Comparative iTRAQ proteomic profiling of sweet orange fruit on sensitive and tolerant rootstocks infected by ‘Candidatus Liberibacter asiaticus’

Abstract

Citrus Huanglongbing (HLB), which is also known as citrus greening, is a destructive disease continuing to devastate citrus production worldwide. Although all citrus varieties can be infected with ‘Candidatus Liberibacter asiaticus’ (CaLas), a certain level of HLB tolerance of scion varieties can be conferred by some rootstocks. To understand the effects of rootstock varieties on orange fruit under CaLas stress, comparative iTRAQ proteomic profilings were conducted, using fruit from ‘Valencia’ sweet orange grafted on the sensitive (‘Swingle’) and tolerant rootstocks (a new selection called ‘46x20-04-48’) infected by CaLas as experimental groups, and the same plant materials without CaLas infection as controls. The symptomatic fruit on ‘Swingle’ had 573 differentially-expressed (DE) proteins in comparison with their healthy fruit on the same rootstock, whereas the symptomatic fruit on ‘46x20-04-48’ had 263 DE proteins. Many defense-associated proteins were down-regulated in the symptomatic fruit on ‘Swingle’ rootstock that were seldom detected in the symptomatic fruit on the ‘46x20-04-48’ rootstock, especially the proteins involved in the jasmonate biosynthesis (AOC4), jasmonate signaling (ASK2, RUB1, SKP1, HSP70T-2, and HSP90.1), protein hydrolysis (RPN8A and RPT2a), and vesicle trafficking (SNAREs and Clathrin) pathways. Therefore, we predict that the down-regulated proteins involved in the jasmonate signaling pathway and vesicle trafficking are likely to be related to citrus sensitivity to the CaLas pathogen.

About the Authors:

Lixiao Yao

Roles Data curation, Formal analysis, Funding acquisition, Writing – original draft

Affiliations Citrus Research Institute, Southwest University, Chongqing, China, Citrus Research and Education Center, University of Florida, Lake Alfred, Florida, United States of America

ORCID logo http://orcid.org/0000-0002-4512-2613

Qibin Yu

Roles Data curation, Writing – original draft, Writing – review & editing

Affiliation: Citrus Research and Education Center, University of Florida, Lake Alfred, Florida, United States of America

Ming Huang

Roles Formal analysis, Methodology

Affiliation: Citrus Research and Education Center, University of Florida, Lake Alfred, Florida, United States of America

Zhen Song

Roles Data curation, Funding acquisition

Affiliation: Citrus Research Institute, Southwest University, Chongqing, China

Jude Grosser

Roles Resources

Affiliation: Citrus Research and Education Center, University of Florida, Lake Alfred, Florida, United States of America

Shanchun Chen

Roles Funding acquisition, Writing – original draft

Affiliation: Citrus Research Institute, Southwest University, Chongqing, China

Yu Wang

Roles Methodology, Writing – original draft

Affiliation: Citrus Research and Education Center, University of Florida, Lake Alfred, Florida, United States of America

Frederick G. Gmitter Jr.

Roles Funding acquisition, Supervision, Writing – review & editing

* E-mail: [email protected]

Affiliation: Citrus Research and Education Center, University of Florida, Lake Alfred, Florida, United States of America

Introduction

Huanglongbing (HLB), also known as citrus greening, is the most destructive citrus disease worldwide. It is commonly accepted that HLB is mainly caused by the gram-negative, phloem-limited fastidious bacterium ‘Candidatus Liberibacter asiaticus’ (CaLas) and vectored by Diaphorina citri, the Asian citrus psyllid. CaLas distributes in bark, leaf midrib, root, flower, and fruit parts of infected citrus trees, and a relatively high-concentration of bacteria can be observed in fruit peduncles and fruit abscission zones [1, 2]. The CaLas-infected trees usually display yellowing or blotchy mottled leaves, and show twig dieback, decline and even mortality several months to years after infection. Symptomatic fruits are usually found on symptomatic branches; they are lopsided and small, and often abscise prematurely. These fruits also have poor color development and may only “break color” on the stem end, the remaining surface of which is largely green. The abscission zone of the fruits located at the pedicel-fruit interface can be orange and their columella vascular bundles are orange or brown. It has been reported that juice from HLB-affected fruit was bitter and much more acidic with numerous off-flavors, similar to immature fruit [3]. This is because, comparing asymptomatic and healthy fruit, juice of symptomatic fruit contains lower percentage of soluble solid content and has lower soluble solid content to titratable acidity ratio [4, 5], and a significantly higher concentration of bitter limonoid compounds (limonin and nomilin) [5, 6]. Seeds are usually aborted in symptomatic fruit, and may be dark in color regardless if they are filled or partially filled.

Understanding molecular changes underlying host responses to pathogens is essential for clarification of the mechanisms behind plant-microbe interactions and in development of innovative strategies for both diagnostic and therapeutic approaches. Identifying key genes and proteins induced by HLB has been studied in leaf [7–20], stem [21], root [21, 22], fruit peel [2, 12, 23] with the “omic” methods, including microarray, RNA-Seq, 2-DE and iTRAQ. There is very little known about the proteomic differences in fruit pulp tissues as a consequence of HLB, and nothing is known on the impact of using more tolerant rootstocks on the fruit proteome. The materials utilized in these studies are varied, in general: 1) most of them focused on HLB-sensitive citrus [2, 7–14, 21–24], especially sweet orange ‘Valencia’, in which HLB-affected citrus were compared to healthy trees; 2) HLB-tolerant citrus [15], such as lemon, were also analyzed by comparing symptomatic leaves with asymptomatic leaves; and 3) the HLB-tolerant citrus and the HLB-sensitive citrus were analyzed at the same time to identify the genes/proteins associated with tolerance or sensitivity in citrus [16–20]. Overall, the results have shown the molecular mechanisms of disease development in HLB-tolerant and sensitive varieties are very complex, and within the tolerant citrus, different varieties showed different responses to HLB [16, 17].

The rootstock is very important for the commercialization of citrus trees and successful citrus production, as it can affect the citrus tolerance to abiotic and biotic stresses. At present, some rootstock varieties with HLB tolerance have been reported, but they have not yet been widely used in the commercial citrus [25]. Recent studies revealed that citrus trees grafted on some rootstock accessions showed tolerance to HLB. Some CaLas-infected scion/tolerant rootstock trees continued to grow, and had significantly greater fruit load than the CaLas-infected scion/sensitive rootstock trees [26–28]. Although Albrecht and her colleagues found that the concentrations of many metabolites were higher in the tolerant compared with sensitive rootstock cultivars [29], little is known about the molecular mechanism of rootstock effect on citrus scion response to CaLas infection. Therefore, comparing scions grafted on tolerant and sensitive citrus rootstocks infected by CaLas may provide more insights of the disease mechanisms.

CaLas are unevenly distributed in the infected plants and could induce similar or different reactions among root, stem, leaf and fruit. As a sink tissue, HLB-associated characteristics in fruit are related to but not depending on restricted carbohydrate movement [2]. Due to widespread HLB within several years, citrus production in Florida was reduced sharply (Florida Citrus Commission: http://www.floridacitrus.org). The HLB-affected oranges also have been utilized in the juice processing and this can impact product flavor [3]. It is critical to understand the whole protein profile of the fruit, especially in fruit pulp, under the threat of HLB disease.

