Bladder cancer (BC) is one of the most common malignant tumors among men. The treatment of BC includes surgical resection, radiotherapy, and chemotherapy. Postoperative recurrence of BC is still possible. Postoperative radiotherapy and chemotherapy may be provided for patients with BCs that may recur. Invasive BC is a tumor between benign and malignant BCs, which BC cannot be completely resected because of its important adjacent structure, and is prone to recurrence after operation.
In recent years, the emergence of small RNA has provided a new way for us to study the pathogenic genes of BC. MicroRNA (miRNA, miR) is a type of small RNA. It is a family of noncoding regulatory RNAs with a 5‐terminal phosphoryl group and a 3‐terminal hydroxyl group and is approximately 22 nucleotides in length. More than 1/3 of all human genes are controlled by miRNA. Increasing evidence has suggested the important role of miRs in the progression of BC. For instance, miR‐206 is reported to be a tumor suppressor in BC via inhibiting the expression of YRDC. And miR‐506 is shown to suppress BC cell proliferation, invasion, and migration via targeting RWDD4. Abnormal expression of miR‐323a has been widely identified in various tumors, including prostate cancer and glioma. For instance, higher levels of miR‐323 are shown in prostate cancer and it is found to increase the vessel formation via targeting adiponectin receptor. In human glioma cells, upregulation of miR‐323‐5p is found to induce apoptosis of U251 and suppress the proliferation of the glioma cells. Additionally, miR‐323‐3p could reduce cell invasion and metastasis in pancreatic ductal adenocarcinoma by inhibiting the expression of SMAD2 and SMAD3. However, the specific functional role of miR‐323a in BC is still elusive.
c‐Met is highly expressed in BC and its high expression is positively correlated with malignancy, cell proliferation index, tumor microvessel density, and malignant prognosis of patients. c‐Met is mainly expressed in tumor cells and vascular endothelial cells. c‐Met activation can induce proliferation, migration, and invasion and inhibit the apoptosis of tumor cells and vascular endothelial cells. c‐Met activation in tumor vascular endothelial cells can induce extracellular matrix degradation and angiogenesis. In addition, c‐Met is widely expressed in BCs, and its expression level is significantly correlated with cell proliferation and angiogenesis, suggesting that c‐Met may play an important role in cell proliferation and angiogenesis in BCs.
The current study aimed to evaluate the expression and role of miR‐323a in the progression of BC, thereby providing a theoretical basis and potential therapy methods for BC patients.
From November 2015 to January 20, 2016 cases of BCs (average age: 48.15 ± 8.2 years; male/female: 11/9) were obtained after their surgical resection from consecutive unselected patients who underwent surgery at Hunan Province People's Hospital. Portions of the surgical specimen were immediately frozen and stored in liquid nitrogen. Five cases of non‐cancerous adjacent bladder tissues were obtained from the BC tissues.
Written informed consent was obtained from all participants involved in this study. The study was performed in accordance with the Declaration of Helsinki and approved by the Institutional Review Board of Hunan province people's hospital, China (HNPPH‐2016‐18).
The T24, J82, TCCSUP, RT‐112 human BC cell lines and human normal bladder epithelial cell line SV‐HUC‐1 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco's modified Eagle's medium (Thermo Fisher Scientific, Inc, Waltham, Massachusetts) supplemented with 10% fetal bovine serum (Hyclone; GE Healthcare Life Sciences, Logan, Utah), streptomycin (100 μg/mL) and penicillin (100 U/mL; Thermo Fisher Scientific, Inc) in 25‐cm2 culture flasks at 37°C in a humidified atmosphere containing 5% CO2.
Cells were seeded at 106 cells/well in 6‐well plates. Subsequently, miR‐323a mimic, inhibitor, or miR negative control (GenePharma) were mixed with HiPerFect transfection reagent (QIAGEN) and incubated at room temperature for 10 minutes. Then, the complex was added to the culture medium for 48 hours. Following transfection for 48 hours, the cells were collected for the subsequent experiments.
