The predominantly Mediterranean genus Odontites Ludw. (Orobanchaceae; Bennett and Mathews, 2006) comprises ca. 26 species of annual and perennial root hemiparasites (Bolliger, 1996) growing in grasslands, shrublands, and wood edges. It includes weeds (Parker, 2013), as well as species listed on national and regional catalogs of endangered plants (e.g., López Udías and Fábregat Llueca, 2010), registered on the International Union for the Conservation of Nature Red List (
The O. vernus (Bellardi) Dumort. group, which includes three species, is the most widespread of the genus, occupying the temperate regions of Eurasia with one population in northern Morocco (Bolliger, 1996). However, phylogenetic relationships and evolutionary patterns within the group remain largely unclear due to a complex interplay between the diploid‐tetraploid cytotypic variation and seasonal ecotypes differing in morphology (Koutecký et al., 2012). Odontites vernus sensu lato (s.l.; Rico, 2009) includes diploid and tetraploid individuals. The latter are probably of autopolyploid origin, as no distinct subgenomes were found in the karyotype (Delgado et al., 2015) and morphology is not intermediate between any two known diploid species. However, the hypothesis of an autopolyploid origin has not been addressed using genetic markers. Furthermore, it is not clear whether some levels of gene flow are maintained in locations where diploids and tetraploids co‐occur (Snogerup, 1983; Koutecký et al., 2012). Although it is known that O. vernus can self‐pollinate (Nilsson and Alves‐dos‐Santos, 2009), inbreeding rates in populations remain unknown. Therefore, genetic markers are needed to study gene flow patterns and how populations of O. vernus are connected. Furthermore, the transferability of the loci to other species of the genus would bring new information for taxonomic revision of Odontites species and conservation of endemic and/or threatened taxa.
METHODS AND RESULTS
Microsatellite development
Silica gel–dried leaves of two diploid individuals of O. vernus (see Appendix 1 for voucher information) were selected for genomic DNA extraction using Invisorb Spin Plant Mini Kit (Invitek, Berlin, Germany). Ploidy level was checked with a CyFlow flow cytometer (Partec GmbH, Münster, Germany), using ‘Woody Plant Buffer’ (WPB; Loureiro et al., 2007) and Solanum pseudocapsicum L. as the internal standard (Temsch et al., 2010). DNA extraction was enriched with AC, AG, TGT, and CCT motifs following Nunome et al. (2006). The resulting microsatellite library was sequenced using a 454 GS Junior Sequencer (454 Life Sciences, a Roche Company, Branford, Connecticut, USA). Analyses with QDD software (Meglécz et al., 2010) revealed 4335 sequence reads with microsatellite motifs (from a total of 16,050), and primer pairs were designed for 169 regions. A set of 36 primer pairs with low penalty, different lengths, and containing different repeat motifs was tested. Amplification was evaluated in four diploid and three tetraploid individuals of O. vernus. PCRs were performed in 12.5‐μL reactions, which contained 45.5 ng of DNA, 1× PCR buffer (Biotools, Madrid, Spain), 1.5 mM MgCl2 (Biotools), 0.2 mM of each dNTP (Life Technologies, Carlsbad, California, USA), 0.33 mM of each primer (Eurofins, Ebersberg, Germany), and 0.5 unit of DNA Polymerase (Biotools), using the following conditions: an initial step at 94°C for 2 min; followed by 35 cycles of 1 min at 94°C, 1 min at primer‐specific annealing temperature, and 50 s at 72°C; and a final extension of 15 min at 72°C. PCR products were visualized on a 2.5% agarose gel.
PCR products were sequenced by Macrogen Europe (Amsterdam, The Netherlands), and the obtained sequences were checked for homology to the expected region. Consistent amplification and levels of polymorphisms were analyzed in gel images. Eighteen loci were selected (see Appendix 2 for discarding reasons) and tested on 140 O. vernus samples using a three‐primer PCR protocol (Schuelke, 2000) with the universal primer M13(–21) 5′‐TGTAAAACGACGGCCAGT‐3′ marked with 5‐FAM, VIC, NED, or PET fluorescent dyes (Life Technologies; Table 1). The PCR mix was as described above, except that 0.2 mM of each reverse and fluorescent‐labeled M13 primer and 0.08 mM of the forward primer were used. Cycling conditions were also as described above, adding 10 cycles of 1 min at 94°C, 1 min at 53°C, and 50 s at 72°C before the final extension. Pooled PCR products were run on an ABI 3730 Capillary Sequencer (Life Technologies) using GeneScan 500 LIZ Size Standard (Life Technologies). Electropherograms were analyzed with GeneMarker AFLP/Genotyping Software version 1.8 (SoftGenetics, State College, Pennsylvania, USA). Three loci were discarded due to genotyping difficulties, and an additional one was monomorphic. Because lengths of some alleles differed from expected sizes, alleles found in homozygous individuals were sequenced to verify indel presence and/or imperfect microsatellite motifs. Indel presence was confirmed in all but three loci (Ov‐19, Ov‐21, and Ov‐35), and imperfect microsatellite motifs were confirmed in two loci (Ov‐5 and Ov‐25). Additionally, denaturation temperature (Td) was reduced to 83°C to test if lower Td improved genotyping (Olejniczak and Krzyzosiak, 2006). Of the remaining 14 loci, Td = 83 produced better results for two loci, in two cases there were no differences, and in 10 loci there was reduced scorability, contrary to expectations.