To explore the effects of CaLas on the fruits harvested from ‘Valencia’ scion grafted on HLB-sensitive and HLB-tolerant rootstocks, we used an eight-channel iTRAQ technique to identify differentially expressed proteins by comparing symptomatic and healthy ‘Valencia’ fruits on the HLB-sensitive and HLB-tolerant rootstocks. Our results have highlighted the molecular processes regarding plant defense associated with HLB affected fruits produced from trees grown on rootstocks that differ in their sensitivity to the pathogen.

Materials and methods

Plant materials

Symptomatic and healthy 8-year-old ‘Valencia’ trees grafted on HLB-sensitive rootstock ‘Swingle’ (Citrus paradisi × Poncirus trifoliata) and HLB-tolerant rootstock ‘46x20-04-48’ (C. grandis × C. reticulata) were grown at an orchard in St. Cloud, FL, USA, and were characterized by visual observation for symptom severity. Quantitative real-time PCR (qPCR) described by Li et al. [30] was used to determine the presence or absence of CaLas in leaf and fruit tissues. Only two PCR-negative and healthy trees from each rootstock selection were found in the citrus grove, as a consequence of the widespread incursion on HLB in Florida when the study was initiated. Three biological replicate symptomatic trees were selected on each rootstock. Five fruits from each tree were randomly harvested and fruit pulp was collected from each fruit, mixed for one tree, and stored at -80°C. Other fruits were weighed, and their length and width were measured using a caliper. Minolta CR-330 colorimeter was used to measure peel color at three locations around the equatorial plane of fruit and the color was expressed as the Hunter ratio a/b. The color a/b ratio is negative for green, zero for yellow and positive for orange.

The qPCR detection of CaLas

Fruits and leaves were ground in liquid nitrogen using mortar and pestle. DNA extraction was performed using 100 mg of each ground tissue. Plant DNeasy Plant Mini Kit (Qiagen, Valencia, CA) was used to extract DNA according to the manufacturer’s instructions, which yielded 25 ng of DNA per extraction. We performed qPCR assays using primers LAS_HLB1 (5´- TCGAGCGCGTATGCAATACG -3´) and LAS_HLB2 (5´- GCGTTATCCCGTAGAAAAAGGTAG-3´), and probe FAM_HLB (5´-AGACGGGTGAGTAACGCG-3´) [30]. Amplifications were performed using an Mx3005P qPCR System (Agilent Technologies, Santa Clara, CA) and the Brilliant III Ultra-Fast qPCR Master Mix (Agilent Technologies) according to the manufacturer’s instructions. All reactions were carried out in two technical duplicates in a 10 μL reaction volume, 1 μL DNA as template per reaction. Leaf and fruit samples were considered PCR-positive if the Ct (cycle threshold) value was less than 32.

Protein extraction

We used the modified phenol-based procedure to isolate total plant protein [31]. Specifically, five grams of fruit pulp frozen in liquid nitrogen was ground to powder and suspended directly in 15 mL of homogenization buffer (0.7 M Sucrose, 50 mM EDTA, 50 mM DTT, 1 mM PMSF, 0.1 M KCl, 1% 2-mercaptoethanol, 0.1% protease inhibitor mix, 0.5 M Tris [pH 7.5]) and the same volume of Tris-saturated phenol. The homogenate was vibrated and mixed vigorously for 30 min at 4°C. The top phenol phase was transferred into a new 50 mL polypropylene tube after 30 min centrifugation at 5000 ×g at 4°C. The protein pellet was precipitated overnight with 3 volumes of ice-cold 0.1 M ammonium acetate, and thoroughly washed four times with pure methanol and acetone. Air-dried protein was stored at -20°C.

Proteomic iTRAQ running and data analysis

Ten protein samples were labeled and run for iTRAQ analysis (3 biological replicates of the symptomatic samples, 2 biological replicates of the healthy samples, and 2 rootstock varieties). 100 μg protein extracted with phenol from fruits on one tree was regarded as one biological replication. iTRAQ running and data analyses were performed by the Interdisciplinary Center for Biotechnology Research (ICBR) at the University of Florida (Gainesville, FL, USA). Protein digestion, marker labeling and cation exchange were performed according to the manufacturer’s protocols. For protein identification, the MS/MS data produced in iTRAQ were analyzed by a thorough search against the NCBI subset of C. sinensis plants fasta database using the Paragon™ Algorithm of ProteinPilot V5.0 software suite (Applied Biosystems). For relative quantification of proteins, it was considered to be a differentially expressed (DE) protein if its p value was less than 0.05, and fold change was more than 1.5 (up-regulated), or less than 0.67 (down-regulated). The DE proteins were obtained between symptomatic fruit on ‘Swingle’ rootstock and healthy fruit on the same rootstock, and symptomatic fruit on ‘46x20-04-48’ rootstock and healthy fruit on the same rootstock. Gene ontology analysis and functional classification of total DE proteins were performed using Blast2GO [32]. Arabidopsis orthologs were determined for each DE protein by local BLASTX (e-value < 10−3) against the TAIR database of Arabidopsis predicted proteins. The biological interpretation of the DE proteins was further confirmed by MAPMAN [33] and Pathway Studio (Plant) Desktop 10 from Elsevier [34].

Results

HLB test by qPCR and the characteristics of fruits

To assess bacterial population levels in the ‘Valencia’ fruit and leaf tissues, qPCR analysis that targeted 16S rDNA of CaLas was performed. The samples were labeled “positive” and “negative” if their Ct values were less and greater than 32, respectively. Regardless of rootstock varieties (HLB-tolerant ‘46x20-04-48’ or HLB-sensitive ‘Swingle’), leaf qPCR was positive and negative for the symptomatic and healthy trees, respectively. The fruits on healthy and symptomatic trees were marked as healthy or symptomatic fruits, respectively. The majority of fruits were found to be qPCR-negative. However, the symptomatic fruit from one tree on the tolerant rootstock ‘46x20-04-48’ was positive (S1 Table).

For healthy fruit, there were no significant differences between the ‘46x20-04-48’ and ‘Swingle’ rootstocks in terms of fruit width, fruit length, fresh weight and color (S2 Table). However, the Hunter ratio a/b of ‘Valencia’ fruit was negative for symptomatic fruit (green peel) under CaLas infection. The size (width and length) and weight of symptomatic fruit were reduced 8% and 16%, and 21% and 40%, compared with healthy fruit from the trees grafted on the ‘46x20-04-48’ and ‘Swingle’ rootstock, respectively.

