Introduction
Errors during DNA replication can lead to aneuploidy and DNA damage (Passerini et al., 2016). An insufficient concentration of replication factors can also lead to genomic instability (Orr et al., 2010). Therefore, it is important that cells ensure that a single round of DNA replication occurs in each cell cycle. DNA replication initiates from DNA replication origins (origins). In Saccharomyces cerevisiae origins are formed of an autonomously replicating sequence (ARS) which contains an 11bp ARS consensus sequence (ACS). Origins recruit the origin recognition complex (ORC) via the ACS, which in turn facilitates origin licensing. Origin licensing factors (Cdc6 and Cdt1) bind at the origin and allow the mini-chromosome maintenance (MCM) proteins to also bind. Post-licensing, firing factors (Cdc45, Sld2, Sld3, Dpb11) recruit the loading complex which contains GINS (a four-subunit complex), Cdc45 and the replicative polymerases (Polε, Polδ and Polα) (Yeeles et al., 2015). Cdc45, MCM and GINS collectively form the CMG (Yeeles et al., 2015). The CMG melts DNA, unwinding the DNA double helix to allow loading of the polymerases, to begin DNA replication. To prevent re-replication, origin licensing in eukaryotes is limited to G1 phase of the cell cycle, and origin firing is restricted to S phase (Blow & Dutta, 2005). In S. cerevisiae, loss of DNA re-replication control leads to genome instability including gene amplification (Green et al., 2010).
The activities of licensing and firing factors are influenced by cell cycle kinases. For example, origin firing is dependent upon two kinases: the Dbf4-dependent kinase (DDK) and the cyclin-dependent kinase (CDK). DDK phosphorylates multiple chromatin-bound MCM subunits, including Mcm4 and Mcm6. Phosphorylation facilitates Sld3, Sld7 and Cdc45 binding. Subsequently, CDK phosphorylates Sld3 and Sld2, which then recruits the loading complex (Zegerman, 2015), which leads to origin firing.
However, the kinase-driven view of replication initiation outlined above is now known to be incomplete (Davé et al., 2014). A role for dephosphorylation in controlling DNA replication initiation was established recently (Davé et al., 2014; Hiraga et al., 2014; Mattarocci et al., 2014; Poh et al., 2014). The Rap1-interacting factor (Rif1) is able to recruit protein phosphatase 1 (PP1) to MCM subunits and dephosphorylate them (Davé et al., 2014; Hiraga et al., 2014; Mattarocci et al., 2014; Poh et al., 2014). A greater DDK concentration is therefore required to promote origin firing, since the MCM phosphorylation rate must exceed its dephosphorylation rate. Conversely, DDK can bind directly to Rif1 and inhibit its interaction with PP1 (Hiraga et al., 2014). Therefore, as DDK levels increase during S phase, MCM phosphorylation is promoted and dephosphorylation is inhibited. The resulting feedback loop allows for a rapid switch from low MCM phosphorylation in G1 to high MCM phosphorylation in S phase.
Rif1-PP1 involvement in DNA replication control appears to be conserved throughout eukaryotes, both Xenopus egg extract and HeLa cell studies support the findings in yeast (Poh et al., 2014; Yamazaki et al., 2012). Additionally, there is evidence that Rif1-PP1 controls further aspects of DNA replication initiation. For example, in yeast, Rif1-PP1 may antagonise CDK phosphorylation (Stark et al., 2015). In RIF1 null yeast strains phosphorylation of Sld3, but not Sld2, is increased (Mattarocci et al., 2014). Deletion of RIF1 can partially rescue the phenotype of temperature-sensitive (ts-) origin firing factor alleles including Dpb11, Cdc45 and Sld3 (Mattarocci et al., 2014). In human cells, Rif1-PP1 is active during mitotic exit. Dephosphorylation of Orc2, an ORC subunit, allows the process of origin licensing to start again. Human Rif1-PP1 not only antagonises MCM phosphorylation, but also positively promotes DNA replication origin licensing (Hiraga et al., 2017).
Before a role for Rif1-PP1 in DNA replication was described, Rif1 was known to be a telomere-associated protein, contributing to the late replication of telomeric regions (Lian et al., 2011). Rif1 has also been implicated in a PP1-independent role in DNA replication at the whole genome level. The conserved replication timing of some genomic domains is altered in RIF1 mutant cells due to disordered chromatin organisation. These observations led to a role for Rif1 in physically grouping similarly timed replication domains being described (Foti et al., 2016).