Characteristics of 14 polymorphic microsatellite loci developed in Odontites vernus.
| Locus | Primer sequences (5′–3′) | Fluorescent label | Repeat motif | Allele size range (bp)a | A | Indel detected | Ta (°C) | Td (°C) | GenBank accession no.b |
| Ov‐2 | F: CCCAAGTTTGTTAATTGGATCG | VIC | (AATT)9 | 171–213 | 11 | Y | 54 | 94 | KT777566–KT777574 |
| R: GAACTGCAGCTGGAACCTCTA | |||||||||
| Ov‐5 | F: ATTAGGTACAACCACACGAGGG | VIC | (TA)4‐(CA)8 | 178–190 | 6 | N | 55 | 94 | KT777577–KT777579 |
| R: ATACTCGGCATCTTGCAATTCT | |||||||||
| Ov‐6 | F: CACTCTCCCACGTTTCTTGATT | NED | (AGC)6 | 92–116 | 13 | Y | 54 | 94 | KT777580–KT777583 |
| R: TCAGAAATGGGGTATGAGAAAA | |||||||||
| Ov‐10 | F: TGAATAATGTTTTCAGTCCATAC | PET | (AGT)6 | 213–217 | 4 | Y | 55 | 94 | KT777587–KT777590 |
| R: CACACTCTTGTAGCTATGTGCC | |||||||||
| Ov‐15 | F: CTAGGGTTTGGGAATGTGGTT | NED | (ACT)5 | 93–108 | 11 | Y | 54 | * | KT777593–KT777596 |
| R: CCTAGCTACCCAGATACCATCC | |||||||||
| Ov‐17 | F: TATCGATCCACTCGTGAAACAC | PET | (AAAAC)5 | 309–327 | 4 | Y | 55 | 94 | KT777597–KT777599 |
| R: TTCAGATCACGGTACACGATTC | |||||||||
| Ov‐19 | F: GAGGAGGATTGAGGATTGCATA | 5‐FAM | (AGGG)5 | 85–94 | 7 | — | 55 | 94 | KT777600 |
| R: CCCACCATTTCATTTACTCTCC | |||||||||
| Ov‐20 | F: GAGGAGACCCAATAACAAAATTA | PET | (AGTT)3 | 98–122 | 5 | Y | 55 | 83 | KT777601–KT777603 |
| R: AATTTAAGCACCATGTTGAA | |||||||||
| Ov‐21 | F: GATCCATTAGCAATGGGACTTT | NED | (AG)11 | 238–274 | 13 | N | 55 | 94 | KT777604–KT777613 |
| R: TCCAGGTCAAACAGTGAACAAC | |||||||||
| Ov‐25 | F: CTGCCATAGATAACATGCCAAA | 5‐FAM | (TA)3‐(CA)9 | 185–196 | 8 | Y | 55 | 94 | KT777617–KT777620 |
| R: CCCCATGCCGAGAAAG | |||||||||
| Ov‐28 | F: ACAAGATTCTTCCCTCCCTGTC | 5‐FAM | (AC)6 | 227–258 | 8 | Y | 55 | * | KT777622–KT777626 |
| R: ATCCATGTGAGCAATGATGAAA | |||||||||
| Ov‐30 | F: TTCGGATATCGAATAAAATGGG | NED | (AC)5 | 249–257 | 6 | Y | 55 | 94 | KT777627–KT777629 |
| R: TCGCAATGTTTCCTGTTGTTAC | |||||||||
| Ov‐33 | F: CCTTGAACATACAGAAACTACAACAA | VIC | (AC)5 | 367–387 | 3 | Y | 55 | 94 | KT777631–KT777633 |
| R: TGATTACTATGCAACCACTGCC | |||||||||
| Ov‐35 | F: TCAAATTCATTAGAACTGCGTCA | PET | (ACC)5 | 310–313 | 2 | N | 55 | 83 | KT777634–KT777635 |
| R: CTATTTGACCATGAGCTCCACC |
Note: A = number of alleles; Ta = optimal annealing temperature; Td = optimal denaturation temperature.
Range of fragment sizes included the M13(–21) tail attached to the forward primer. Sizes were taken from GeneMarker allele calls.
More than one accession per locus (except for Ov‐19) in order to check imperfect microsatellite motifs and/or indel presence.
*No differences in genotyping between both Td tested.
Population genetic parameters in two populations of Odontites vernus
Two populations were selected to obtain population genetic parameters that could be illustrative of performance in two different situations. In one population (Tejada), all sampled individuals were diploids, but in the other one (San Miguel del Arroyo [SMA]) 32 were diploids and 36 were tetraploids. The number of alleles per locus, observed and expected heterozygosity, significance of deviation from Hardy–Weinberg equilibrium (HWE; Table 2), and test for linkage disequilibrium between markers were estimated using Arlequin version 3.5.1.2 (Excoffier and Lischer, 2010). To perform those analyses, allele sizes were not transformed into number of repeats, and exact allele dosage was not estimated in tetraploids. In SMA, these parameters were calculated only for diploids. The number of alleles per locus ranged from two to 13 in the complete data set (Table 1), but varied from one to five in the two selected populations (Table 2). Four loci were monomorphic in both populations, and four to six were polymorphic in the studied populations. Significant deviation from HWE (P < 0.05) was found in all loci probably due to inbreeding, as recorded in the closely related genus Euphrasia L. (French et al., 2003). Linkage disequilibrium was significant after Bonferroni correction in all pairwise comparisons, except those involving allele Ov‐19 and the pair Ov‐10/Ov‐15. Regarding alleles related to ploidy levels, almost all alleles in every locus are shared between ploidy levels overall. But in the SMA samples, there are six loci (Ov‐5, Ov‐19, Ov‐21, Ov‐28, Ov‐30, Ov‐33) that differentiate ploidies unequivocally.
Results of initial screening of within‐population variation in two populations of Odontites vernus.
| Tejada (n = 30) | SMA diploids (n = 32) | SMA tetraploids (n = 36) | |||||||||
| Locus | A | Ho | He | HWEa | A | Ho | He | HWEa | A | Aper ind. | Hob |
| Ov‐2 | 2 | 0.16667 | 0.34520 | 0.01190* | 3 | 0.06250 | 0.63641 | 0.00000*** | 1 | — | — |
| Ov‐5 | 1 | — | — | — | 1 | — | — | — | 2 | 2 | 1.00 |
| Ov‐6 | 1 | — | — | — | 1 | — | — | — | 3 | 3 | 1.00 |
| Ov‐10 | 1 | — | — | — | 2 | 0.15625 | 0.48363 | 0.00013*** | 1 | — | — |
| Ov‐15 | 4 | 0.10000 | 0.29774 | 0.00000*** | 2 | 0.18750 | 0.49008 | 0.00080*** | 3 | 3 | 1.00 |
| Ov‐19 | 2 | 0.00000 | 0.12655 | 0.00090*** | 1 | — | — | — | 2 | 2 | 1.00 |
| Ov‐20 | 1 | — | — | — | 2 | 0.18750 | 0.50000 | 0.00068*** | 1 | — | — |
| Ov‐21 | 2 | 0.10000 | 0.46271 | 0.00003*** | 5 | 0.21875 | 0.65278 | 0.00000*** | 1 | — | — |
| Ov‐28 | 1 | — | — | — | 1 | — | — | — | 3 | 3 | 1.00 |
| Ov‐33 | 1 | — | — | — | 1 | — | — | — | 2 | 2 | 1.00 |
Note: — = monomorphic loci; A = number of alleles; Aper ind. = maximum number of alleles in a single individual; He = expected heterozygosity; Ho = observed heterozygosity; HWE = Hardy–Weinberg equilibrium probabilities; n = number of individuals sampled.