Fruit proteomic profile in symptomatic fruit on tolerant and sensitive rootstock

A total of 758 differentially-expressed proteins were found by comparing symptomatic fruit with healthy fruit, seven of which did not show orthology with any genes from Arabidopsis thaliana. There were 495 differentially-expressed fruit proteins (41 up, 454 down) found only in the symptomatic fruit on ‘Swingle’, whereas 185 proteins (6 up, 179 down) were found only in the symptomatic fruit on ‘46x20-04-48’. Fruit on both rootstocks shared 78 differentially-expressed proteins, all of which were down-regulated in fruit on the ‘46x20-04-48’ rootstock, whereas seven were up-regulated in fruit on the ‘Swingle’ rootstock (Fig 1A). Most differentially-expressed proteins have catalytic activity and binding function, playing a role in metabolic processes, single-organism processes, localization, and response to stimuli, etc. (Fig 1B). Fruit on ‘Swingle’ had more differentially-expressed proteins in GO classification, except in the extracellular category. There were no differentially-expressed proteins detected from trees grafted on ‘46x20-04-48’ in the multicellular organismal process, molecular transducer activity, or nucleic acid binding transcription factor activity (Fig 1B).

[Figure omitted. See PDF.]

Fig 1. Differentially-expressed fruit proteins in MAPMAN analysis and GO classification responding to Huanglongbing.

A: MAPMAN analysis; B: GO classification. H48 means healthy fruit from HLB-tolerant ‘46x20-04-48’ rootstock; S48 means symptomatic fruit from HLB-tolerant ‘46x20-04-48’ rootstock; HS means healthy fruit from HLB-sensitive ‘Swingle’ rootstock; SS means symptomatic fruit from HLB-sensitive ‘Swingle’ rootstock.

https://doi.org/10.1371/journal.pone.0228876.g001

Differentially expressed transcription factors

There were nine transcription factors differentially-expressed by comparing the symptomatic and healthy fruits on the same rootstock type (Table 1). None of them was shared from symptomatic fruits on both ‘Swingle’ and ‘46x20-04-48’ when compared with their healthy counterparts. Specifically, compared with healthy fruit from trees grafted on ‘Swingle’, symptomatic fruit had one protein T13M11.9 (gi|641856847) that was up-regulated and seven other down-regulated proteins. Among these, HSFA6B (gi|641849752) was confirmed as response to heat stress, GR-RBP2 (gi|641831608) had glycine-rich domain, and F11A3.17 (gi|641849010), F5O4.7 (gi|568833438), and SE (gi|641847522) had the zinc finger domain. BTF3 (gi|641840770), a basal transcription factor, was the only differentially-expressed protein in symptomatic fruit on rootstock ‘46x20-04-48’ compared with healthy fruit on ‘46x20-04-48’.

[Figure omitted. See PDF.]

Table 1. The differentially-expressed transcription factors in Huanglongbing (HLB)-symptomatic fruit, from sensitive and tolerant rootstocks respectively.

https://doi.org/10.1371/journal.pone.0228876.t001

Down-regulated proteins involved in hormone signal pathways

Compared with healthy fruit, there were 15 down-regulated proteins associated with the signaling pathway in symptomatic fruit (Fig 1A, S3 Table), six of which (AOC4, ASK2, APX1, CSD1, RUB1, and SKP1) were involved in the jasmonic acid, ethylene and salicylic acid crosstalk signaling pathway. Four (AHP5, PDV2, PPC1, and PPC4) and three proteins (ASK2, COP9, and SKP1) were involved in the cytokinins signaling and the senescence auxin pathways, respectively. Three (CDPK2, LTI65, and RAB18) and two (ASK2 and SKP1) proteins were involved in the ABA signaling and gibberellin signaling pathways. One protein (GLX1) was involved in the calcium signaling pathway. Compared with healthy fruit on ‘Swingle’, twelve down-regulated signal-associated proteins were found in the symptomatic fruit on the ‘Swingle’ rootstock. There were 4 down-regulated signal-associated proteins in the symptomatic fruit compared with the healthy fruit on the ‘46x20-04-48’ rootstock.

Jasmonates play key roles in modulating defense responses and in regulating plant growth and development. Eleven down-regulated proteins involved in jasmonate biosynthesis and signal pathway were found in the symptomatic ‘Valencia’ fruits compared with healthy ones (Table 2). Two proteins involved in the jasmonate biosynthesis process were allene oxide cyclases (AOCs). In specific, AOC4 (gi|641805976) and AOC3 (gi|641851214) were detected with down-regulation in the symptomatic fruit on the ‘Swingle’ and ‘46x20-04-48’ rootstocks, respectively. Eight down-regulated proteins involved in the jasmonate signal transmission were found in the symptomatic fruit on ‘Swingle’ rootstock and 4 down-regulated proteins in the diseased fruit on ‘46x20-04-48’ rootstock. Among them, HSP90.1(gi|568875065), SKP1(gi|568839457), and RPT2a(gi|568853056) were found to be decreased in the symptomatic fruit, not only on the ‘Swingle’ but also on the ‘46x20-04-48’ rootstock.

[Figure omitted. See PDF.]

Table 2. Down-regulated fruit proteins involved in the jasmonate (JA) biosynthesis and signal pathway, in response to Huanglongbing (HLB).

https://doi.org/10.1371/journal.pone.0228876.t002

Differentially-expressed proteins associated with vesicle trafficking

There were 16 differentially-expressed proteins involved in the vesicle trafficking process that were detected from the symptomatic fruit compared with their healthy counterparts (Table 3) on the ‘Swingle’ and ‘46x20-04-48’ rootstocks. The expression of four soluble SNAREs (N-ethylmaleimide-sensitive factor attachment protein receptors) were decreased in the symptomatic fruit on the ‘Swingle’ rootstock. They are divided in the two subtypes that are t-SNAREs (gi|568850479 and gi|641843163) and v-SNAREs (gi|641840511 and gi|568822856) located on the target membrane and on the vesicular membrane, respectively. The t-SNARE protein gi|568850479 was also down-regulated in the symptomatic fruit on ‘46x20-04-48’ rootstock. Expression of two other t-SNAREs (gi|641843247 and gi|641867568) were specifically decreased in the symptomatic fruit on the ‘46x20-04-48’ rootstock. Four plastid division proteins were differentially expressed in the symptomatic fruit on ‘Swingle’, three of which were down-regulated (gi|568869681, gi|641835496, and gi|568852804). A clathrin protein (gi|568865883) and two clathrin interactors (EPSIN1 (gi|568844191) and EPSIN2 (gi|568850347)) were down-regulated in the symptomatic fruit on the ‘Swingle’ rootstock. Two proteins (gi|641830669 and gi|568845159), possibly providing energy for the vesicle trafficking, were down-regulated in the symptomatic fruit on ‘Swingle’. The PTAC4 (gi|641826577) involved in the thylakoid formation was found in lower concentration in the symptomatic fruit on ‘46x20-04-48’, but not in symptomatic fruit on ‘Swingle’.

[Figure omitted. See PDF.]