Total RNA was isolated from whole blood samples (5 mL, collected in tubes containing EDTA) or T24 cells using RNAVzol LS (Vigorous Biotechnology Beijing Co, Ltd, Beijing, China) according to the manufacturer's protocol. The concentration and purity of RNA samples were determined by measuring the optical density (OD) at OD260/OD280. A total of 1 μg of RNA was reverse transcribed using Moloney murine leukemia virus reverse transcription enzyme (Applied Biosystems; Thermo Fisher Scientific, Inc) with specific primers. The temperature protocol used for RT was as follows: 72°C for 10 minutes, 42°C for 60 minutes, 72°C for 5 minutes, and 95°C for 2 minutes. To quantify the relative mRNA levels, qPCR was performed using SYBR Green Supermix (Bio‐Rad Laboratories, Inc, Hercules, California) in an iCycleriQ real‐time Polymerase Chain Reaction detection system. The Polymerase Chain Reaction amplifications were performed in a 10 μL reaction system containing 5 μL of SYBR Green Supermix, 0.4 μL of forward primer, 0.4 μL of reverse primer, 2.2 μL pf double distilled H2O, and 2 μL of template cDNA. Thermocycling conditions were as follows: 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Relative mRNA expression was normalized to U6 using the 2‐ΔΔCq method. The primer sequences were as follows: miR‐323a‐5p‐RT, 5 ′‐GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCGAAC‐3′; U6‐RT, 5′‐GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATG‐3′; miR‐323a‐5p, forward 5′‐GCAGGUGGUCCGUGGCGCG‐3′; U6, forward 5′‐GCGCGTCGTGAAGCGTTC‐3′; universal reverse primer, 5′‐GTGCAGGGTCCGAGGT‐3′.
Total proteins were isolated from BC tissues or T24 cells using a total protein extraction kit (Beijing Solarbio Science & Technology Co, Ltd) and were collected following centrifugation at 12 000g for 30 minutes at 4°C. A bicinchoninic acid protein assay kit (Pierce; Thermo Fisher Scientific, Inc) was used to determine the protein concentration. A total of 20 μg of protein was separated using 12% dodecyl sulfate,sodium salt (SDS)‐Polyacrylamide gel electrophoresis, transferred onto polyvinylidene difluoride membranes and blocked with 5% fat‐free milk at room temperature for 2 hours. Membranes were incubated with primary antibodies against c‐Met (cat. no. 8198), anti‐p‐AKT (cat. no.4060), AKT (cat. no.4691), Bcl‐2 (cat. no. 3498), Bax (cat. no. 8242; 1:1000; Cell Signaling Technology, Inc), and GAPDH (2118; 1:5000; Cell Signaling Technology, Inc) at 4°C overnight. Membranes were subsequently incubated with horseradish peroxidase‐conjugated goat anti‐rabbit IgG (both 1:5000; cat. no. ZB‐2301; Beijing Zhongshan Golden Bridge Biotechnology Co, Beijing, China) for 2 hours at room temperature, followed by three washes with TBST. Enhanced chemiluminescence (EMD Millipore, Billerica, Massachusetts) was used to determine the protein concentrations according to the manufacturer's protocol. Signals were detected using a Super ECL Plus Kit (Nanjing KeyGen Biotech Co, Ltd), and quantitative analysis was performed using UVP software (UVP LLC, Upland, California). Relative protein expression levels were normalized to that of GAPDH. All experiments were repeated three times. ImageJ 1.43b software (National Institutes of Health, Bethesda, Maryland) was used for densitometry analysis.
The 3′ untranslated region (UTR) of c‐Met containing the predicted binding site was cloned into the pmirGLO (Promega) luciferase reporter vector. The PCR procedures were as follows: a hot start step at 95°C for 10 minutes, 40 cycles at 95°C for 15 seconds, and 55°C for 45 seconds followed by 72°C for 30 seconds. To construct the mutant vector, the Fast Mutagenesis System was applied (TransGen Biotech, Beijing, China).
For the luciferase reporter assay, cells were seeded at 5 × 104 cells/well in 500 μL 24‐well plates for 18 hours. Then, the modified firefly luciferase vector (500 ng/μL) was mixed with the Vigofect transfection reagent according to the manufacturer's instruction. After transfection for 48 hours, the Dual‐Luciferase Reporter Assay System (Promega) was applied to determine the changes in relative luciferase units. Renilla activity was used as the internal control.