Deviations from HWE were statistically significant at *P < 0.05 and ***P < 0.001. Note that there were no deviations at P < 0.01.
As it is not possible to calculate Ho accurately for tetraploids, the proportion of individuals with more than one allele is shown.
Cross‐amplification in other Odontites species and related genera
The 18 selected loci were tested in 19 Odontites taxa and 11 other taxa from eight related genera using the PCR conditions described above. Fragment separation results (Table 3) were promising in closely related species (O. corsicus (Loisel.) G. Don, O. hollianus (Lowe) Benth., O. luteus (L.) Clairv., O. kaliformis (Pourr. ex Willd.) Pau, and O. recordonii Burnat & Barbey) because they amplify in 13 to 17 loci, and sometimes showed more than one allele, despite a small sample size (n = 4). Furthermore, good results were obtained for several other taxa–locus combinations. Development of species‐specific PCR protocols could improve these results, especially in some other Odontites species (i.e., O. bolligeri E. Rico, L. Delgado & Herrero, O. pyrenaeus (Bubani) Rothm., and O. cebennensis H. J. Coste & Soulié).
Results of cross‐amplification within the genus Odontites and related genera.a
| Speciesb | n | Ov‐2 | Ov‐3c | Ov‐5 | Ov‐6 | Ov‐10 | Ov‐12c | Ov‐15 | Ov‐17 | Ov‐19 | Ov‐20 | Ov‐21 | Ov‐25 | Ov‐26c | Ov‐28 | Ov‐30 | Ov‐32c | Ov‐33 | Ov‐35 |
| B. inaequalis Benth. | 1 | 0/0/1 (1) | 0/0/1 (1) | 0/0/1 (1) | 0/0/1 (1) | ||||||||||||||
| Ba. rameauana (Emb.) Bolliger | 4 | 2/1/1 (2) | 3/0/1 (1) | 1/0/3 (4) | 0/0/4 (2) | 0/0/4 (1) | 0/0/4 (3) | 1/3/0 (2)* | |||||||||||
| Be. trixago (L.) All. | 2 | 0/0/2 (1) | 0/0/2 (1) | 0/0/2 (2) | |||||||||||||||
| Eu. antarctica Benth. | 1 | 0/0/1 (1) | 0/1/0 (1) | ||||||||||||||||
| Eu. hirtella Jord. ex Reut. | 1 | 0/0/1 (1) | 0/0/1 (1) | 0/0/1 (1) | 0/1/0 (1) | ||||||||||||||
| Ma. longiflorum (Lam.) Rothm. | 4 | 3/0/1 (1) | 3/0/1 (1) | 0/0/4 (1) | 3/0/1 (2) | 0/2/2 (1) | 0/0/4 (2) | 0/1/3 (1)* | 3/0/1 (1) | 3/0/1 (1)* | |||||||||
| No. asperrima (Link) Benedí & Herrero | 4 | 0/0/4 (1) | 1/0/3 (1) | 0/0/4 (1) | 0/0/4 (1) | 2/2/0 (2) | |||||||||||||
| No. spicata (Ramond) Bolliger & Molau | 4 | 3/0/1 (1) | 3/1/0 (1) | 0/0/4 (1) | 0/0/4 (1) | 0/0/4 (1) | 1/2/1 (1) | ||||||||||||
| Od. virgata (Link) Rothm. | 4 | 2/0/2 (2) | 3/0/1 (1) | 0/0/4 (1) | 0/0/4 (2) | 3/0/1 (1) | |||||||||||||
| O. bocconii (Guss.) Walp. | 4 | 2/0/2 (1) | 3/0/1 (1) | 0/0/4 (3)* | 0/0/4 (2) | 0/0/4 (1) | 2/2/0 (1) | 0/0/4 (3) | 1/2/1 (1)* | ||||||||||
| O. bolligeri E. Rico, L. Delgado & Herrero | 4 | 3/0/1 (1) | 2/0/2 (1) | 1/0/3 (1) | 0/0/4 (1) | 0/0/4 (2) | 0/0/4 (1) | 0/2/2 (4) | 2/2/0 (1) | 3/1/0 (1) | 0/0/4 (1)* | ||||||||
| O. cebennensis H. J. Coste & Soulié | 4 | 3/0/1 (1) | 3/1/0 (1) | 0/0/4 (1) | 0/0/4 (3) | 1/1/2 (1) | 0/0/4 (2) | 0/0/4 (1) | 0/0/4 (2) | 0/3/1 (3) | 0/0/4 (1) | ||||||||
| O. corsicus (Loisel.) G. Don | 4 | 0/0/4 (1) | 0/0/4 (3) | 0/0/4 (1) | 0/0/4 (1) | 0/0/4 (2) | 0/1/3 (2) | 0/0/4 (1) | 3/0/1 (1) | 0/0/4 (1) | 0/0/4 (1) | 0/0/4 (2) | 0/0/4 (2) | 1/3/0 (1) | 1/0/3 (1) | 0/0/4 (1) | |||
| O. foliosus Pérez Lara | 4 | 0/0/4 (2) | 0/0/4 (2) | 0/0/4 (1) | 1/0/3 (1) | 2/1/1 (3)* | |||||||||||||
| O. hollianus (Lowe) Benth. | 4 | 0/0/4 (2) | 0/0/4 (1) | 0/0/4 (2) | 0/0/4 (1) | 1/0/3 (1) | 0/0/4 (1) | 0/0/4 (1) | 0/0/4 (1) | 0/1/3 (1) | 0/0/4 (2) | 1/0/3 (1) | 0/0/4 (1) | ||||||