Table 3. Differentially-regulated fruit proteins in vesicle trafficking responding to Huanglongbing (HLB).

https://doi.org/10.1371/journal.pone.0228876.t003

Other defense-response proteins

Despite the defense-response proteins described above, seventy-three others were also found with differential expression from comparing symptomatic and healthy fruits. They included 51 (3 up, 48 down) and 30 (all down) in symptomatic fruit on ‘Swingle’ and ‘46x20-04-48’, respectively (S4 Table). Among these, eight were detected from the two varieties of rootstock under the HLB stress, most of which were decreased with expression in fruit on both ‘Swingle’ and ‘46x20-04-48’ except gi|641841112 that was up-regulated and down-regulated in symptomatic fruit on ‘Swingle’ and ‘46x20-04-48’, respectively. Two proteins (gi|568867630 and gi|641849727) involved in the PTI process and one protein (gi|641835987) involved in the ETI process were down-regulated in symptomatic fruit on ‘Swingle’ and ‘46x20-04-48’, respectively. One PR-6 family protein (gi|568854491) was down-regulated in symptomatic fruit on the ‘Swingle’ rootstock. Arginase (gi|641867103), an acyl-CoA binding protein ACBP3 (gi|641862869), and phosphotase WIN2 (gi|641848484) were all down-regulated in symptomatic fruit on ‘Swingle’. While, the polygalacturonase inhibitor 1 (PGIP1, gi|641820484) and a 6-phosphogluconolactonase EMB2024 (gi|568880520) were down-regulated in symptomatic fruit on rootstock ‘46x20-04-48’ specifically.

Discussion

HLB is a devastating disease affecting citrus worldwide. The leaf midrib is usually used to detect CaLas by qPCR; however, the pathogen can be found in most HLB-affected fruit tissues including fruit pedicel, fruit abscission zone, fruit flavedo, vascular tissue, and juice vesicle [2]. The RNA transcription of HLB-impacted fruit versus girdled fruit comparison indicated that the mechanisms regulating development of HLB symptoms in fruit, rather than a direct consequence of carbohydrate starvation, are likely to be related to the host disease response [2]. In this experiment, both citrus trees grafted on the ‘46x20-04-48’ and ‘Swingle’ rootstocks were naturally infected with CaLas in the field. We identified more differentially-expressed proteins in symptomatic fruit on HLB-sensitive ‘Swingle’ rootstock (573) than HLB-tolerant ‘46x20-04-48’ rootstock (263) compared with their healthy counterparts, which are similar to the published literatures [16, 17, 19] that more genes were differentially expressed in HLB-sensitive orange than the HLB-tolerant citrus. This phenomenon was also found on the metabolite products. The number of differentially regulated metabolites in the HLB-affected fruit was the largest in the susceptible cultivar and the lowest in the tolerant cultivar, compared with the non-affected fruit [29].

Transcription factors were negatively regulated in the symptomatic fruit

We found nine down-regulated transcription factors in the symptomatic fruit on the CaLas-infected tree compared with the healthy fruit on the non-pathogen-infected tree (Table 1), whose expression was associated with the biotic and abiotic stress. BTF3 (gi|641840770) protein, originally recognized as a basal transcription factor, was specifically down-regulated in symptomatic fruit on the ‘46x20-04-48’ rootstock. It has been found that the gene BTF3 from Capsicum annuum is involved in hypersensitive response cell death and regulates hypersensitive response-related gene expression [35]. gi|641831608 is a homologous protein of GR-RBP2, the gene of which encodes a glycine-rich RNA-binding protein that has RNA chaperone activity. GR-RBP2 silencing was found to affect flowering time, stamen number, and seed development in Arabidopsis [36]. It is quite possible that the defect of this protein is associated with the aborted seeds of the HLB-affected citrus fruit. In addition, GR-RBP2 overexpression can improve grain yield of rice (Oryza sativa) under drought stress conditions [37]. HSFA6B (gi|641849752) is a member of the heat stress transcription factor (Hsf) family and its cis-promoter elements can be bound with NAC019, which is a NAC transcription factor and its expression can be induced by drought, high salt, and abscisic acid [38]. Multiprotein bridging factor 1 (MBF1) (gi|641827820), a transcriptional co-activator, functions in mediating transcriptional activation by connecting sequence-specific activator-like proteins and the TATA-box binding protein (TBP). Studies of maize and Arabidopsis reveal that MBF may be involved in stress response pathways [39, 40].

Negative regulation of jasmonate signal in the symptomatic fruit

The plant hormone jasmonate is an important lipid-derived regulator responding to biotic and abiotic stresses as well as playing a role in plant growth and development. Its role in biosynthesis, perception, signal transduction, and action in stress response, growth, and development have been frequently discussed [41–43]. All the enzymes involved in the biosynthesis of jasmonate have been characterized from numerous plant species, which are also jasmonate-inducible. Allene oxide cyclase (AOC) is crucial within jasmonate biosynthesis, which establishes the enantiomeric structure of the cyclopentenone ring. AOC activity was determined by pairwise combinations of the four AOC isoforms and the most activitive heterodimers were found containing AOC4/AOC1 and AOC4/AOC2, respectively [44]. Proteins involved in jasmonate perception and signalling include COI1, acting as an F-box protein and jasmonate receptor, and the core compenent of an SKP1/Cullin/F-box complex (SCFCOI1) that functions as an E3 ubiquitin ligase. The SCFCOI1 that binds jasmonate make the transcriptional repressor JAZ to be poly-ubiquitylated, then the JAZ is subsequently degraded by the 26S proteasome [45]. The degradation of JAZ activities MYC2 and possible other transcription factors, allowing the expression of the plant systemic resistant genes [46].

COI1 also has been revealed to interact directly with the COP signalosome (CSN) in vivo using co-immunoprecipitation and gel-filtration analyses. More importantly, most of the COI1-dependent jasmonate-responsive genes also require CSN, whose abundance was shown to be important for jasmonate-dependant plant defense responses [47, 48]. At the same time, COI1 is a client protein of a chaperone complex SGT1b-HSP70-HSP90 and these complexes function in jasmonate hormone signalling through stabilizing the COI1 protein. The COI1 has direct interaction with SGT1b and is independent from SKP1 protein [49]. SKP1 has been demonstrated to interact with COI1 through yeast two-hybrid analysis and immunoprecipitation, and a SKP1-related protein, ASK2, has been also reported to interact with COI1 [50]. The Arabidopsis cullin AtCUL1, another subunit of SCFCOI1 E3 ubiquitin ligase, can be modified by the ubiquitin-related protein RUB1 [51]. The RUB family of proteins have around 50–60% of amino acids identical to ubiquitin. However, unlike ubiquitin modification, the conjugation product of RUB and Cullin does not appear to modify its metabolites’ stability and stimulate SCFCOI1 ubiquitin ligase activity [52]. RUB1 interacts weakly with a proteasomal ubiquitin receptor Rpn10, but binds to proteasome ubiquitin-shuttle proteins like ubiquitin [53].

In the symptomatic fruit from trees grafted on the ‘Swingle’ rootstock infected with CaLas, the citrus homologous proteins involved in the jasmonate biosynthesis and signal pathway were accumulated at significantly lower levels compared with the healthy fruit on the same rootstock variety. The jasmonate biosynthesis enzyme AOC4, that could compose the highest AOC activity heterodimers, was down-regulated 35% in the HLB-affected fruit on ‘Swingle’ [44]. The fruit proteins involved in the jasmonate signal pathway (SKP1, RUB1, HSP90.1, HSP70T-2, ASK2, and COP9) were down-regulated 31% - 49% in the citrus tree grafted on ‘Swingle’ infected with CaLas. The subunits of 26S proteasome, RPB8A and RPT2a, were decreased to 38% expression. Recently, Zhong et al. [22] have found 5 JAZ genes were up-regulated in the CaLas-infected citrus root through RNA-seq, which might inhibit MYC expression. These down-regulated and up-regulated proteins indicated the plant resistance induced by jasmonate was suppressed, and were likely to be related to facilitate CaLas infection on citrus as shown in Fig 2.