The importance of Rif1-PP1 dephosphorylation raises the question of whether other phosphatases are implicated in DNA replication control. A large genomic screen for genetic interactions previously identified a potential synthetic rescue of mutant ORC2 by additional RTS1 deletion (Costanzo et al., 2010). Rts1 is a regulatory subunit for the PP2A phosphatase, which has been previously implicated in DNA replication. PP2A antagonises the DNA damage checkpoint protein Chk1 (Petersen et al., 2006), and its function is required for Cdc45 loading onto chromatin (Chou et al., 2002; Peplowska et al., 2014). Whether this interaction is direct, occurs via dephosphorylation of Sld3 (Guo et al., 2015), or uses another protein complex (Chowdhury et al., 2010) is as yet unclear. It has also been proposed that another regulatory subunit of PP2A, PR48, allows it to bind to and dephosphorylate the licensing factor Cdc6 during mitotic exit, promoting origin licensing during G1 (Yan et al., 2000). Unlike PP1, which in humans is regulated by more than 90 different subunits, PP2A has only 13 regulatory subunits in humans, and 3 in yeast (Stark et al., 2015).
Whilst Rif1 is associated with telomeres and late-replicating regions of DNA, Rts1 is associated with the protection of centromeres, which are known to replicate early (Mccarroll & Fangman, 1988). Rts1-PP2A is enriched at centromeres pre-anaphase promoting cell cycle progression after appropriate microtubule binding, and correct chromosome segregation (Peplowska et al., 2014).
This study investigates a putative role for Rts1-PP2A, akin to Rif1-PP1, in controlling DNA replication licensing and firing. We use a panel of ts-replication factor mutants to screen for synthetic rescue by RTS1 deletion. We find that RTS1 deletion using classical genetics does not alleviate the lethality caused by inactivating origin initiation factors. Whilst the published synthetic rescue given by rif1Δ is confirmed in these strains, we find an additive effect for rts1Δ. This indicates that two separate pathways are compromised. Although these data contradict the original genetic interactions screen (Costanzo et al., 2010) they are in accordance with a more recent screen (Costanzo et al., 2016), suggesting that RTS1 deletion results in an enhanced (rather than alleviated) phenotype in some replication factor mutants.
Methods
Yeast strains and methods
Yeast strains were cultured both in liquid and on solid YPAD media (CCM1010 and CM0510 respectively; Formedium, Hunstanton, UK), and manipulated according to established practices (Treco & Winston, 2008). Most yeast strains used had a W303 background. However, strains from the S. cerevisiae genome deletion project (Giaever et al., 2002) had an S288c background. All strains used are listed in Table 1.
Table 1. List of yeast strains.
A list of yeast strains used in this study.
| STRAIN | GENOTYPE | SOURCE |
|---|---|---|
| T7107 | MATa: RAD5, BUD4, leu2, ura3, trp1, ade2, his3 | T. Tanaka lab |
| 45-1 | MATa: leu2-3, 112 ura3-52 ade2-1 lys2-801 cdc45-1 | C. Nieduszynski lab |
| CNY167 | MATa: ade2-1 his3-11,15 leu2-3,112 trp1-1 ura3-1 can1-100 Gal+ orc5-1 | C. Nieduszynski lab |
| AUY080 | MATa: ade2-1 trp1-1 can1-100 leu2-3,112 his3-11,15 ura3 GAL+ ssd1,d2 RAD5 orc2-1 | C. Nieduszynski lab |
| K2539 | MATα: cdc9-1 Backcrossed three times to K699/K700 | T. Tanaka lab |
| dbf4-1 | MATa: ade2-1 his3-11,15 leu2-3,112 trp1-1 ura3-1 can1-100 ssd1-d2 Gal+ dbf4-1 | Tanaka & Nasmyth, 1998 |
| YKB2 | MATa: leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3- 11,15, cdc7-4 | Mattarocci et al., 2014 |
| YYK32 | MATa: leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3- 11,15, cdc45-27, bar1Δ::hisG | Mattarocci et al., 2014 |
| YYK14 | MATa: leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3- 11,15, sld3-4, bar1Δ::hisG | Mattarocci et al., 2014 |
| YNIG63(2) | MATa: leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3- 11,15 , dpb11-24, bar1Δ::hisG | Mattarocci et al., 2014 |