| O. kaliformis (Pourr. ex Willd.) Pau | 4 | 0/0/4 (1) | 0/0/4 (1) | 3/1/0 (1) | 0/0/4 (1) | 0/0/4 (1) | 0/0/4 (1) | 0/0/4 (3) | 1/2/1 (1) | 0/0/4 (1) | 0/0/4 (1) | 0/0/4 (1) | 0/0/4 (1) | 0/1/3 (1) | 0/0/4 (1) | 0/1/3 (1) | 0/0/4 (1) | ||
| O. linkii Heldr. & Sartori ex Boiss. | 4 | 0/1/3 (1) | 3/1/0 (1) | 0/0/4 (1) | 0/1/3 (1) | 0/0/4 (2) | 3/1/0 (1) | 2/2/0 (1)* | |||||||||||
| O. luteus (L.) Clairv. | 4 | 2/2/0 (1) | 0/0/4 (5) | 0/0/4 (2) | 0/0/4 (2) | 0/0/4 (2) | 0/0/4 (5) | 0/1/3 (2) | 0/0/4 (4) | 2/0/2 (4) | 0/0/4 (2) | 0/0/4 (2) | 0/0/4 (4) | 0/0/4 (2) | 0/0/4 (1) | 0/1/3 (5) | |||
| O. maroccanus Bolliger | 4 | 3/0/1 (1) | 1/1/2 (2) | 0/0/4 (1) | 0/1/3 (1) | 1/0/3 (1) | 2/1/1 (1) | 2/2/0 (2)* | |||||||||||
| O. powellii Maire | 4 | 3/1/0 (1) | 0/0/4 (2) | 0/0/4 (2) | 0/2/2 (2) | 1/3/0 (3)* | |||||||||||||
| O. pyrenaeus subsp. abilianus P. Monts. | 4 | 2/0/2 (1) | 2/2/0 (1) | 0/0/4 (1) | 0/0/4 (2) | 3/0/1 (2) | 0/0/4 (2) | 0/0/4 (1) | 0/0/4 (1) | 2/0/2 (1) | 0/0/4 (2) | ||||||||
| O. pyrenaeus (Bubani) Rothm. subsp. pyrenaeus | 4 | 3/0/1 (1) | 2/0/2 (3) | 1/1/2 (2) | 0/0/4 (2) | 0/1/3 (6) | 1/0/3 (2) | 2/2/0 (1) | 0/0/4 (1) | 0/0/4 (2) | 0/0/4 (2) | 3/1/0 (1) | 0/0/4 (2) | ||||||
| O. recordonii Burnat & Barbey | 4 | 0/0/4 (3) | 0/0/4 (4) | 0/0/4 (4) | 0/0/4 (2) | 0/1/3 (2) | 0/0/4 (4) | 0/0/4 (1) | 0/0/4 (2) | 0/0/4 (3) | 0/0/4 (4) | 0/0/4 (1) | 0/0/4 (1) | 0/0/4 (2) | 0/0/4 (1) | 1/0/3 (1) | 0/0/4 (1) | ||
| O. viscosus subsp. asturicus M. Laínz | 2 | 1/1/0 (1) | 1/0/1 (1) | 0/0/2 (2) | 0/0/2 (1) | 1/1/0 (1) | 0/2/0 (1) | ||||||||||||
| O. viscosus subsp. australis (Boiss.) Jahand. & Maire | 2 | 1/0/1 (1) | 1/0/1 (1) | 0/2/0 (1) | 0/0/2 (2) | 0/0/2 (2) | 1/0/1 (1) | ||||||||||||
| O. viscosus subsp. granatensis (Boiss.) Bolliger | 2 | 1/1/0 (1) | 1/0/1 (1) | 0/0/2 (1) | 1/0/1 (1) | 0/0/2 (2) | 1/1/0 (1) | ||||||||||||
| O. viscosus subsp. lusitanicus Bolliger | 2 | 1/0/1 (1) | 0/2/0 (1) | 0/1/1 (2) | 0/0/2 (1) | 0/0/2 (1) | 0/0/2 (1) | ||||||||||||
| O. viscosus (L.) Clairv. subsp. viscosus | 2 | 1/0/1 (1) | 0/1/1 (2) | 0/0/2 (1) | 0/0/2 (1) | 0/0/2 (1) | 0/0/2 (1) | 1/0/1 (1) | |||||||||||
| Pa. latifolia (L.) Caruel | 2 | 1/0/1 (1) | 1/0/1 (1) | 0/0/2 (2) | 0/0/2 (1) | ||||||||||||||
| Pa. viscosa (L.) Caruel | 2 | 1/0/1 (2) | 1/1/0 (1)* | 0/2/0 (1) | 0/1/1 (1) | 0/0/2 (1) | 0/0/2 (2) | 0/0/2 (2) | 1/0/1 (1)* |
Note: n = number of individuals sampled.
Amplification success is presented as: number of individuals that did not amplify/number of individuals that amplified weakly/number of individuals that amplified successfully (number of alleles detected). No amplification = peak height >0 and <250 relative fluorescence units (RFU); weak amplification = peak height >250 and <1000 RFU; successful amplification = peak height >1000 RFU; * = presence of spurious peak. Empty cells indicate failed amplification in all individuals.
Abbreviations: B. = Bartsia; Ba. = Bartsiella; Be. = Bellardia; Eu. = Euphrasia; Ma. = Macrosyringion; No. = Nothobartsia; Od. = Odontitella; O. = Odontites; Pa. = Parentucellia.
Loci excluded in Odontites vernus due to genotyping difficulties or no polymorphism.
CONCLUSIONS
A set of polymorphic microsatellite markers for O. vernus is reported for the first time. Successful results for these loci in the cross‐amplification tests extend their potential usefulness to other closely related taxa. These markers will be useful for investigating genetic diversity in threatened species, self‐pollination rates, origin and evolution of polyploidy, and ecotypic variation and local adaptation in populations.
Appendix 1.