[Figure omitted. See PDF.]

Fig 2. Scheme of JA signal pathway in the symptomatic fruit responding to Huanglongbing.

These green proteins were down-regulated in symptomatic fruit on the HLB-sensitive rootstock ‘Swingle’. This suggested perhaps a negative effect, depending on COI1, suppressing the hydrolyzation of JAZ and interfering with the expression of plant resistance genes.

https://doi.org/10.1371/journal.pone.0228876.g002

Negative regulation of vesicle trafficking in the symptomatic fruit

Plants lack an acquired immune system and a circulatory system. They have evolved conserved innate immune systems against pathogenic microbes on two definable layers. PTI is the immunity triggered with pathogen-associated molecular patterns, and ETI is triggered with pathogen-associated effectors [54]. A variety of host proteins involved in PTI and ETI are largely limited in the distinct membrane subcellular structures of plant cells. In order to activate the spatio-temporally controlled immune responses, it is critical to regulate the dynamic subcellular localization of plant immunity-related proteins through the engaged protein trafficking system [55, 56].

There are a number of proteins required to play proper roles together from vesicle budding to vesicle fusion to ensure the correct vesicle trafficking, among which, SNARE polypeptides are the most important that function during the recognition and fusion between vesicle and target membrane [57]. They are divided into the two functional forms: 1) v-SNAREs that are inserted into the vesicular membrane, and 2) t-SNAREs that are located on target membrane. Generally, through forming a cis-SNARE complex located on the target membrane, t-SNARE proteins (2~3) properly interact with a v-SNARE to form a four-helix trans-SNARE complex on an incoming vesicle via their coiled-coil domains that provides fusion specificity [58, 59]. In symptomatic fruit on the ‘Swingle’ rootstock, we found two t-SNAREs (SYP21 and SYP61) and two v-SNAREs (YKT61 and SEC22) were down-regulated under the CaLas infection (Table 3). The v-SNARE SEC22 has a subcellular distribution compatible with a role at the ER-Golgi interface. The overexpression of SEC22 and Memb11 can induce collapse of Golgi membrane proteins collapsing into the ER, which are also involved in anterograde protein trafficking at the ER-Golgi interface [60]. These down-regulated t-SNAREs and v-SNAREs in symptomatic fruit on the ‘Swingle’ rootstock are likely to affect vesicle trafficking and subsequently weaken the plant immune defense.

Clathrin-mediated endocytosis enters cells through clathrin-coated vesicles on the plasma membrane. Clathrin plays a major role in modifying membranes to form the budding vesicle. Rather than directly binding to the membrane or to cargo receptors, it relies on adaptor and accessory proteins (such as EPSIN) that are recruited to the plasma membrane [61]. Clathrin protein (gi|568865883), EPSIN1 (gi|568844191) and EPSIN2 (gi|568850347) were down-regulated in symptomatic fruit on the ‘Swingle’ rootstock (Table 3). In Arabidopsis, EPSIN1 interacting with clathrin and v-SNARE VTI11 plays a crutial role in the vacuolar trafficking of soluble proteins at the trans-Golgi network [62] and EPSIN2 is essential in protein trafficking through interacting with clathrin and v-SNARE VTI12 and phosphatidylinositol-3-P [63].

Two distinct plant plastid chaperonin polypeptides, Cpn60α (gi|568869681) and Cpn60β (gi|641835496), were down-regulated in symptomatic fruit on the ‘Swingle’ rootstock. In Arabidopsis, len1 mutant showed that Cpn60β (LEN1) functions as a molecular chaperone in chloroplasts and its deletion triggers cell death, which leads to the establishment of systemic acquired resistance [64]. The formation of a normal plastid division apparatus requires Cpn60α and Cpn60β. A proper level of Cpn60 is required for folding of stromal plastid division proteins and/or the regulation of FtsZ polymer dynamics [65]. The distribution of active GTP and inactive GDP-bound forms between membranes and cytosol is controlled by GDI (gi|641830669), a key regulator of Rab/Ypt GTPases. A RabGDI deletion is lethal in yeast [66]. TUF (gi|568845159) is the subunit E1 of the vacuolar type H+-ATPase (v-ATPase), and v-ATPase localizes to specific regions of the vacuolar membrane and functions to generate a proteon motive force for secondary transport systems [67]. The two proteins, GDI and TUF, possibly provide energy for the vesicle trafficking and were down-regulated in symptomatic fruit on the HLB-sensitive rootstock ‘Swingle’.

Other down-regulated plant defense proteins in the symptomatic fruit

Many down-regulated proteins in the symptomatic fruit on the HLB-sensitve ‘Swingle’ rootstock were shown to be involved in the plant defense response according to GO annotation. Arginase (gi|641867103), producing ornithine and urea, plays a role in plant defense responses. In tomato, inducing arginase activity in leaves has been shown to respond to wounding, treatment with jasmonate and infection with Botrytis cinerea, Plasmodiophora brassicae, and Pseudomonas syringae [68–70]. ACBP3 (gi|641862869), present in the extracellar space, can transport fatty acid/lipid precursors. It plays a role in the plant defense, responding to the bacterial pathogen P. syringae pv tomato DC3000 [71], which is likely to serve as one of the potential pathogen targets, and its degradation can enhance pathogen growth [72]. Interacting with the bacterial HopW1-1 effector, WIN2 (gi|641848484) (a PP2C) is required against virulent P. syringae [73]. PGIPs (gi|641820484), capable to recognize and directly inhibit fungal endopolygalacturonases, are extracellular leucine-rich repeat (LRR) proteins present in the plant cell wall [74]. Constitutive expression of Vvpgip1 from Vitis vinifera was found to protect tobacco plants from Botrytis cinerea through remodelling and reorganizing the cellulose xyloglucan network in cell walls [75, 76]. EMB2024 (gi|568880520), known as PGL3, is a 6-phosphogluconolactonase that catalyses a reaction step of the pentose phosphate pathway in plastids. Knockdown of PGL3 constitutively activated the plant salicylic acid-dependent defense responses [77].

Conclusions

‘Valencia’ scions show differences in the fruit characteristics and protein expression profiles under CaLas infection when grafted on HLB-sensitive ‘Swingle’ and HLB-tolerant ‘46x20-04-48’ rootstocks. Most differentially-expressed fruit proteins were down-regulated in the symptomatic fruit on both ‘Swingle’ rootstock (525 down-regulated proteins) and ‘46x20-04-48’ rootstock (257 down-regulated proteins) compared with their healthy counterparts. The down-regulated proteins in the jasmonate signal pathway and vesicle trafficking are likely to affect the plant defense response that enhance citrus sensitivity to CaLas, the HLB pathogen. Further research to unravel the underlying mechanisms through which the rootstock interacts with the scion to enhance scion tolerance of HLB can lend valuable insight to the disease manifestation processes, potentially leading to new genetic or even cultural approaches to decrease the serious negative impacts of HLB on citrus production globally.

Supporting information

[Figure omitted. See PDF.]