First, the cells were washed with phosphate buffered saline (PBS) three times. To determine cell apoptosis, an Annexin‐V FITC‐PI Apoptosis Kit (Invitrogen, Carlsbad, California) was used. Briefly, the cells were washed with 1× Annexin‐V Binding Buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, 2.5 mM CaCl2) at a concentration of 2 to 3 × 106 cells/mL. Then, the Annexin‐V FITC and propidium iodide buffer was added, followed by incubation at room temperature for 15 minutes. After treatment, the cells were filtered by a 300 mesh filter and analyzed by flow cytometry (Becton Dickinson, Franklin Lakes, New Jersey) within 1 hour of staining.
Nuclear fragmentation was evaluated using TUNEL staining with an In Situ Cell Death Detection Kit (Roche Diagnostics, Indianapolis, Indiana) according to the instructions. In brief, after T24 cells transfected with miR‐323 mimic for 48 hours, the cells were fixed with 4% paraformaldehyde for 30 minutes, followed by incubation with TUNEL buffer for 1 hour at 37°C. After rinsing with PBS, the TUNEL‐positive apoptotic cells were observed using a fluorescence microscope (Olympus Corporation, Tokyo, Japan) at a magnification of ×400.
First, T24 cells were seeded in the top chamber of each insert at a density of 1.0 × 105 cells/well (BD Biosciences, San Jose, California) with 8.0‐mm pores for the motility assay. For the invasion assays, 2.0 × 105 cells were cultured in a chamber (BD Biosciences) precoated with 0.2% Matrigel (Collaborative Research, Boston, Massachusetts) at 37°C. As a chemoattractant, 10% fetal bovine serum was added to the culture medium in the lower chamber. After 24 hours, the cells remaining in the upper compartment were removed by cotton swabs, and those that invaded through the membrane were stained with a dye solution containing 20% methanol and 0.1% crystal violet. The cells were then imaged under a light microscope (Olympus), and 10 individual fields were counted per insert. The results are presented as an average of three separate experiments.
Data are presented as the mean ± SD from three independent experiments. The two‐tailed unpaired student's t tests were used for comparisons of two groups. The one‐way analysis of variance multiple comparison test (version 20.0, SPSS, Inc, Chicago, Illinois) followed by Turkey post hoc test were used for comparisons of two more groups. P < .05 was considered statistically significant.
First, we explored the level of miR‐323a in BC tissues. Compared with non‐cancerous tissues, the level of miR‐323a was significantly lower in BC tissues (Figure A). We further divided the bladder tissues according to the clinical stages (Ta‐T1 [n = 8 cases], ≥T2 [n = 12 cases]). Reduced miR‐323a expression in the BC tissues was found to be significantly associated with tumor grade (Ta‐T1 vs ≥T2: 1 ± 0.68 vs 0.53 ± 0.64; Figure B). Meanwhile, we also tested the level of miR‐323a in human BC cell lines (T24, J82, TCCSUP, RT‐112) and human normal bladder epithelial cell line SV‐HUC‐1. As shown in Figure B, the expression of miR‐323a was significantly decreased in all human BC cell lines compared with that of SV‐HUC‐1 cells. More importantly, miR‐323a was found to be much lower in TCCSUP and T24 cells (Figure C). Hence, in the following experiment, TCCSUP and T24 cells were selected for further in vitro analysis.
Enlarge this image.The level of miR‐323a was found to be decreased in bladder cancer (BC) tissues and cell lines. A, Compared with non‐cancerous adjacent BC tissues, the level of miR‐323a was significantly reduced in BC tissues (n = 20). B, Much lower level of miR‐323a was found in BC tissues ≥T2 stages than that in Ta‐T1 stages. C, The level of miR‐323a was reduced in T24, J82, TCCSUP, RT‐112 cells than that in SV‐HUC‐1 cells. *P < .05, **P < .01 vs control
Then, we explored whether miR‐323a affected BC cell migration and invasion. As shown in Figure A,B (upper panel, respectively), overexpression of miR‐323a significantly reduced the migration capacity of T24 and TCCSUP cells, while inhibition of miR‐323a markedly increased the migration capacity of T24 and TCCSUP cells. Meanwhile, the invasive capacity was reduced in T24 cells and TCCSUP transfected with the miR‐323a mimic (Figure A,B, lower panel, respectively). In comparison, the invasive capacity was enhanced in T24 and TCCSUP cells transfected with the miR‐323a inhibitor (Figure A,B, lower panel, respectively). These data suggested that reduced miR‐323a levels prompted BC cell migration and invasion.