| YCH175 | MATα: ho, ade2, trp1, can1, leu2, his3, GAL, psi + W303-1; cdc6-1 | Mattarocci et al., 2014 |
| YOR014W | rts1Δ::KanMX S288c | Giaever et al., 2002 |
| YBR275C | rif1Δ::KanMX S288c | Giaever et al., 2002 |
| YDR007W | trp1Δ::KanMX S288c | Giaever et al., 2002 |
| ACY001 | W303 MATα rts1Δ::kanMX | This Study |
| ACY004 | W303 MATa rts1Δ::kanMX | This Study |
| ACY007 | W303 MATα rif1Δ::kanMX | This Study |
| ACY010 | W303 MATa rif1Δ::kanMX | This Study |
| ACY013 | W303 MATα trp1Δ::kanMX | This Study |
| ACY016 | W303 MATa trp1Δ::kanMX | This Study |
| ACY036 | W303 Diploid orc2-1 rts1Δ::kanMX | This Study |
| ACY113 | W303 MATα orc2-1 rts1Δ::kanMX | This Study |
| ACY044 | W303 Diploid orc2-1 rif1Δ::kanMX | This Study |
| ACY100 | W303 MATα orc2-1 rif1Δ::kanMX | This Study |
| ACY079 | W303 Diploid cdc6-1 rts1Δ::kanMX | This Study |
| ACY112 | W303 MATa cdc6-1 rts1Δ::kanMX | This Study |
| ACY081 | W303 Diploid cdc6-1 rif1Δ::kanMX | This Study |
| ACY148 | W303 MATa cdc6-1 rif1Δ::kanMX | This Study |
| ACY035 | W303 Diploid cdc7-4 rts1Δ::kanMX | This Study |
| ACY096 | W303 MATa cdc7-4 rts1Δ::kanMX | This Study |
| ACY042 | W303 Diploid cdc7-4 rif1Δ::kanMX | This Study |
| ACY139 | W303 MATa cdc7-4 rif1Δ::kanMX | This Study |
| ACY071 | W303 Diploid dbf4-1 rts1Δ::kanMX | This Study |
| ACY106 | W303 MATα dbf4-1 rts1Δ::kanMX | This Study |
| ACY073 | W303 Diploid dbf4-1 rif1Δ::kanMX | This Study |
| ACY104 | W303 MATα dbf4-1 rif1Δ::kanMX | This Study |
| ACY031 | W303 Diploid cdc45-27 rts1Δ::kanMX | This Study |
| ACY093 | W303 MATα cdc45-27 rts1Δ::kanMX | This Study |
| ACY037 | W303 Diploid cdc45-27 rif1Δ::kanMX | This Study |
| ACY142 | W303 MATa cdc45-27 rif1Δ::kanMX | This Study |
| ACY019 | W303 Diploid cdc45-1 rts1Δ::kanMX | This Study |
| ACY087 | W303 MATa cdc45-1 rts1Δ::kanMX | This Study |
| ACY051 | W303 Diploid cdc45-1 rif1Δ::kanMX | This Study |
| ACY145 | W303 MATa cdc45-1 rif1Δ::kanMX | This Study |
| ACY025 | W303 Diploid cdc9-1 rts1Δ::kanMX | This Study |
| ACY067 | W303 MATα cdc9-1 rts1Δ::kanMX | This Study |
| ACY050 | W303 Diploid cdc9-1 rif1Δ::kanMX | This Study |
| ACY120 | W303 MATα cdc9-1 rif1Δ::kanMX | This Study |
| ACY069 | W303 Diploid dpb11-24 rts1Δ::kanMX | This Study |
| ACY087 | W303 MATa dpb11-24 rts1Δ::kanMX | This Study |
| ACY046 | W303 Diploid dpb11-24 rif1Δ::kanMX | This Study |
| ACY123 | W303 MATα dpb11-24 rif1Δ::kanMX | This Study |
In order to delete S. cerevisiae genes, the appropriate KanMX deletion cassettes from the SGDP were incorporated into a recipient strain by transformation. Deletion was confirmed by PCR spanning the deletion site. Oligonucleotide sequences are listed in Table 2. Ts-initiation factor mutant strains were confirmed by a lack of growth on solid YPAD plates at restrictive temperatures. Ts-initiation factor mutations with respective permissive and restrictive temperatures are listed in Table 3. Double mutant (ts-mutant / gene deletion) strains were confirmed by temperature-sensitivity and G418 resistance (400 µg/ml G418 disulfate salt; A1720-5G, Sigma-Aldrich, St Louis, MO, USA), relative to wild-type sister colonies.
Table 2. List of oligonucleotides.
A list of oligonucleotides used in this study.
| PRIMER 1 | PRIMER 2 | PRODUCT |
|---|---|---|
| AC0003 TTTTCAGTTCTTTGTGTTTTTCCTC | AC0004 TGATCCTTTAGAATGGAGAAGATTG | rif1Δ::kanMX |
| AC0005 TAAACCATCGTCGCCGTAA | AC0006 GGAAGAAGGAAAGCGAAAAGA | rts1Δ::kanMX |
| CA1118 CCATTACGCTCGTCATCAAA | AC0010 AAGAAACAAGAAGTCAACAGAAGG | Confirms 5’ insertion of rif1Δ::kanMX |
| CA1117 GATAATGTCGGGCAATCAGG | AC0009 GCGGTAGCATTTCCATCATAA | Confirms 3’ insertion of rif1Δ::kanMX |
| CA1118 CCATTACGCTCGTCATCAAA | AC0011 GGCATGTCAATACGTCTCGTT | Confirms 5’ insertion of rts1Δ::kanMX |
| CA1117 GATAATGTCGGGCAATCAGG | AC0012 GGCAAGGTTTACGGAAAAGA | Confirms 3’ insertion of rts1Δ::kanMX |
Table 3. Temperature-sensitive mutation strains used in this study.
