Biol. 2014;21:12939. doi:http://dx.doi.org/10.1016/j.chembiol.2014.08.015

Web End =10.1016/j.chembiol.2014.08.015 .

Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purication.

Can J Biochem Physiol. 1959;37(8):91117. doi:http://dx.doi.org/10.1139/o59-099

Web End =10.1139/o59-099 . Choi YJ, Lee SY. Microbial production of short-chain alkanes. Nature.

2013;502:5714. doi:http://dx.doi.org/10.1038/nature12536

Web End =10.1038/nature12536 .

Christie WW. A simple procedure for rapid transmethylation of glycerolipids and cholesteryl esters. J Lipid Res. 1982;23:10725.

Dyer JM, Stymne S, Green AG, Carlsson AS. High-value oils from plants. Plant J.

2008;54:64055. doi:http://dx.doi.org/10.1111/j.1365-313X.2008.03430.x

Web End =10.1111/j.1365-313X.2008.03430.x .

Howard TP, Middelhaufe S, Moore K, Edner C, Kolak DM, Taylor GN, Parker DA,

Lee R, Smirno N, Aves SJ, Love J. Synthesis of customized petroleum-replica fuel molecules by targeted modication of free fatty acid pools in Escherichia coli. Proc Natl Acad Sci USA. 2013;110:763641. doi:http://dx.doi.org/10.1073/pnas.1215966110

Web End =10.1073/ http://dx.doi.org/10.1073/pnas.1215966110

Web End =pnas.1215966110 Huang H-H, Camsund D, Lindblad P, Heidorn T. Design and characterizationof molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Res. 2010;38:257793. doi:http://dx.doi.org/10.1093/nar/gkq164

Web End =10.1093/nar/gkq164 .

Kaczmarzyk D, Fulda M. Fatty acid activation in cyanobacteria mediated by acyl-acyl carrier protein synthetase enables fatty acid recycling. Plant Physiol. 2010;152:1598610. doi:http://dx.doi.org/10.1104/pp.109.148007

Web End =10.1104/pp.109.148007 .

Kaiser BK, Carleton M, Hickman JW, Miller C, Lawson D, Budde M, Warrener P,

Paredes A, Mullapudi S, Navarro P, Cross F, Roberts JM. Fatty aldehydesin cyanobacteria are a metabolically exible precursor for a diversityof biofuel products. PLoS One. 2013;8:e58307. doi:http://dx.doi.org/10.1371/journal.pone.0058307

Web End =10.1371/journal. http://dx.doi.org/10.1371/journal.pone.0058307

Web End =pone.0058307 .

Kallio P, Psztor A, Akhtar MK, Jones PR. Renewable jet fuel. Curr Opin Biotechnol. 2014;26:505. doi:http://dx.doi.org/10.1016/j.copbio.2013.09.006

Web End =10.1016/j.copbio.2013.09.006 .

Keasling JD. Synthetic biology and the development of tools for metabolic engineering. Metab Eng. 2012;14:18995. doi:http://dx.doi.org/10.1016/j.ymben.2012.01.004

Web End =10.1016/j. http://dx.doi.org/10.1016/j.ymben.2012.01.004

Web End =ymben.2012.01.004 .

Koo AJK, Fulda M, Browse J, Ohlrogge JB. Identication of a plastid acyl-acyl carrier protein synthetase in Arabidopsis and its role in the activationand elongation of exogenous fatty acids. Plant J. 2005;44:62032. doi:http://dx.doi.org/10.1111/j.1365-313X.2005.02553.x

Web End =10.1111/j.1365-313X.2005.02553.x .

Lennen RM, Peger BF. Microbial production of fatty acid-derived fuelsand chemicals. Curr Opin Biotechnol. 2013;24:104453. doi:http://dx.doi.org/10.1016/j.copbio.2013.02.028

Web End =10.1016/j. http://dx.doi.org/10.1016/j.copbio.2013.02.028

Web End =copbio.2013.02.028 .