S1 Table. Detection of CaLas 16S rDNA from leaf and fruit tissues of ‘Valencia’ by qPCR.

https://doi.org/10.1371/journal.pone.0228876.s001

(XLSX)

S2 Table. The characteristics in healthy and symptomatic fruit grafted on a tolerant (‘46x20-04-48’) and sensitive (‘Swingle’) rootstock.

https://doi.org/10.1371/journal.pone.0228876.s002

(XLSX)

S3 Table. Differentially-expressed proteins associated with plant signaling in the symptomatic fruit.

https://doi.org/10.1371/journal.pone.0228876.s003

(XLSX)

S4 Table. Other differentially-expressed defense-response proteins in the symptomatic fruit.

https://doi.org/10.1371/journal.pone.0228876.s004

(XLSX)

Citation: Yao L, Yu Q, Huang M, Song Z, Grosser J, Chen S, et al. (2020) Comparative iTRAQ proteomic profiling of sweet orange fruit on sensitive and tolerant rootstocks infected by ‘Candidatus Liberibacter asiaticus’. PLoS ONE 15(2): e0228876. https://doi.org/10.1371/journal.pone.0228876

References

1. Tatineni S, Sagaram US, Gowda S, Robertson CJ, Dawson WO, Iwanami T, et al. In planta distribution of 'Candidatus Liberibacter asiaticus' as revealed by polymerase chain reaction (PCR) and real-time PCR. Phytopathology. 2008;98(98):592–9. pmid:18943228

2. Liao HL, Burns JK. Gene expression in Citrus sinensis fruit tissues harvested from huanglongbing-infected trees: comparison with girdled fruit. J Exp Bot. 2012;63(8):3307–19. pmid:22407645; PubMed Central PMCID: PMC3350938.

3. Raithore S, Dea S, Plotto A, Bai J, Manthey J, Narciso J, et al. Effect of blending Huanglongbing (HLB) disease affected orange juice with juice from healthy orange on flavor quality. LWT—Food Sci Technol. 2015;62(1):868–74.

4. Plotto A, Baldwin E, McCollum G, Manthey J, Narciso J, Irey M. Effect of Liberibacter infection (huanglongbing or "greening" disease) of citrus on orange juice flavor quality by sensory evaluation. J Food Sci. 2010;75(4):S220–S30. pmid:20546425.

5. Dagulo L, Danyluk MD, Spann TM, Valim MF, Goodrich‐Schneider R, Sims C, et al. Chemical characterization of orange juice from trees infected with citrus greening (Huanglongbing). J Food Sci. 2010;75(2):C199–C207. pmid:20492226

6. Paula BMD, Raithore S, Manthey JA, Baldwin EA, Bai J, Zhao W, et al. Active taste compounds in juice from oranges symptomatic for Huanglongbing (HLB) citrus greening disease. LWT-Food Sci Technol. 2018;91:518–25.

7. Albrecht U, Bowman KD. Gene expression in Citrus sinensis (L.) Osbeck following infection with the bacterial pathogen Candidatus Liberibacter asiaticus causing Huanglongbing in Florida. Plant Sci. 2008;175(3):291–306.

8. Fan J, Chen C, Yu Q, Brlansky RH, Li Z-G, Gmitter FG Jr. Comparative iTRAQ proteome and transcriptome analyses of sweet orange infected by "Candidatus Liberibacter asiaticus". Physiol Plantarum. 2011;143(3):235–45. WOS:000296029100003. pmid:21838733

9. Kim JS, Sagaram US, Burns JK, Li JL, Wang N. Response of sweet orange (Citrus sinensis) to 'Candidatus Liberibacter asiaticus' infection: microscopy and microarray analyses. Phytopathology. 2009;99(1):50–7. pmid:19055434

10. Mafra V, Martins PK, Francisco CS, Ribeiro-Alves M, Freitas-Astua J, Machado MA. Candidatus Liberibacter americanus induces significant reprogramming of the transcriptome of the susceptible citrus genotype. BMC Genomics. 2013;14:247. WOS:000318037100001. pmid:23586643

11. Martinelli F, Reagan RL, Dolan D, Fileccia V, Dandekar AM. Proteomic analysis highlights the role of detoxification pathways in increased tolerance to Huanglongbing disease. BMC Plant Biol. 2016;16(1):167. pmid:27465111; PubMed Central PMCID: PMC4963945.

12. Martinelli F, Reagan RL, Uratsu SL, Phu ML, Albrecht U, Zhao W, et al. Gene regulatory networks elucidating Huanglongbing disease mechanisms. PLoS One. 2013;8(9):e74256. pmid:24086326; PubMed Central PMCID: PMC3783430.

13. Zhong Y, Cheng CZ, Jiang B, Jiang NH, Zhang YY, Hu ML, et al. Digital gene expression analysis of Ponkan mandarin (Citrus reticulata Blanco) in response to Asia citrus psyllid-vectored Huanglongbing infection. Int J Mol Sci. 2016;17(7):1063. WOS:000381500900078. pmid:27384559

14. Nwugo CC, Lin H, Duan Y, Civerolo EL. The effect of 'Candidatus Liberibacter asiaticus' infection on the proteomic profiles and nutritional status of pre-symptomatic and symptomatic grapefruit (Citrus paradisi) plants. BMC Plant Biol. 2013;13:59. WOS:000319738500001. pmid:23578104

15. Nwugo CC, Duan Y, Lin H. Study on citrus response to Huanglongbing highlights a down-regulation of defense-related proteins in lemon plants upon 'Ca. Liberibacter asiaticus' infection. PLoS One. 2013;8(6):e67442. pmid:23922636; PubMed Central PMCID: PMC3686881.

16. Albrecht U, Bowman KD. Transcriptional response of susceptible and tolerant citrus to infection with Candidatus Liberibacter asiaticus. Plant Sci. 2012;185–186:118–30.

17. Fan J, Chen C, Yu Q, Khalaf A, Achor DS, Brlansky RH, et al. Comparative transcriptional and anatomical analyses of tolerant rough lemon and susceptible sweet orange in response to 'Candidatus Liberibacter asiaticus' infection. Mol Plant Microbe Interact. 2012;25(11):1396–407. pmid:22809274.

18. Wang Y, Zhou L, Yu X, Stover E, Luo F, Duan Y. Transcriptome profiling of Huanglongbing (HLB) tolerant and susceptible Citrus plants reveals the role of basal resistance in HLB tolerance. Front Plant Sci. 2016;7:933. pmid:27446161; PubMed Central PMCID: PMC4923198.

19. Hu Y, Zhong X, Liu X, Lou B, Zhou C, Wang X. Comparative transcriptome analysis unveils the tolerance mechanisms of Citrus hystrix in response to ‘Candidatus Liberibacter asiaticus’ infection. PLoS One. 2017;12(12):e0189229. pmid:29232716

20. Yu Q, Chen C, Du D, Huang M, Yao J, Yu F, et al. Reprogramming of a defense signaling pathway in rough lemon and sweet orange is a critical element of the early response to ‘Candidatus Liberibacter asiaticus’. Hortic Res. 2017;4:17063. pmid:29214028

21. Aritua V, Achor D, Gmitter FG, Albrigo G, Wang N. Transcriptional and microscopic analyses of citrus stem and root responses to Candidatus Liberibacter asiaticus infection. PLoS One. 2013;8(9):e73742. WOS:000324408400033. pmid:24058486

22. Zhong Y, Cheng CZ, Jiang NH, Jiang B, Zhang YY, Wu B, et al. Comparative transcriptome and iTRAQ proteome analyses of citrus root responses to Candidatus Liberibacter asiaticus infection. PLoS One. 2015;10(6):e0126973. pmid:26046530; PubMed Central PMCID: PMC4457719.