Mutant forms of replication initiation factors, temperatures at which we observed phenotypes, and the study that originally reported each strain.
| TS-REPLICATION FACTOR MUTATION | TEMPERATURE AT WHICH PHENOTYPE OBSERVED | TEMPERATURE AT WHICH NO PHENOTYPE OBSERVED | REFERENCE |
|---|---|---|---|
| orc2-1 | 30 | 23 | Foss et al., 1993 |
| cdc6-1 | 33 | 30 | Hartwell et al., 1973 |
| cdc7-4 | 30 | 23 | Hartwell et al., 1973 |
| dbf4-1 | 32 | 30 | Johnston & Thomas, 1982 |
| cdc45-27 | 32 | 30 | Kamimura et al., 2001 |
| cdc45-1 | 23 | 30 | Moir et al., 1982 |
| cdc9-1 | 30 | 23 | Hartwell et al., 1973 |
| dpb11-24 | 37 | 32 | Tanaka et al., 2007 |
Dilution series assay
Strains were inoculated into YPAD liquid medium and cultured for 12–16 hours. Haploid cell concentration was inferred from attenuance measured at 600 nm (using a BioMate3 spectrophotometer; Thermofisher, Waltham, MA, USA). Cells were diluted initially to 107cells/ml, before serial 10-fold dilutions were prepared. Dilution spots of 5 µl were pipetted onto YPAD agar plates and incubated at stated temperatures. Control strains were included on each plate. After two days, plates were photographed and images were analysed qualitatively by observation of relative growth of yeast strains.
Results
RTS1 deletion does not synthetically rescue orc2-1
The combination of two mutations, which individually decrease cell fitness, can restore fitness if the genes have opposing effects (Synthetic Rescue, Figure 1). In the presence of a replication factor mutant, such as orc2-1, even at the permissive temperature origin firing can be reduced by as much as 30% (Shimada et al., 2002), leading to growth deficiency. We first examined RTS1 deletion in an orc2-1 strain (Figure 2A), since a synthetic rescue phenotype has been reported (Costanzo et al., 2010). A dilution series viability assay was used to assess synthetic rescue. We found that an orc2-1 rts1Δ strain had a more severe ts-phenotype that either the orc2-1 or rts1Δ strains (Figure 2A). This additive effect indicates that the two genes are not acting within the same pathway. Conversely, a small synthetic rescue was observed in the orc2-1 rif1Δ strain (Figure 2A). It has previously been shown that RIF1 deletion leads to slight synthetic rescue in orc5-1 strains, consistent with this result (Mattarocci et al., 2014).
Enlarge this image.Figure 1. A summary of genetic interactions. Two genes, A and B, show genetic interactions as a result of the interacting functions of their products: A and B. When A and B function in different cellular processes, the relative fitness of an A-B- double mutant is a product of the relative fitness of the two single mutants (no genetic interaction). If the double mutant strain has a lower than expected viability, it is described as synthetic lethality, indicating redundant functions for the two gene products in one cellular process. In contrast, a greater than expected viability (synthetic rescue) indicates that the gene products have opposing roles in a cellular process.
Enlarge this image.Figure 2. RTS1 deletion does not suppress temperature-sensitivity of DNA replication origin licensing factor mutants. Budding yeast strains with ts-mutants of replication factors, together with either wild type, rts1Δ or rif1Δ were characterised by dilution viability assays. Wild type strains, without ts-replication factors, are shown at the top of each panel, as a control. (A) ORC subunit (orc2-1) is assayed. (B) A second pre-RC component, cdc6-1 is assayed.
The origin licensing factor Cdc6 is not opposed by RTS1
Since Rif1 recruits PP1 to oppose DDK phosphorylation, RIF1 deletion provides limited or no rescue to the temperature sensitivity of pre-Replication Complex (pre-RC) factors mutants, which function prior to DDK (Mattarocci et al., 2014). Given that this study aimed to investigate a role for Rts1 in opposing the action of Orc2, we next looked for a genetic interaction between RTS1 and another origin licensing factor: CDC6, which loads MCM. Deleting RTS1 in the context of cdc6-1 showed no rescue relative to the original ts-strain (Figure 2B). Similarly, deletion of RIF1 gave no synthetic rescue, consistent with published data (Mattarocci et al., 2014). It has previously been shown that rts1Δ yeast strains are ts at 37°C (Auesukaree et al., 2009; Shu & Hallberg, 1995), while rif1Δ strains are not (Mattarocci et al., 2014). Our study confirmed both these phenotypes (Figure 2B).