Enlarge this image.Reduced miR‐323a expression enhanced T24 and TCCSUP cell migration and invasion. A, T24 cell migration and invasion capacity were determined using 0.1% crystal violet. B, TCCSUP cell migration and invasion capacity were determined using 0.1% crystal violet. N = 3 independent experiments, **P < .01, ***P < .001 vs control
Next, we overexpressed miR‐323a in T24 cells and explored their role in BC cekk apoptosis. As shown in Figure A, overexpression of miR‐323a enhanced T24 and TCCSUP cell apoptosis, which was discovered using flow cytometry analysis. In addition, TUNEL staining demonstrated that overexpression of miR‐323a markedly enhanced the apoptotic morphology of T24 and TCCSUP cells compared with that of the negative control (Figure B).
Enlarge this image.Upregulation of miR‐323a increased T24 and TCCSUP cell apoptosis. A, Overexpression of miR‐323a enhanced T24 cell and TCCSUP apoptosis using flow cytometry analysis. B, TUNEL staining demonstrated that overexpression of miR‐323a markedly enhanced the apoptotic morphology of T24 and TCCSUP cells compared with that of the negative control. N = 3 independent experiments, **P < .01 vs control
Then, we explored the possible target gene of miR‐323a in BC cells. According to TargetScan, we identified c‐Met as a possible target gene of miR‐323a in humans (Figure A). Then, the 3′ UTR of c‐Met was cloned into the luciferase reporter vector pmirGLO. A dual luciferase reporter assay showed that overexpression of miR‐323a markedly suppressed the relative luciferase activity of the pmirGLO‐c‐Met‐3′UTR (Figure B). Moreover, we also determined that overexpression of miR‐323a suppressed the protein level of c‐Met (Figure C), while inhibition of miR‐323a markedly enhanced the protein expression of c‐Met (Figure D).
Enlarge this image.C‐Met was the target gene of miR‐323a. A, Schematic analysis of the binding site for miR‐323a in the 3′UTR of c‐Met. B, Dual luciferase reporter assay showed that overexpression of miR‐323a markedly suppressed the relative luciferase activity of pmirGLO‐c‐Met‐3′UTR. C, The overexpression of miR‐323a suppressed the protein level of c‐Met. D, Inhibition of miR‐323a markedly enhanced the protein expression of c‐Met. E, Inhibition of miR‐323a enhanced the phosphorylation level of AKT and the expression of Bcl‐2. N = 3 independent experiments, *P < .05, **P < .01 vs control
To further explore the possible mechanism by which miR‐323a affected BC cell proliferation, we silenced the level of c‐Met in T24 cells using a specific siRNA targeting c‐Met. As shown in Figure E, inhibition of c‐Met markedly decreased the phosphorylation level of AKT, which then reduced cell proliferation. Meanwhile, the protein expression of Bcl‐2 was also decreased in T24 cells transfected with si‐c‐Met. In contrast, the levels of c‐Met, p‐AKT, and Bcl‐2 were significantly increased in T24 cells transfected with miR‐323a inhibitor, indicating a tumor suppressor role in BC (Figure E). However, this effect of the miR‐323a inhibitor could be abolished to a great extent in T24 cells transfected with si‐c‐Met (Figure E). Moreover, Inhibition of c‐Met could reverse miR‐323a inhibitor‐induced BC cell migration in T24 and TCCSUP cells (Figure A,B). These results indicated that inhibition of miR‐323a contributed to BC progression mainly through its action on the oncogene c‐Met.