Voucher information for Odontites and related genera samples used in this study.
| Species | Collector no. and voucher accessiona,b | nc | Collection locality | Coordinatesd |
| Bartsia inaequalis Benth. | S. Pfanzelt 999, SALA 153256 | 1 | Bolivia: La Paz, Takesi valley | 19KFB2480 |
| Bartsiella rameauana (Emb.) Bolliger | AQ 2129, MA 746138 | 2 | Morocco: Azilal, Jbel Tarkeddit | 29RQQ3692 |
| Bartsiella rameauana | VL 172, SALA 149231 | 2 | Morocco: Ouarzazate, Tizi n'Ait Hamad | 29RQQ5992 |
| Bellardia trixago (L.) All. | DP 918, SALA 142076 | 1 | Spain: Burgos, Castrillo de la Vega | 30TVM3411 |
| Bellardia trixago | MO 6020, SALA 142078 | 1 | Spain: Cáceres, Gabriel y Galán Reservoir | 29TQE4456 |
| Euphrasia antarctica Benth. | S. Pfanzelt 699, CONC 180033 | 1 | Chile: Magallanes, San Juán | 19FCA7056 |
| Euphrasia hirtella Jord. ex Reut. | ER 8041, SALA 142118 | 1 | Spain: Ávila, San Martín de la Vega del Alberche | 30TUK1778 |
| Macrosyringion longiflorum (Lam.) Rothm. | DP 11, SALA 135639 | 1 | Spain: Burgos, Castrillo de la Vega | 30TVM3508 |
| Macrosyringion longiflorum | DP 851, SALA 137313 | 1 | Spain: Soria, Aldehuela de Periañez | 30TWM5429 |
| Macrosyringion longiflorum | DP 898, SALA 137290 | 1 | Spain: Segovia, Ayllón | 30TVL8073 |
| Macrosyringion longiflorum | VL 82, SALA 137638 | 1 | Morocco: Chefchaouen, Jbel L'akraa | 30SUD0490 |
| Nothobartsia asperrima (Link) Benedí & Herrero | DP 1062, SALA 156176 | 1 | Morocco: Chefchaouen, track betw. Sidi Jel and Beni Bouker | 30SUD0696 |
| Nothobartsia asperrima | ER 7909, SALA 123313 | 1 | Portugal: Ribatejo, Tomar | 29SND4983 |
| Nothobartsia asperrima | MS 958, SALA 123310 | 1 | Portugal: Estremadura, Azeitão | 29SNC0164 |
| Nothobartsia asperrima | MS 960, SALA 123311 | 1 | Portugal: Estremadura, Sesimbra | 29SMC8151 |
| Nothobartsia spicata (Ramond) Bolliger & Molau | ER 7920, SALA 125802 | 2 | Spain: Oviedo, Ribadesella | 30TUP3611 |
| Nothobartsia spicata | ER 7921, SALA 125801 | 2 | Spain: Santander, Peñarrubia | 30TUN6791 |
| Odontitella virgata (Link) Rothm. | DP 14, SALA 135636 | 1 | Spain: Burgos, Castrillo de la Vega | 30TVM3610 |
| Odontitella virgata | ER 7959, SALA 136278 | 1 | Spain: Cádiz, Los Barrios | 30STF6712 |
| Odontitella virgata | LD 1069, SALA 136280 | 1 | Spain: A Coruña, Santiso | 29TNH8046 |
| Odontitella virgata | SA 297, SALA 135467 | 1 | Portugal: Beira Litoral, rd. betw. Mira and Castanhede | 29TNE2771 |
| Odontites bocconii (Guss.) Walp. | G. Domina s.n., PAL 90581 | 2 | Italy: Sicilia, San Martino delle Scale | 33SUC4716 |
| Odontites bocconii | JPG‐11‐03, SALA 142125 | 2 | Italy: Sicilia, Madonie Regional Natural Park | 33SVB1389 |
| Odontites bolligeri E. Rico, L. Delgado & Herrero | AQ 2812, SALA 142142 | 1 | Morocco: Berkane, Béni‐Snassen | 30SWD5652 |
| Odontites bolligeri | DP 832, SALA 136804 | 1 | Spain: Málaga, Frigiliana | 30SVF1970 |
| Odontites bolligeri | MO 4566, SALA 135619 | 1 | Spain: Granada, Restábal | 30SVF4886 |
| Odontites bolligeri | VL 153, SALA 156172 | 1 | Spain: Almería, Láujar de Andarax | 30SWF1094 |
| Odontites cebennensis H. J. Coste & Soulié | DP 628, SALA 135679 | 1 | Spain: Barcelona, La Pobla de Lillet | 31TDG1877 |
| Odontites cebennensis | DP 1760, SALA 156184 | 1 | Andorra: Ordino, track to Castell dels Moros | 31TCH8012 |
| Odontites cebennensis | DP 1842, SALA 156185 | 1 | Spain: Gerona, Albanyà | 31TDG7578 |
| Odontites cebennensis | DP 1894, SALA 156186 | 1 | Spain: Teruel, Linares de Mora | 30TYK0665 |
| Odontites corsicus (Loisel.) G. Don | A. Tribsch s.n., SALA 137639 | 4 | France: Corse, Bastia | 32TNN3133 |
| Odontites foliosus Pérez Lara | DP 821, SALA 156297 | 1 | Spain: Málaga, Manilva | 30STF9724 |
| Odontites foliosus | ER 7903, SALA 103775e | 1 | Spain: Cádiz, Barbate | 30STF3408 |
| Odontites foliosus | ER 7939, SALA 134536 | 1 | Spain: Cadiz, Puerto Real | 29SQA5645 |
| Odontites foliosus | VL 135, SALA 144130 | 1 | Spain: Málaga, Genalguacil | 30STF9947 |
| Odontites hollianus (Lowe) Benth. | SC 17379, MA 714540 | 1 | Portugal: Madeira, betw. Pico do Arieiro and Pico Ruivo | 28SCB1823 |
| Odontites hollianus | M. Díaz s.n., SALA 156496 | 2 | Spain: Santa Cruz de Tenerife, Isla de La Palma | 28RBS1482 |
| Odontites hollianus | MS 5056, SALA 125030 | 1 | Portugal: Madeira, betw. O Ninho da Manta and O Pico Cidrão | 28SCB1724 |