Rts1 does not antagonise DDK phosphorylation
A potential role for Rts1-PP2A phosphatase in DNA replication initiation could be to oppose the action of a kinase. The established role for Rif1-PP1 in opposing DDK activity indicates that regulation of phosphorylation is key during this step of replication initiation. Therefore, RTS1 was deleted in combination with ts-forms of both subunits of DDK (Cdc7 and Dbf4). However, rts1Δ had a slightly additive effect on temperature-sensitivity in both cdc7-4 (Figure 3A) and dbf4-1 (Figure 3B) strains. This was in stark contrast to the strong restoration of cell growth at elevated temperatures in cdc7-4 rif1Δ (Figure 3A) and dbf4-1 rif1Δ (Figure 3B) strains. This suggests that Rif1 and Rts1 do not have analogous roles in control of DNA replication initiation, and that Rts1-PP2A does not antagonise DDK activity.
Enlarge this image.Figure 3. Unlike rif1Δ, rts1Δ cannot synthetically rescue ts-forms of DDK subunits. Budding yeast strains with ts-mutants of replication factors, together with either wild type, rts1Δ or rif1Δ were characterised by dilution viability assays. Wild type strains, without ts-replication factors, are shown at the top of each panel, as a control. Ts-forms of DDK subunits, Cdc7 (A) and Dbf4 (B) are assayed.
Replication firing factors are not opposed by Rts1
MCM phosphorylation by DDK recruits the firing factor, Cdc45. The sequential recruitment of further firing factors (e.g. Dpb11) relies on phosphorylation by CDK. Therefore, Rts1-PP2A activity could be important following DDK activity, to limit CDK-induced origin firing. In order to test this hypothesis, RTS1 was deleted in the context of ts- cdc45-1 and dpb11-24 firing factors. Unlike rif1Δ, rts1Δ did not rescue cdc45-27 or dpb11-24 temperature-sensitivity (Figure 4AI, 4B). Conversely, rts1Δ led to an increased lethality in these strains, suggesting either an additive or synthetic lethality effect (Figure 1).
Enlarge this image.Figure 4. RTS1 causes synthetic lethality with DNA replication firing factors and a DNA replication progression factor. Budding yeast strains with ts-mutants of replication factors, together with either wild type, rts1Δ or rif1Δ were characterised by dilution viability assays. Wild type strains, without ts-replication factors, are shown at the top of each panel, as a control. (A) Ts- (I) and cold- sensitive (II) forms of Cdc45, (B) the replication firing factor Dbp11, which functions post-DDK, and (C) Cdc9 ligase, are assayed.
However, the cold-sensitive cdc45-1 strain (restricted at 15°C) had no phenotypic rescue by either rif1Δ or rts1Δ (Figure 4AII). Instead, an additive effect was observed for both gene deletions, which was stronger in the case of RTS1. This additive effect of rif1Δ in cold-sensitive cdc45-1 contradicts the known rescue of ts-cdc45-27 by rif1Δ (Mattarocci et al., 2014), a finding repeated in this study. Therefore, the significance of an additive effect of rts1Δ with cdc45-1 is unclear.
Synthetic lethality of RTS1 and CDC9 ligase
Since the detrimental effect of RTS1 deletion alongside ts-DNA replication initiation factors appeared to be most severe in factors which function later in the firing process, we hypothesised that Rts1 could play a role in DNA replication post-firing. Therefore, RTS1 was deleted alongside a ts-CDC9 ligase allele (cdc9-1). Cdc9 ligates lagging strand Okazaki fragments, aiding in DNA replication during elongation. RTS1 deletion in a cdc9-1 strain led to the greatest synthetic lethality, relative to RTS1 deletion in the other ts-strains examined. No effect of rif1Δ was seen in cdc9-1 cells. This was anticipated, since Rif1 is known to function during replication initiation. These data show that, if Rts1 plays a role in DNA replication, it is not akin to that played by Rif1, and does not appear to oppose critical events leading to origin licensing or origin firing.
Discussion
In this study, RTS1, which encodes a regulatory subunit for the PP2A phosphatase, was deleted in the context of a range of ts-replication factor mutants. At no stage of DNA replication initiation (licensing, DDK-phosphorylation, and origin firing) did deletion of RTS1 lead to synthetic rescue of ts-phenotypes. In contrast, deletion of RIF1 was able to rescue ts-mutants of replication firing factors, and some replication licensing factors. Rif1 recruits PP1 phosphatase to DNA replication origins where it counteracts MCM phosphorylation by DDK. When replication origin firing is limited by mutant replication factors, removing this negative regulation allows more replication origins to fire, giving synthetic rescue. In contrast, rts1Δ leads to increased temperature-sensitivity when combined with orc2-1, cdc7-4, cdc45-1 and dpb11-24 mutant replication factors. The lack of synthetic rescue given by rts1Δ in these strains indicates that there is no evidence for a role for Rts1 in limiting origin firing, analogous to that played by Rif1.