23. Martinelli F, Uratsu SL, Albrecht U, Reagan RL, Phu ML, Britton M, et al. Transcriptome profiling of citrus fruit response to Huanglongbing disease. PLoS One. 2012;7(5):e38039. pmid:22675433; PubMed Central PMCID: PMC3364978.

24. Yao L, Yu Q, Huang M, Hung W, Grosser J, Chen S, et al. Proteomic and metabolomic analyses provide insight into the off-flavour of fruits from citrus trees infected with ‘Candidatus Liberibacter asiaticus’. Hortic Res. 2019;6:31. pmid:30792870

25. Ramadugu C, Keremane ML, Halbert SE, Duan YP, Roose ML, Stover E, et al. Long-term field evaluation reveals Huanglongbing resistance in citrus relatives. Plant Dis. 2016;100(9):1858–69. pmid:30682983

26. Stover E, Inch S, Richardson ML, Hall DG. Conventional citrus of some scion/ rootstock combinations show field tolerance under high Huanglongbing disease pressure. HortScience. 2016;51(2):127–32.

27. Albrecht U, McCollum G, Bowman KD. Influence of rootstock variety on Huanglongbing disease development in field-grown sweet orange (Citrus sinensis [L.] Osbeck) trees. Sci Hortic. 2012;138:210–20. WOS:000303623800029.

28. Bowman KD, Mccollum G, Albrecht U. Performance of ‘Valencia’ orange (Citrus sinensis [L.] Osbeck) on 17 rootstocks in a trial severely affected by huanglongbing. Sci Hortic. 2016;201:355–61.

29. Albrecht U, Fiehn O, Bowman KD. Metabolic variations in different citrus rootstock cultivars associated with different responses to Huanglongbing. Plant Physiol Bioch. 2016;107:33–44. pmid:27236226

30. Li W, Hartung JS, Levy L. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J Microbiol Methods. 2006;66(1):104–15. pmid:16414133.

31. Hurkman WJ, Tanaka CK. Solubilization of plant membrane proteins for analysis by two-dimensional gel electrophoresis. Plant Physiol. 1986;81(3):802–6. pmid:16664906

32. Conesa A, Götz S, García-Gómez JM, Terol J, Talón M, Robles M. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics. 2005;21(18):3674–6. pmid:16081474

33. Thimm O, Bläsing O, Gibon Y, Nagel A, Meyer S, Krüger P, et al. MAPMAN: a user-driven tool to display genomics data sets onto diagrams of metabolic pathways and other biological processes. The Plant journal: for cell and molecular biology. 2004;37(6):914–39. pmid:14996223

34. Nikitin A, Egorov S, Daraselia N, Mazo I. Pathway studio-the analysis and navigation of molecular networks. Bioinformatics. 2003;19(16):2155–7. pmid:14594725

35. Huh SU, Kim KJ, Paek KH. Capsicum annuum basic transcription factor 3 (CaBtf3) regulates transcription of pathogenesis-related genes during hypersensitive response upon Tobacco mosaic virus infection. Biochem Biophys Res Commun. 2012;417(2):910–7. pmid:22209846

36. Fusaro AF, Bocca SN, Ramos RLB, Barrôco RM, Magioli C, Jorge VC, et al. AtGRP2, a cold-induced nucleo-cytoplasmic RNA-binding protein, has a role in flower and seed development. Planta. 2007;225(6):1339–51. pmid:17123099

37. Yang DH, Kwak KJ, Min KK, Su JP, Yang KY, Kang H. Expression of Arabidopsis glycine-rich RNA-binding protein AtGRP2 or AtGRP7 improves grain yield of rice (Oryza sativa) under drought stress conditions. Plant Sci. 2014;214C(1):106–12. pmid:24268168

38. Guan Q, Zhu J. The protein phosphatase RCF2 and its interacting partner NAC019 are critical for heat stress-responsive gene regulation and thermotolerance in Arabidopsis. Plant Cell. 2014;26(1):438–53. pmid:24415771

39. Kim MJ, Lim GH, Kim ES, Ko CB, Yang KY, Jeong JA, et al. Abiotic and biotic stress tolerance in Arabidopsis overexpressing the Multiprotein bridging factor 1a (MBF1a) transcriptional coactivator gene. Biochem Bioph Res Co. 2007;354(2):440–6. pmid:17234157

40. Tsuda K, Yamazaki KI. Structure and expression analysis of three subtypes of Arabidopsis MBF1 genes. Biochimica et Biophysica Acta. 2004;1680(1):1–10. pmid:15451167

41. Okada K, Abe H, Arimura G-i. Jasmonates induce both defense responses and communication in monocotyledonous and dicotyledonous plants. Plant Cell Physiol. 2015;56(1):16–27. pmid:25378688

42. Campos ML, Kang J-H, Howe GA. Jasmonate-triggered plant immunity. J Chem Ecol. 2014;40(7):657–75. pmid:24973116

43. Wasternack C, Hause B. Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Ann Bot. 2013;(111):1021–58, 2013. pmid:23558912

44. Otto M, Naumann C, Brandt W, Wasternack C, Hause B. Activity regulation by heteromerization of Arabidopsis allene oxide cyclase family members. Plants. 2016;5(1):3. Epub 2016/05/03. pmid:27135223; PubMed Central PMCID: PMC4844422.

45. Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, et al. Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor. Nature. 2010;468(7322):400–5. pmid:20927106

46. Thines B, Katsir L, Melotto M, Niu Y, Mandaokar A, Liu G, et al. JAZ repressor proteins are targets of the SCFCOI1 complex during jasmonate signalling. Nature. 2007;448(7154):661–5. pmid:17637677

47. Feng S, Ma L, Wang X, Xie D, Dinesh-Kumar SP, Wei N, et al. The COP9 signalosome interacts physically with SCFCOI1 and modulates jasmonate responses. Plant Cell. 2003;15(5):1083–94. pmid:12724535

48. Hind SR, Pulliam SE, Veronese P, Shantharaj D, Nazir A, Jacobs NS, et al. The COP9 signalosome controls jasmonic acid synthesis and plant responses to herbivory and pathogens. Plant J. 2011;65(3):480–91. pmid:21265900.

49. Zhang XC, Millet YA, Cheng Z, Bush J, Ausubel FM. Jasmonate signalling in involves SGT1b-HSP70-HSP90 chaperone complexes. Nat Plants. 2015;1(5):15049. pmid:27054042; PubMed Central PMCID: PMC4819967.