| Odontites kaliformis (Pourr. ex Willd.) Pau | ER 7913, SALA 124706 | 2 | Spain: Valencia, Sagunto | 30SYJ3690 |
| Odontites kaliformis | ER 7914, SALA 124707 | 2 | Spain: Castellón, Cabanes | 31TBE6052 |
| Odontites linkii Heldr. & Sartori ex Boiss. | AH 3359, SALA 140386 | 1 | Greece: Peloponnese, Ahaia | 34SFH0215 |
| Odontites linkii | AH 3480, SALA 140486 | 1 | Greece: Peloponnese, Korinthia | 34SFH2804 |
| Odontites linkii | CA 14257, SALA 140800 | 2 | Greece: Peloponnese, Lakonia | 34SFG1806 |
| Odontites luteus (L.) Clairv. | BR 187, SALA 142123 | 1 | Czech Republic: Jihomoravský kraj, betw. Klentnice and Mikulov | 33UXQ2010 |
| Odontites luteus | DP 763, SALA 137330 | 1 | Spain: Albacete, Riópar | 30SWH5361 |
| Odontites luteus | DP 1018, SALA 110042 | 1 | Spain: Valladolid, Santibañez de Valcorba | 30TUM7904 |
| Odontites luteus | ER 7852, SALA 136275 | 1 | Spain: Lérida, betw. Puente de Montañana and Tremp | 31TCG1670 |
| Odontites maroccanus Bolliger | DP 785, SALA 156299 | 1 | Morocco: Ifrane, Tizi‐n‐Tretten | 30SUC1003 |
| Odontites maroccanus | DP 1082, SALA 156177 | 1 | Morocco: Ifrane, Aïn Vittel | 30SUC0314 |
| Odontites maroccanus | DP 1084, SALA 156178 | 1 | Morocco: Ifrane, Michlifen | 30SUB0699 |
| Odontites maroccanus | NLG 56, SALA 156170 | 1 | Morocco: Ifrane, near Michlifen | 30SUB0498 |
| Odontites powellii Maire | AQ 2119, MA 746128 | 1 | Morocco: Béni‐Mellal, Tizzi‐n‐Aif | 29SQS8002 |
| Odontites powellii | DP 786, SALA 156298 | 1 | Morocco: Ifrane, Tizi‐n‐Tretten | 30SUC1003 |
| Odontites powellii | NLG 64, SALA 156171 | 1 | Morocco: Khénifra, Col du Zad | 30SUB0750 |
| Odontites powellii | VL 83, SALA 156300 | 1 | Morocco: Chefchaouen, Jbel L'akraa | 30SUD0490 |
| Odontites pyrenaeus subsp. abilianus P. Monts. | DP 1603, SALA 156179 | 1 | Spain: Huesca, Jaca | 30TXN9312 |
| Odontites pyrenaeus subsp. abilianus | DP 1607, SALA 156180 | 1 | Spain: Zaragoza, Longás | 30TXN6905 |
| Odontites pyrenaeus subsp. abilianus | DP 1615, SALA 156181 | 1 | Spain: Huesca, Jaca | 30TYN0614 |
| Odontites pyrenaeus subsp. abilianus | ER 7746, SALA 103068 | 1 | Spain: Huesca, Jaca | 30TXN9707 |
| Odontites pyrenaeus (Bubani) Rothm. subsp. pyrenaeus | DP 615, SALA 135664 | 1 | Spain: Lérida, Sarroca de Bellera | 31TCG2492 |
| Odontites pyrenaeus subsp. pyrenaeus | DP 1667, SALA 156182 | 1 | Spain: Huesca, Isábena | 31TCG0387 |
| Odontites pyrenaeus subsp. pyrenaeus | DP 1736, SALA 156183 | 1 | Spain: Lérida, Cabó | 31TCG5375 |
| Odontites pyrenaeus subsp. pyrenaeus | ER 7845, SALA 136276 | 1 | Spain: Huesca, Plan | 31TBH7515 |
| Odontites recordonii Burnat & Barbey | DP 607, SALA 135656 | 1 | Spain: Vitoria, Elciego | 30TWN3008 |
| Odontites recordonii | DP 672, SALA 135722 | 1 | Spain: Albacete, Socovos | 30SWH9242 |
| Odontites recordonii | DP 692, SALA 135742 | 1 | Spain: Guadalajara, Fuentelviejo | 30TWK0184 |
| Odontites recordonii | LD 1019, SALA 135629 | 1 | Spain: Lérida, Sanaüja | 31TCG6136 |
| Odontites vernus (Bellardi) Dumort. | A. Tribsch 4650, SALA 126029 | 1 | Austria: Land Salzburg, Salzburg | 33TUN5199 |
| Odontites vernus | BR 27, SALA 135614 | 2 | Bulgaria: Veliko Tarnovo, betw. Dobre Dyal and Rodina | 35TMH0972 |
| Odontites vernus | BR 127, SALA 137352 | 1 | Serbia: Moravica, Čačak | 34TDP3960 |
| Odontites vernus | BR 158, SALA 142120 | 2 | France: Haute‐Normandie, near St. Sebastien | 31UCQ6131 |
| Odontites vernus | DP 619, SALA 135668 | 1 | Spain: Lérida, Espot | 31TCH4215 |
| Odontites vernus | DP 636, SALA 135687 | 2 (12x) | Spain: Gerona, Ribes de Freser | 31TDG3181 |
| Odontites vernus | DP 638, SALA 135689 | 3 | Spain: Gerona, Campdevanol | 31TDG3176 |
| Odontites vernus | DP 663, SALA 135713 | 3 | Spain: Granada, Quéntar | 30SVG6420 |
| Odontites vernus | DP 683, SALA 135733 | 2 | Spain: Teruel, Linares de Mora | 30TYK0465 |
| Odontites vernus | DP 694, SALA 135744 | 2 | Spain: Valladolid, Aldeamayor de San Martín | 30TUL5997 |
| Odontites vernus | DP 696, SALA 135746 | 32D+36T (12x+14x) | Spain: Valladolid, San Miguel del Arroyo | 30TUL7888 |
| Odontites vernus | DP 999, SALA 110023 | 1 | Spain: Burgos, Contreras | 30TVM6352 |
| Odontites vernus | DP 1277, SALA 150522 | 30 | Spain: Burgos, Tejada | 30TVM5544 |
| Odontites vernus | ER 7844, SALA 110695 | 14x | Spain: Huesca, Saravillo | 31TBH7415 |