Without a genetic interaction, combining mutations in genes involved in separate pathways will give an additive effect. However, alone, rts1Δ has no growth inhibition at temperatures below 34°C. Therefore, the extent of reduced cell viability seen in some double mutant strains, such as dpb11-24 rts1Δ at 32°C (Figure 4), suggests synthetic lethality. This may be the result of non-specific protein instability after heat stress, in rts1Δ strains. Over-expression of RTS1 can partially rescue lethality of a ts-HPS60 allele (Shu & Hallberg, 1995). Hps60 is a mitochondrial protein that aids in protein refolding after heat stress (Shu & Hallberg, 1995). A reduced capability to maintain protein structure in heat stress conditions could explain the increased temperature sensitivity of unstable replication factor forms in rts1Δ cells. This could be analogous to the partial rescue of the ts-phenotype of orc2-1 by mutations in the ubiquitin ligase UBA1 (Shimada et al., 2002). Therefore, investigation of heat stress in rts1Δ strains would be needed to elucidate the molecular mechanism.
The extent of the additional lethality given by rts1Δ alongside mutant ts-replication factors is inconsistent. If added lethality of rts1Δ depends on the function of the ts-factor, this could indicate a functional genetic interaction between that replication factor and RTS1. In DDK and pre-RC factor mutants (cdc7-4, dbf4-1, cdc6-1) there is either mildly increased temperature-sensitivity or no effect given by rts1Δ (Figure 2B, Figure 3). However, in post-DDK acting firing factors cdc45-1 and dpb11-24, the observed increase in the ts-phenotype is larger (Figure 4). We cannot exclude the possibility that this effect is due to greater heat-instability of the cdc45-1 and dpb11-24 mutant replication factors. However, these data may suggest a role for Rts1 late in DNA replication initiation, demonstrating a genuine negative genetic interaction between RTS1 and post-DDK replication firing factors.
Interestingly, the greatest synthetic lethality is seen between RTS1 and a replication elongation factor: CDC9. Cdc9 is important for DNA replication progression and elongation rather than initiation. Accordingly, we find no synthetic rescue by rif1Δ in the cdc9-1 strain (Figure 4). The observed synthetic lethality of RTS1 deletion in a cdc9-1 strain may provide evidence for a complementary role for Rts1 function in allowing replication fork progression. In cdc9-1 strains, increased DNA damage is seen due to the collapse of replication forks. This results in double strand breaks (DSBs), and the DNA damage response (DDR) being activated. One of the ways to repair DSBs is via break-induced replication (BIR), which is activated in cdc9-1 cells (Vasianovich et al., 2014). A role for Rts1 in recruiting PP2A phosphatase to control phosphorylation steps in the DDR, potentially in BIR, could be hypothesised. In this instance, rts1Δ in a cdc9-1 background would give increased lethality, since there would also be an impaired capacity for cells to repair cdc9-1 dependent DSBs.
Evidence in support of the synthetic lethality of RTS1 and DNA replication factors can be found on BioGRID, a summary of published genetic interactions in budding yeast. A combination of high and low throughput genetic interaction screens show that RTS1 exhibits negative genetic interactions (a term reserved for genetic screens which show a more lethal phenotype in strains where two mutations are combined than in the respective single mutant strains) with DBF4, CDC6 and ORC6 and DPB11 (Archambault et al., 2005; Collins et al., 2007; Costanzo et al., 2016). However, we show here, for the first time, negative genetic interactions of RTS1 with CDC45 and CDC9.
Conclusions
Given the wealth of recent literature outlining the importance of Rif1 in opposing the actions of DDK kinase, it is clear that phosphatases play an important role in controlling DNA replication origin firing. However, we do not find evidence for an analogous role for PP2A, specifically via its regulatory subunit Rts1. Deletion of RTS1 in combination with mutations in origin licensing factor genes, ORC and CDC6, showed little or no genetic interaction, providing no genetic evidence for Rts1-PP2A controlling DNA replication origin licensing. Further, we found no role for Rts1 in opposing DDK phosphorylation. However, we observed some level of increased temperature-sensitivity phenotype when RTS1 was deleted in many of the replication initiation factor mutant strains, alluding to a potential synthetic lethality phenotype. Increased temperature-sensitivity was most pronounced in late-acting DNA replication firing factors Cdc45 and Dpb11. Additionally, an increased requirement for RTS1 in a cdc9-1 background was found. We speculate that a functional overlap between Rts1-PP2A and Cdc9 may exist via replication fork progression mechanisms. Rts1 may recruit PP2A during BIR, or the DDR, in response to DSBs. Over-expression of RTS1 could potentially compensate for the increased replication fork collapse seen in cdc9-1 mutants, giving synthetic rescue of temperature-sensitivity. Further studies would be needed to confirm this hypothesis.