Enlarge this image.Knockdown of c‐Met reversed miR‐323a inhibitor‐induced cell migration. Inhibition of c‐Met could reverse miR‐323a inhibitor‐induced BC cell migration in T24 (A) and TCCSUP (B) cells. *P < .05, **P < .01 vs NC; ###P < .001 vs miR‐323a inhibitor
BC, as a malignant tumor originating from urinary tract epithelium, accounts for 1% to 2% of all malignant tumors. In the world, BC ranks the fourth most common solid tumors in men and the tenth in women. The incidence of BC is relatively insidious, not easy to detect, and the growth of the tumor itself is rapid, prone to invasion, and metastasis. At the same time, the degree of malignant phenotype such as metastasis and infiltration after recurrence will further increase. Studies have shown that after treatment, about 30% to 80% of patients with non‐myometrial invasive BC recur within 5 years, and some of these patients will further progress to myometrial invasive BC. Therefore, it is very important for clinical practice that the pathogenesis of BC and the pathogenic genes of BC be explored.
In recent years, more and more evidences have shown that miRNA plays a key regulatory role in tumorigenesis and development. For instance, miRNAs are found to affect cell differentiation, proliferation, and apoptosis by reducing the stability of target genes or inhibiting their translation. Exploring the relationship between miRNAs and BC formation provides a new way to define the pathogenic factors of BC.
Previous studies have shown the tumor suppressor role of miR‐323 in the progression of various tumors. Here, our data showed that the expression of miR‐323a was significantly decreased in both BC tissues and BC cell lines. Further study showed that inhibition of miR‐323a significantly enhanced the migration and invasion capacity of BC cells, validating a tumor suppressive role of miR‐323a in BC. We also found that elevated miR‐323a levels induced of T24 and TCCSUP cell apoptosis, indicating the anti‐apoptosis role of miR‐323a in BC.
However, the underlying mechanisms of this anti‐apoptotic role remain unclear. Interestingly, we found that c‐Met was a target gene of miR‐323a. In BC cells, overexpression of c‐Met can increase tumorigenesis, tumor growth, and angiogenesis, while inhibition of c‐Met expression can inhibit BC formation and growth in vivo. At the same time, c‐Met expression is more common in high‐grade BC than in low‐grade BC. c‐Met regulates BC formation and malignant transformation by promoting cell cycle progression, tumor cell migration and invasion, and tumor angiogenesis and inhibiting apoptosis. In epithelial ovarian cancer, reduction of miR‐323a is reported to suppress epithelial ovarian cancer cell proliferation via targeting c‐Met and suppressing the c‐Met/AKT/mTOR signaling pathway. Consistently, we found that knockdown of c‐Met markedly enhanced the phosphorylation level of AKT in T24 and TCCSUP cells, while upregulation of c‐Met significantly decreased the phosphorylation level of AKT and the protein expression of Bcl‐2, indicating an oncogenic role of c‐Met in T24 and TCCSUP cells. In addition, such effect of miR‐323a inhibitor was abrogated by transfection of si‐c‐Met, indicating that the contribution to BC progression from the inhibition of miR‐323a mainly depended on the oncogene c‐Met.
Even though, some limitations still exist in the current study. For instance, whether low miR‐323a expression is associated with high bladder tumor recurrence rate in BC patients is still not known. In the future study, we will include more patient samples and make a deep analysis of the association between low miR‐323a expression and high bladder tumor recurrence rate in BC patients.
In conclusion, reduced miR‐323a expression in BC cells contributes to abnormal cancer cell proliferation and migration mainly by targeting c‐Met.
© 2019. This work is published under http://creativecommons.org/licenses/by-nc-nd/4.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Fang, Yi 2 ; Li, Jian 3 ; Sheng‐Ying Xiao 1 1 Department of Oncology, Hunan Province People's Hospital, the First Affiliated Hospital of Hunan Normal University, Changsha, Hunan, People's Republic of China
2 Department of Anesthesiology, Changsha Central Hospital, Changsha, Hunan, People's Republic of China
3 Department of Radiotherapy, the Second Affiliated Hospital of Guangxi Medical University, Nanning, People's Republic of China