| Odontites vernus | ER 7851, SALA 110696 | 3 | Spain: Huesca, Bisaurri | 31TBH9509 |
| Odontites vernus | ER 7863, SALA 110693 | 2 | Spain: Toledo, Tembleque | 30SVJ4592 |
| Odontites vernus | ER 7876, SALA 110709 | 12x | Spain: Almería, Fondón | 30SWF1293 |
| Odontites vernus | ER 7890, SALA 110730 | 2 | Spain: Lugo, Samos | 29TPH4631 |
| Odontites vernus | ER 7971, SALA 135644 | 1 | Spain: Orense, Castro Caldelas | 29TPG3089 |
| Odontites vernus | ER 8053, SALA 156498 | 1 | Spain: Burgos, Encío | 30TVN9224 |
| Odontites vernus | G. Domina s.n., PAL 88463 | 12x | Italy: Sicilia, Geraci Siculo | 33SVB2592 |
| Odontites vernus | G. Tuleu s.n., CBFS 5135 | 2f | Czech Republic: South Bohemia, České Budějovice | 33UVQ5925 |
| Odontites vernus | LD 908, SALA 110700e | 2 | Spain: Valladolid, Aldeamayor de San Martín | 30TUL6698 |
| Odontites vernus | LD 910, SALA 110698 | 3 | Spain: Valladolid, Canillas de Esgueva | 30TVM0723 |
| Odontites vernus | LD 931, SALA 110715 | 1 | Spain: Soria, El Royo | 30TWM3235 |
| Odontites vernus | LD 944, SALA 110736 | 2 | Spain: Burgos, Oña | 30TVN8228 |
| Odontites vernus | LD 979, SALA 110715e | 2 | Spain: Soria, El Royo | 30TWM3235 |
| Odontites vernus | MO 4522, SALA 135623 | 14x | Spain: Burgos, Merindad de Río Ubierna | 30TVN4205 |
| Odontites vernus | MO 5531, SALA 137348 | 2 | Croatia: Lika‐Senj, Plitvička Jezera National Park | 33TWK5466 |
| Odontites vernus | MO 5574, SALA 153253 | 1 | Spain: Burgos, Frías | 30TVN7635 |
| Odontites vernus | MS 944, SALA 128791 | 1 | Spain: Huesca, Ansó | 30TXN8152 |
| Odontites vernus | SA 415, SALA 137353 | 1 | Macedonia: Kavadarci, betw. Rožden and Majden | 34TEL7959 |
| Odontites viscosus subsp. asturicus M. Laínz | DP 874, SALA 137373 | 2 | Spain: León, Puebla de Lillo | 30TUN0774 |
| Odontites viscosus subsp. australis (Boiss.) Jahand. & Maire | DP 566, SALA 136267 | 1 | Spain: Granada, Güéjar Sierra | 30SVG5712 |
| Odontites viscosus subsp. australis | VL 91, SALA 156301 | 1 | Morocco: Chefchaouen, Jbel L'akraa | 30SUD0490 |
| Odontites viscosus subsp. granatensis (Boiss.) Bolliger | JPG ODOGRA‐G01, SALA 135386e | 1 | Spain: Granada, Sierra Nevada | 30SVG6207 |
| Odontites viscosus subsp. granatensis | JPG 130, no voucher | 1 | Spain: Granada, Sierra Nevada | 30SVG6208 |
| Odontites viscosus subsp. lusitanicus Bolliger | MS 959, SALA 123308 | 1 | Portugal: Estremadura, Sesimbra | 29SMC8151 |
| Odontites viscosus subsp. lusitanicus | MS 961, SALA 123309 | 1 | Portugal: Estremadura, Sesimbra | 29SMC8352 |
| Odontites viscosus (L.) Clairv. subsp. viscosus | BR 165, SALA 142122 | 1 | France: Provence‐Alpes‐Côte d'Azur, Marseille | 31TFJ9705 |
| Odontites viscosus subsp. viscosus | DP 616, SALA 135665 | 1 | Spain: Lérida, Sarroca de Bellera | 31TCG2492 |
| Parentucellia latifolia (L.) Caruel | MO 6019, SALA 142077 | 2 | Spain: Cáceres, Hervás | 30TTK5659 |
| Parentucellia viscosa (L.) Caruel | MO 6021, SALA 142079 | 2 | Spain: Cáceres, betw. Guijo de Granadilla and Mohedas de Granadilla | 29TQE3956 |
Note: n = number of individuals sampled.
Abbreviations (collector numbers): AH = Alberto Herrero; AQ =Alejandro Quintanar; BR = Blanca Rojas‐Andrés; CA = Carlos Aedo; DP = Daniel Pinto; ER = Enrique Rico; JPG = Julio Peñas de Giles; LD = Luis Delgado; MO = M. Montserrat Martínez‐Ortega; MS = María Santos (except for MS 5056, SALA 125030, which refers to Miguel Sequeira); NLG = Noemí López González; SA = Santiago Andrés‐Sánchez; SC = Santiago Castroviejo; VL = Victor Lucía.
Herbarium specimens are lodged at the herbarium of Universidad de Salamanca (SALA), Salamanca, Spain; University of South Bohemia (CBFS), České Budějovice, Czech Republic; Universidad de Concepción (CONC), Concepción, Chile; Herbarium Mediterraneum Panormitanum (PAL), Palermo, Italy; and Real Jardín Botánico–Consejo Superior de Investigaciones Científicas (MA), Madrid, Spain. DNA samples are deposited at Biobanco de ADN Vegetal (Universidad de Salamanca), Salamanca, Spain.
2x, 4x indicate ploidy level of individuals used in initial screening by agarose gel electrophoresis.
Coordinates are in MGRS format and using WGS84 Datum.
Silica gel–dried material and voucher specimen were collected in the same location but on different dates.
Individuals used to obtain 454 sequence library.
Appendix 2.