Data availability
All data underlying the results are available as part of the article and no additional source data are required.
Competing interests
No competing interests were disclosed.
Grant information
Wellcome Trust [110064] grant to CN.
Biotechnology and Biological Sciences Research Council [BB/M011224/1] grant funded AW.
The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Acknowledgements
We are grateful to Tomoyuki Tanaka and David Shore for sending us yeast strains, detailed in Table 1. We are also grateful to Carolin A. Müller, Dzmitry G. Batrakou, Rosemary H.C. Wilson and Emma D. Heron who gave feedback on the manuscript.
Archambault V, Ikui AE, Drapkin BJ, et al.: Disruption of mechanisms that prevent rereplication triggers a DNA damage response. Mol Cell Biol. 2005; 25(15): 6707–6721.
Auesukaree C, Damnernsawad A, Kruatrachue M, et al.: Genome-wide identification of genes involved in tolerance to various environmental stresses in Saccharomyces cerevisiae. J Appl Genet. 2009; 50(3): 301–310.
Blow JJ, Dutta A: Preventing re-replication of chromosomal DNA. Nat Rev Mol Cell Biol. 2005; 6(6): 476–486.
Chou DM, Petersen P, Walter JC, et al.: Protein phosphatase 2A regulates binding of Cdc45 to the prereplication complex. J Biol Chem. 2002; 277(43): 40520–40527.
Chowdhury A, Liu G, Kemp M, et al.: The DNA unwinding element binding protein DUE-B interacts with Cdc45 in preinitiation complex formation. Mol Cell Biol. 2010; 30(6): 1495–1507.
Collins SR, Miller KM, Maas NL, et al.: Functional dissection of protein complexes involved in yeast chromosome biology using a genetic interaction map. Nature. 2007; 446(7137): 806–10.
Costanzo M, Baryshnikova A, Bellay J, et al.: The genetic landscape of a cell. Science. 2010; 327(5964): 425–31.
Costanzo M, VanderSluis B, Koch EN, et al.: A global genetic interaction network maps a wiring diagram of cellular function. Science. 2016; 353(6306): pii: aaf1420.
Davé A, Cooley C, Garg M, et al.: Protein Phosphatase 1 recruitment by Rif1 regulates DNA replication origin firing by counteracting DDK activity. Cell Rep. 2014; 7(1): 53–61.
Foss M, McNally FJ, Laurenson P, et al.: Origin recognition complex (ORC) in transcriptional silencing and DNA replication in S. cerevisiae. Science. 1993; 262(5141): 1838–44.
Foti R, Gnan S, Cornacchia D, et al.: Nuclear Architecture Organized by Rif1 Underpins the Replication-Timing Program. Mol Cell. 2016; 61(2): 260–273.
Giaever G, Chu AM, Ni L, et al.: Functional profiling of the Saccharomyces cerevisiae genome. Nature. 2002; 418(6896): 387–391.
Green BM, Finn KJ, Li JJ: Loss of DNA replication control is a potent inducer of gene amplification. Science. 2010; 329(5994): 943–6.
Guo C, Kumagai A, Schlacher K, et al.: Interaction of Chk1 with Treslin negatively regulates the initiation of chromosomal DNA replication. Mol Cell. 2015; 57(3): 492–505.
Hartwell LH, Mortimer RK, Culotti J, et al.: Genetic Control of the Cell Division Cycle in Yeast: V. Genetic Analysis of cdc Mutants. Genetics. 1973; 74(2): 267–286.
Hiraga S, Alvino GM, Chang F, et al.: Rif1 controls DNA replication by directing Protein Phosphatase 1 to reverse Cdc7-mediated phosphorylation of the MCM complex. Genes Dev. 2014; 28(4): 372–383.
Hiraga S, Ly T, Garzón J, et al.: Human RIF1 and protein phosphatase 1 stimulate DNA replication origin licensing but suppress origin activation. EMBO Rep. 2017; 18(3): 403–419.
Johnston LH, Thomas AP: The isolation of new DNA synthesis mutants in the yeast Saccharomyces cerevisiae. Mol Gen Genet. 1982; 186(3): 439–444.