Liu A, Tan X, Yao L, Lu X. Fatty alcohol production in engineered E. coli expressing Marinobacter fatty acyl-CoA reductases. Appl Microbiol Biotechnol. 2013;97:706171. doi:http://dx.doi.org/10.1007/s00253-013-5027-2

Web End =10.1007/s00253-013-5027-2 .

Liu X, Sheng J, Curtiss R III. Fatty acid production in genetically modied cyanobacteria. Proc Natl Acad Sci. 2011;108:6899904. doi:http://dx.doi.org/10.1073/pnas.1103014108

Web End =10.1073/ http://dx.doi.org/10.1073/pnas.1103014108

Web End =pnas.1103014108 .

Peger BF, Gossing M, Nielsen J. Metabolic engineering strategies for microbial synthesis of oleochemicals. Metab Eng. 2015;29:111. doi:http://dx.doi.org/10.1016/j.ymben.2015.01.009

Web End =10.1016/j. http://dx.doi.org/10.1016/j.ymben.2015.01.009

Web End =ymben.2015.01.009 .

Rock CO, Cronan JE. Acyl-acyl carrier protein synthetase from Escherichia coli.

Methods Enzymol. 1981;71:1638.

Ruffing AM. Improved free fatty acid production in cyanobacteria with Synechococcus sp. PCC 7002 as host. Front Bioeng Biotechnol. 2014;2:110. doi:http://dx.doi.org/10.3389/fbioe.2014.00017

Web End =10.3389/fbioe.2014.00017 .

Ruffing AM, Jones HDT. Physiological eects of free fatty acid production in genetically engineered Synechococcus elongatus PCC 7942. Biotechnol Bioeng. 2012;109:21909. doi:http://dx.doi.org/10.1002/bit.24509

Web End =10.1002/bit.24509 .

Savakis P, Hellingwerf KJ. Engineering cyanobacteria for direct biofuel production from CO2. Curr Opin Biotechnol. 2015;33:814. doi:http://dx.doi.org/10.1016/j.copbio.2014.09.007

Web End =10.1016/j.

http://dx.doi.org/10.1016/j.copbio.2014.09.007

Web End =copbio.2014.09.007 .

Kaczmarzyk et al. AMB Expr (2016) 6:7

Page 9 of 9

Schirmer A, Rude MA, Li X, Popova E, del Cardayre SB. Microbial biosynthesis of alkanes. Science. 2010;329:55962. doi:http://dx.doi.org/10.1126/science.1187936

Web End =10.1126/science.1187936 .

Seo SW, Yang J, Min BE, Jang S, Lim JH, Lim HG, Kim SC, Kim SY, Jeong JH, Jung GY. Synthetic biology: tools to design microbes for the production of chemicals and fuels. Biotechnol Adv. 2013;31:8117. doi:http://dx.doi.org/10.1016/j.biotechadv.2013.03.012

Web End =10.1016/j. http://dx.doi.org/10.1016/j.biotechadv.2013.03.012

Web End =biotechadv.2013.03.012 .

Shockey JM, Fulda MS, Browse J. Arabidopsis contains a large superfamily of acyl-activating enzymes. Phylogenetic and biochemical analysis reveals a new class of acyl-coenzyme a synthetases. Plant Physiol. 2003;132:106576. doi:http://dx.doi.org/10.1104/pp.103.020552

Web End =10.1104/pp.103.020552 .

Shockey JM, Fulda MS, Browse JA. Arabidopsis contains nine long-chain acyl-coenzyme a synthetase genes that participate in fatty acid and glycerolipid metabolism. Plant Physiol. 2002;129:171022. doi:http://dx.doi.org/10.1104/pp.003269

Web End =10.1104/ http://dx.doi.org/10.1104/pp.003269

Web End =pp.003269 .

Steen EJ, Kang Y, Bokinsky G, Hu Z, Schirmer A, McClure A, Del Cardayre SB, Keasling JD. Microbial production of fatty-acid-derived fuels and chemicals from plant biomass. Nature. 2010;463:55962. doi:http://dx.doi.org/10.1038/nature08721

Web End =10.1038/ http://dx.doi.org/10.1038/nature08721

Web End =nature08721 .