Primers rejected and reasons for discarding.
| Locus | Primer sequences (5′–3′) | Repeat motif | PCR product size (bp) | Ta (°C) | GenBank accession no. | Discarding reason |
| Ov‐1 | F: TCCTTAGAAGGACCCTCGAAAT | (AAT)11 | 93 | — | KT777565 | Inconsistent amplification |
| R: TCAGTACATTTGTTACTTTTCAGCTA | ||||||
| Ov‐3 | F: CTCTCCTTCATCACCCCTTCTT | (AC)11 | 124 | 54 | KT777575 | Genotyping difficulties |
| R: ACAAATTGAGAACCACTTTCCC | ||||||
| Ov‐4 | F: CACCTTTCTCATGAATCCATCT | (AAAT)9 | 276 | — | KT777576 | Spurious bands in gel |
| R: GTATGATGAAAATGGACGGGTT | ||||||
| Ov‐7 | F: GTCCGAAGCTCAAAGAGAAATC | (CCG)7 | 81 | — | KT777584 | Low levels of polymorphism in gel |
| R: ACGTGAATAGATCTTCGACGGA | ||||||
| Ov‐8 | F: TGCCGTTAAAGTCTCAGATCAA | (AC)10 | 103 | — | KT777585 | Low levels of polymorphism in gel |
| R: ATAATTTCACTAACGGCGAAGC | ||||||
| Ov‐9 | F: AATTCATAAGGCTGCTGCAGAT | (AG)10 | 84 | — | KT777586 | Low levels of polymorphism in gel |
| R: AATATCCATATGGTTTCAGCGG | ||||||
| Ov‐11 | F: GATTCATTGATTCGTTTATGTGT | (AAC)5 | 99 | — | KT777591 | Low levels of polymorphism in gel |
| R: AATGCCACAACTTTGCATCTAA | ||||||
| Ov‐12 | F: AAAGATCTGCAAACAAACAGCA | (AC)13 | 105 | 55 | KT777592 | Genotyping difficulties |
| R: GCATTATTCTCTATCCCACCCA | ||||||
| Ov‐13 | F: TAAGCATAAAACTGGAGGGGTC | (AC)10 | 108 | — | — | Unsuccessful amplification |
| R: CGTTTGTCGAGCTTTATTTTCC | ||||||
| Ov‐14 | F: GCCACGTATGTTTAGCCTTGTA | (AAT)6 | 161 | — | — | Unsuccessful amplification |
| R: GCTTCTCTTTTGTGGGGTTTATT | ||||||
| Ov‐16 | F: AGCTACCCAATATTCAGGGGAT | (AG)8 | 361 | — | — | Unsuccessful amplification |
| R: ATGGAATACTCCTCCCTCCCT | ||||||
| Ov‐18 | F: CGTTCATCAACTTGACAAGAGC | (AG)22 | 179 | — | — | Unsuccessful amplification |
| R: CAGAAGACCAACCAACTCTCCT | ||||||
| Ov‐22 | F: CAATTTAGGTCGAACTTGCACA | (ACC)5 | 159 | — | KT777614 | Spurious bands in gel |
| R: GATATTCAGAATGACGGGAAGC | ||||||
| Ov‐23 | F: ACTCCTTTCGTTGCCTATACCA | (AAT)5 | 82 | — | KT777615 | Low levels of polymorphism in gel |
| R: AGATGTCGTACTCGCAAACAGT | ||||||
| Ov‐24 | F: AGTTTTCAGCTCCACAGGTTGT | (ACC)5 | 89 | — | KT777616 | Low levels of polymorphism in gel |
| R: CTTGAAATTGGTTCTGGAAAGG | ||||||
| Ov‐26 | F: AAGGAGCTGATGAAAGCAGTTT | (AC)5 | 170 | 55 | KT777621 | Monomorphic |
| R: AGCTCATATTCTCCGGGTTACA | ||||||
| Ov‐27 | F: CTCAGTGTAGTTCCGTCATTGC | (AG)6 | 276 | — | — | Unsuccessful amplification |
| R: GCAATTCACAAATTCAATCCAA | ||||||
| Ov‐29 | F: GTACCCATATTTTTCCACCACG | (AG)8 | 275 | — | — | Unsuccessful amplification |
| R: ATGGAATACTCCTCCCTCCCT | ||||||
| Ov‐31 | F: TGGGAGTAGGGTAATCAAAGGA | (AG)22 | 225 | — | — | Unsuccessful amplification |
| R: AGAAGACCAACCAACTCTCCTG | ||||||
| Ov‐32 | F: GATCCATTAGCAATGGGACTTT | (AG)11 | 411 | 53 | KT777630 | Genotyping difficulties |
| R: TCGAGGAGATGTAATGGTTTTG | ||||||
| Ov‐34 | F: CGCATTTCACGAATCAAACTAA | (AC)5 | 208 | — | — | Unsuccessful amplification |
| R: AGCCTTGTAGCAGAAGCATTTC | ||||||
| Ov‐36 | F: AATTCATCCTAGCGTGTTCCAT | (AT)5 | 338 | — | — | Unsuccessful amplification |
| R: ACTTGGTTGGGATACGTTTAGC |
Note: — = no information available; Ta = optimal annealing temperature.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2016. This work is published under http://creativecommons.org/licenses/by-nc/4.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Premise of the study:
Microsatellite primers were developed for the first time in the root hemiparasite herb Odontites vernus (Orobanchaceae). These markers will be useful to investigate the role of polyploidization in the evolution of this diploid‐tetraploid complex, as well as the extent of gene flow between different ploidy levels.
Methods and Results:
Fourteen polymorphic and reproducible loci were identified and optimized from O. vernus using a microsatellite‐enriched library and 454 Junior sequencing. The set of primers amplified di‐ to pentanucleotide repeats and showed two to 13 alleles per locus. Transferability was tested in 30 taxa (19 belonging to Odontites and 11 from eight other genera of Orobanchaceae tribe Rhinantheae).
Conclusions:
The results indicate the utility of the newly developed microsatellites in O. vernus and several other species, which will be useful for taxon delimitation and conservation genetics studies.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
1 Departamento de Botánica, Universidad de Salamanca, E‐37007 Salamanca, Spain; Biobanco de ADN Vegetal, Banco Nacional de ADN, Edificio Multiusos I+D+I, E‐37007 Salamanca, Spain
2 Faculty of Science, University of South Bohemia, CZ‐370 05 České Budějovice, Czech Republic