Kamimura Y, Tak YS, Sugino A, et al.: Sld3, which interacts with Cdc45 (Sld4), functions for chromosomal DNA replication in Saccharomyces cerevisiae. EMBO J. 2001; 20(8): 2097–2107.
Lian HY, Robertson ED, Hiraga S, et al.: The effect of Ku on telomere replication time is mediated by telomere length but is independent of histone tail acetylation. Mol Biol Cell. 2011; 22(10): 1753–1765.
Mattarocci S, Shyian M, Lemmens L, et al.: Rif1 controls DNA replication timing in yeast through the PP1 Phosphatase Glc7. Cell Rep. 2014; 7(1): 62–69.
Mccarroll RM, Fangman WL: Time of replication of yeast centromeres and telomeres. Cell. 1988; 54(4): 505–513.
Moir D, Stewart SE, Osmond BC, et al.: Cold-sensitive cell-division-cycle mutants of yeast: isolation, properties, and pseudoreversion studies. Genetics. 1982; 100(4): 547–563.
Orr SJ, Gaymes T, Ladon D, et al.: Reducing MCM levels in human primary T cells during the G0-->G1 transition causes genomic instability during the first cell cycle. Oncogene. 2010; 29(26): 3803–14.
Passerini V, Ozeri-Galai E, de Pagter MS, et al.: The presence of extra chromosomes leads to genomic instability. Nat Commun. 2016; 7: 10754.
Peplowska K, Wallek AU, Storchova Z: Sgo1 regulates both condensin and Ipl1/Aurora B to promote chromosome biorientation. PLoS Genet. 2014; 10(6): e1004411.
Petersen P, Chou DM, You Z, et al.: Protein phosphatase 2A antagonizes ATM and ATR in a Cdk2- and Cdc7-independent DNA damage checkpoint. Mol Cell Biol. 2006; 26(5): 1997–2011.
Poh WT, Chadha GS, Gillespie PJ, et al.: Xenopus Cdc7 executes its essential function early in S phase and is counteracted by checkpoint-regulated protein phosphatase 1. Open Biol. 2014; 4(1): 130138.
Shimada K, Pasero P, Gasser SM: ORC and the intra-S-phase checkpoint: A threshold regulates Rad53p activation in S phase. Genes Dev. 2002; 16(24): 3236–3252.
Shu Y, Hallberg RL: SCS1, a multicopy suppressor of hsp60-ts mutant alleles, does not encode a mitochondrially targeted protein. Mol Cell Biol. 1995; 15(10): 5618–5626.
Stark M, Hiraga S, Donaldson A: Protein phosphatases and DNA replication initiation. In Kaplan D, ed. Initiation of DNA Replication in Eukaryotes. USA: Springer, 2015; 461–477.
Tanaka S, Umemori T, Hirai K, et al.: CDK-dependent phosphorylation of Sld2 and Sld3 initiates DNA replication in budding yeast. Nature. 2007; 445(7125): 328–332.
Tanaka T, Nasmyth K: Association of RPA with chromosomal replication origins requires an Mcm protein, and is regulated by Rad53, and cyclin- and Dbf4-dependent kinases. EMBO J. 1998; 17(17): 5182–5191.
Treco DA, Winston F: Growth and manipulation of yeast. Curr Protoc Mol Biol. 2008; Chapter 13(SUPPL. 82): Unit13.2.
Vasianovich Y, Harrington LA, Makovets S: Break-induced replication requires DNA damage-induced phosphorylation of Pif1 and leads to telomere lengthening. PLoS Genet. 2014; 10(10): e1004679.
Yamazaki S, Ishii A, Kanoh Y, et al.: Rif1 regulates the replication timing domains on the human genome. EMBO J. 2012; 31(18): 3667–77.
Yan Z, Fedorov SA, Mumby MC, et al.: PR48, a novel regulatory subunit of protein phosphatase 2A, interacts with Cdc6 and modulates DNA replication in human cells. Mol Cell Biol. 2000; 20(3): 1021–1029.
Yeeles JT, Deegan TD, Janska A, et al.: Regulated eukaryotic DNA replication origin firing with purified proteins. Nature. 2015; 519(7544): 431–435.
Zegerman P: Evolutionary conservation of the CDK targets in eukaryotic DNA replication initiation. Chromosoma. 2015; 124(3): 309–321.
Ana B.A. Wallis, Conrad A. Nieduszynski
Sir William Dunn School of Pathology, University of Oxford, Oxford, Oxfordshire, OX1 3RE, UK
Ana B.A. Wallis
Roles: Conceptualization, Investigation, Project Administration, Visualization, Writing – Original Draft Preparation
Conrad A. Nieduszynski
Roles: Conceptualization, Funding Acquisition, Project Administration, Supervision, Writing – Review & Editing
© 2018. This work is published under http://creativecommons.org/licenses/by/4.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.