Stumpe M, Kandzia R, Gbel C, Rosahl S, Feussner I. A pathogen-inducible divinyl ether synthase (CYP74D) from elicitor-treated potato suspension cells. FEBS Lett. 2001;507:3716. doi:http://dx.doi.org/10.1016/S0014-5793(01)03019-8

Web End =10.1016/S0014-5793(01)03019-8 .

Tan X, Yao L, Gao Q, Wang W, Qi F, Lu X. Photosynthesis driven conversion of carbon dioxide to fatty alcohols and hydrocarbons in cyanobacteria. Metab Eng. 2011;13:16976. doi:http://dx.doi.org/10.1016/j.ymben.2011.01.001

Web End =10.1016/j.ymben.2011.01.001 .

Torella JP, Ford TJ, Kim SN, Chen AM, Way JC, Silver PA. Tailored fatty acid synthesis via dynamic control of fatty acid elongation. Proc Natl Acad Sci USA. 2013;110:112905. doi:http://dx.doi.org/10.1073/pnas.1307129110

Web End =10.1073/pnas.1307129110 .

Wang W, Liu X, Lu X. Engineering cyanobacteria to improve photosynthetic production of alka(e)nes. Biotechnol Biofuels. 2013;6:69. doi:http://dx.doi.org/10.1186/1754-6834-6-69

Web End =10.1186/1754-6834-6-69 .

Weier D, Mller C, Gaspers C, Frentzen M. Characterisation of acyltransferases from Synechocystis sp. PCC6803. Biochem Biophys Res Commun. 2005;334:112734. doi:http://dx.doi.org/10.1016/j.bbrc.2005.06.197

Web End =10.1016/j.bbrc.2005.06.197 .

Yadav VG, De Mey M, Giaw Lim C, Kumaran Ajikumar P, Stephanopoulos G.

The future of metabolic engineering and synthetic biology: towards a systematic practice. Metab Eng. 2012;14:23341. doi:http://dx.doi.org/10.1016/j.ymben.2012.02.001

Web End =10.1016/j. http://dx.doi.org/10.1016/j.ymben.2012.02.001

Web End =ymben.2012.02.001 .

Yao L, Qi F, Tan X, Lu X. Improved production of fatty alcohols in cyano-bacteria by metabolic engineering. Biotechnol Biofuels. 2014;7:94. doi:http://dx.doi.org/10.1186/1754-6834-7-94

Web End =10.1186/1754-6834-7-94 .

Youngquist JT, Schumacher MH, Rose JP, Raines TC, Politz MC, Copeland

MF, Peger BF. Production of medium chain length fatty alcohols from glucose in Escherichia coli. Metab Eng. 2013;20:17786. doi:http://dx.doi.org/10.1016/j.ymben.2013.10.006

Web End =10.1016/j. http://dx.doi.org/10.1016/j.ymben.2013.10.006

Web End =ymben.2013.10.006 .

Zheng Y-N, Li L-L, Liu Q, Yang J-M, Wang X-W, Liu W, Xu X, Liu H, Zhao

G, Xian M. Optimization of fatty alcohol biosynthesis pathway for selectively enhanced production of C12/14 and C16/18 fatty alcohols in engineered Escherichia coli. Microb Cell Fact. 2012;11:65. doi:http://dx.doi.org/10.1186/1475-2859-11-65

Web End =10.1186/1475-2859-11-65 .

Zybailov B, Rutschow H, Friso G, Rudella A, Emanuelsson O, Sun Q, van Wijk

KJ. Sorting signals, N-terminal modications and abundance of the chloroplast proteome. PLoS One. 2008;3(4):e1994. doi:http://dx.doi.org/10.1371/journal.pone.0001994

Web End =10.1371/journal. http://dx.doi.org/10.1371/journal.pone.0001994

Web End =pone.0001994 .