50. Xu L, Liu F, Lechner E, Genschik P, Crosby WL, Ma H, et al. The SCFCOI1 ubiquitin-ligase complexes are required for jasmonate response in Arabidopsis. Plant Cell. 2002;14(8):1919–35. pmid:12172031

51. del Pozo JC, Estelle M. The Arabidopsis cullin AtCUL1 is modified by the ubiquitin-related protein RUB1. P Natl Acad Sci. 1999;96(26):15342–7. pmid:10611386

52. del Pozo JC, Dharmasiri S, Hellmann H, Walker L, Gray WM, Estelle M. AXR1-ECR1-dependent conjugation of RUB1 to the Arabidopsis Cullin AtCUL1 is required for auxin response. Plant Cell. 2002;14(2):421–33. pmid:11884684

53. Singh RK, Zerath S, Kleifeld O, Scheffner M, Glickman MH, Fushman D. Recognition and cleavage of related to ubiquitin 1 (Rub1) and Rub1-ubiquitin chains by components of the ubiquitin-proteasome system. Mol Cell Proteomics. 2012;11(12):1595–611. pmid:23105008; PubMed Central PMCID: PMC3518131.

54. Robatzek S. Vesicle trafficking in plant immune responses. Cell Microbiol. 2007;9(1):1–8. pmid:17081192.

55. Khaled SB, Postma J, Robatzek S. A moving view: subcellular trafficking processes in pattern recognition receptor-triggered plant immunity. Annu Rev Phytopathol. 2015;53(1):379–402. pmid:26243727

56. Wang WM, Liu PQ, Xu YJ, Xiao S. Protein trafficking during plant innate immunity. J Integr Plant Biol. 2016;58(4):284–98. pmid:26345282.

57. Zorec R. SNARE-mediated vesicle navigation, vesicle anatomy and exocytotic fusion pore. Cell Calcium. 2018;73:53–4. pmid:29880197

58. Poirier MA, Xiao W, Macosko JC, Chan C, Shin YK, Bennett MK. The synaptic SNARE complex is a parallel four-stranded helical bundle. Nat Struct Biol. 1998;5(9):765–9. pmid:9731768

59. Paumet F, Rahimian V, Rothman JE. The specificity of SNARE-dependent fusion is encoded in the SNARE motif. P Natl Acad Sci. 2004;101(10):3376–80. pmid:14981247

60. Chatre L, Brandizzi F, Hocquellet A, Hawes C, Moreau P. Sec22 and Memb11 are v-SNAREs of the anterograde endoplasmic reticulum-Golgi pathway in tobacco leaf epidermal cells. Plant Physiol. 2005;139(3):1244–54. pmid:16244155; PubMed Central PMCID: PMC1283762.

61. Mcmahon HT, Boucrot E. Molecular mechanism and physiological functions of clathrin-mediated endocytosis. Nat Rev Mol Cell Bio. 2011;12(8):517–33. pmid:21779028

62. Song J, Lee MH, Lee GJ, Yoo CM, Hwang I. Arabidopsis EPSIN1 plays an important role in vacuolar trafficking of soluble cargo proteins in plant cells via interactions with clathrin, AP-1, VTI11, and VSR1. Plant Cell. 2006;18(9):2258–74. pmid:16905657

63. Lee GJ, Kim H, Kang H, Jang M, Lee DW, Lee S, et al. EpsinR2 interacts with clathrin, adaptor protein-3, AtVTI12, and phosphatidylinositol-3-phosphate. Implications for EpsinR2 function in protein trafficking in plant cells. Plant Physiol. 2007;143(4):1561–75. pmid:17277094

64. Ishikawa A, Tanaka H, Nakai M, Asahi T. Deletion of a chaperonin 60β gene leads to cell death in the Arabidopsis lesion initiation 1 mutant. Plant Cell Physiol. 2003;44(3):255–61. pmid:12668771

65. Suzuki K, Nakanishi H, Bower J, Yoder DW, Osteryoung KW, Miyagishima S. Plastid chaperonin proteins Cpn60α and Cpn60β are required for plastid division in Arabidopsis thaliana. BMC Plant Biol. 2009;9(1):1–12. pmid:19344532

66. Rak A, Pylypenko O, Durek T, Watzke A, Kushnir S, Brunsveld L, et al. Structure of Rab GDP-dissociation inhibitor in complex with prenylated YPT1 GTPase. Science. 2003;302(5645):646–50. pmid:14576435

67. Yoshida K, Ohnishi M, Fukao Y, Okazaki Y, Fujiwara M, Song C, et al. Studies on vacuolar membrane microdomains isolated from Arabidopsis suspension-cultured cells: local distribution of vacuolar membrane proteins. Plant Cell Physiol. 2013;54(10):1571–84. pmid:23903016.

68. Jubault M, Manzanares-Dauleux MJ. Differential regulation of root arginine catabolism and polyamine metabolism in clubroot-susceptible and partially resistant Arabidopsis genotypes. Plant Physiol. 2008;146(4):2008–19. pmid:18305204

69. Chen H, Mccaig BC, Melotto M, He SY, Howe GA. Regulation of plant arginase by wounding, jasmonate, and the phytotoxin coronatine. J Biol Chem. 2004;279(44):45998–6007. pmid:15322128

70. Brauc S, De Vooght E, Claeys M, Geuns JM, Hofte M, Angenon G. Overexpression of arginase in Arabidopsis thaliana influences defence responses against Botrytis cinerea. Plant Biol (Stuttg). 2012;14 Suppl 1:39–45. pmid:22188168.

71. Xiao S, Chye ML. Overexpression of Arabidopsis ACBP3 enhances NPR1-dependent plant resistance to Pseudomonas syringe pv tomato DC3000. Plant Physiol. 2011;156(4):2069–81. pmid:21670223; PubMed Central PMCID: PMC3149925.

72. Xia Y, Yu K, Gao QM, Wilson EV, Navarre D, Kachroo P, et al. Acyl CoA binding proteins are required for cuticle formation and plant responses to microbes. Front Plant Sci. 2012;3:224. pmid:23060893; PubMed Central PMCID: PMC3465942.

73. Lee MW, Jelenska J, Greenberg JT. Arabidopsis proteins important for modulating defense responses to Pseudomonas syringae that secrete HopW1-1. The Plant journal: for cell and molecular biology. 2008;54(3):452–65. pmid:18266921.

74. Lorenzo GD, D'Ovidio R, Cervone F. The role of polygalacturonase-inhibiting proteins (PGIPs) in defense against pathogenic fungi. Annu Rev Phytopathol. 2001;39(4):313–35. pmid:11701868

75. Alexandersson E, Becker JV, Dan J, Nguema-Ona E, Steyn C, Denby KJ, et al. Constitutive expression of a grapevine polygalacturonase-inhibiting protein affects gene expression and cell wall properties in uninfected tobacco. BMC Research Notes. 2011;4(1):493. pmid:22078230

76. Nguema-Ona E, Moore JP, Fagerström AD, Fangel JU, Willats WG, Hugo A, et al. Overexpression of the grapevine PGIP1 in tobacco results in compositional changes in the leaf arabinoxyloglucan network in the absence of fungal infection. BMC Plant Biol. 2013;13:46. pmid:23506352

77. Spoel SH, Loake GJ. Redox-based protein modifications: the missing link in plant immune signalling. Curr Opin Plant Biol. 2011;14(4):358–64. pmid:21454121.