This work is licensed under http://creativecommons.org/licenses/by/4.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
1. Introduction
Vascular malformations (VM) are benign vascular lesions that are described as structural congenital anomalies [1]. These lesions are always present at birth, but may not be visible until days, weeks, or even years after birth [2]. VM are classified according to the type of involved vessels, such as arterial, venous, lymphatic, capillary malformations, or a combination of different vessels [1–3].
VM result from an error in vascular morphogenesis [4]. They are present at birth and their growth is usually gradual and steady during the first year of life [3]. Their evolutionary peak is generally observed in adolescence or after a traumatic event [5]. Localized facial forms are present essentially on the lips, eyelids, and tongue [5, 6]. The extension of the gingival mucosa can result in bleeding, which can occur spontaneously and/or after certain dental procedures and treatments [7].
Some locations cause, by mass effect, skeletal deformities in the frontoorbital region with enophthalmos and maxillomandibular and dentoalveolar defects, with repercussions on the dental bite and open bite [5, 8]. An important lip deformity tends to make them incompetent. Likewise, giant VM of the tongue can cause permanent changes in normal dental occlusion [7, 8]. Additionally, superficial VM can lead to disfigurement, resulting in an asymmetry hardly supported by patients [9, 10]. This condition is often the cause of low self-esteem and school failure in children and adolescents.
Although the real causes of the development of VM are still poorly understood, previous studies have suggested the involvement of genetic factors in their occurrence [11]. First, the TEK gene (also called TIE-2, tyrosine kinase with immunoglobulin and epidermal growth factor homology domain 2), located at chromosomal region 9p21 and encoding the endothelial-specific receptor tyrosine kinase, has been implicated in Belgian families with a dominant form of the disease [11, 12].
To date, seven missense mutations were identified in these Belgian patients with dominant transmission, including 2545C>T in exon 15, 2690A>G, 2744G>A, 2752C>T, 2755G>T, and 2773G>T in exon 17, and 3300G>C in exon 22 [11, 13, 14]. These mutations lead to an excess of angiopoietin 1 signaling, a ligand for TIE-2 receptor, and consequently to an abnormal proliferation of endothelial cells [11].
The relatively high frequency of VM in Tlemcen region (north-western Algeria) compared to others [15] led us to search in all exons of the TEK gene for either already described mutations or other not yet identified.
2. Materials and Methods
2.1. Patients and Families
A total of ten (10) families, each with a patient with VM (3 men and 7 women), were recruited in Stomatology and Oral Surgery Department of Tlemcen University Medical Centre (Figure 1).
[figures omitted; refer to PDF]
The characteristics of the patients and family members were recorded using a detailed questionnaire. The mean age (± standard error) of the patients at diagnosis was 12 ± 1 years. The recruitment of the patients was carried out on the basis of clinical examination. Such malformations are characterized by a soft, compressible, nonpulsatile tissue mass that does swell in inclined or proclive position [6, 16] (Figure 2).
[figures omitted; refer to PDF]
A magnetic resonance imaging (MRI) was performed in the case of malformations that are simultaneously superficial and deep (Figure 3). The main inclusion criteria were the geographical location of patients exclusively in the region of Tlemcen and inactive malformations. The exclusion criteria were especially arteriovenous malformations. All participants or their parents or guardians have signed an informed consent in accordance with the latest version of the Helsinki Declaration. This study was approved by the Local Ethics Committee and supported by the Hubert Curien Partnership (PHC Tassili, Code 10MDU794).
[figures omitted; refer to PDF]
2.2. Samples
A total of 52 blood samples were collected into EDTA-containing Vacutainer tubes (BD Vacutainer EDTA, USA). VM tissues were taken from one patient after surgery (VMF03.III.2/family VMF03), immediately placed into a sterile collection tube in liquid nitrogen and, then, stored at −80°C in dry ice.
2.3. DNA Analysis
For all samples, DNA was extracted from blood cells using QIAamp DNA Blood Midi Kit Qiagen, as recommended by the manufacturer (Qiagen Valencia, CA, USA). The tissue DNA was isolated using spin columns with the QIAamp DNA Blood Mini Kit Qiagen. The DNA concentration was then measured by spectrophotometer NanoDrop ND-1000 at 260 nm and then at 280 nm (NanoDrop Technologies, Wilmington, DE).
The search for mutations in all the 23 exons as well as in the 5′ and 3′ intronic sequences flanking the exons of the TEK gene was performed by PCR amplification followed by direct sequencing of amplified DNA segments. Such analyses were performed in the Genetics Laboratory of the Medical Unit for Auto-Inflammatory diseases, Hospital Arnaud de Villeneuve, Montpellier, France.
The primer sequences were specifically established to amplify each exon (Table 1), using the Primer3 program [17] (v.0.4.0), referring to the TEK gene sequence (ENSG00000120156) published in Ensembl [18].
Table 1
Primer sequences of all the exons of the TEK gene.
Exon | Amorce sens (5′-3′) | Amorce antisens (5′-3′) | PCR product |
Exon1.1 | AGTCTGAGAAGGATTGGTCATCA | CTGTCTGAGCACAGGGAGTTT | 333 bp |
Exon1.2 | CAGCCCTGCTGATACCAAAT | CACTGATGAGATTTGGGGAGA | 409 bp |
Exon2 | GTTTACCCAATGGGGTCATG | AGCAGCTGCCAAGACAAAAG | 448 bp |
Exon3 | AACGCATTAGCCACCACTGT | ACATCTGCCCACAAGACCA | 360 bp |
Exon4 | CTGAATAGTTCAGCATTTTCATTCT | CAATGCCTGGTTTTTGCTTA | 422 bp |
Exon5 | CTCCTTGTCTTTGTTTCTGTCG | AAATTCTAGATCCAGCAACGATG | 399 bp |
Exon6 | GTTCATCCTACCATGCCACA | TGATTCAAAATCCTGTTGTCCA | 413 bp |
Exon7 | AGTTGGCATGATAGGAGCTCA | GGATGGAAACAAAAGAGGCTT | 453 bp |
Exon8 | TCATCCACATCACAGGTGTCT | GTCAGTTCTGCCTCTCCAGG | 469 bp |
Exon9 | TGGGGTCAATGTTATGGACC | TCCTGGAAATTACCCCAAAG | 335 bp |
Exon10 | ATCACAAAACCTCAAAGCCG | AGCCACCACCTTGAGGTAGA | 331 bp |
Exon11 | TTTCAAAAGCCTAATTTTCCTCA | CACCCATTCAAAAGCGAACT | 462 bp |
Exon12.1 | AGTTGGCATGATAGGAGCTCA | GGATGGAAACAAAAGAGGCTT | 453 bp |
Exon12.2 | TGGGGTCAATGTTATGGACC | TCCTGGAAATTACCCCAAAG | 335 bp |
Exon13 | GCATAATGATCTAGGCCATGG | CCTATAGGGCTGCACGGTAA | 413 bp |
Exon14 | GCTGCTGTTAAGTTCCCATTACA | AAGCCAAAGAGAAGATGAGGC | 397 bp |
Exon15 | GTTCATCCTACCATGCCACA | TGATTCAAAATCCTGTTGTCCA | 413 bp |
Exon16 | TTTGGTTGTATACAGTTGATGGTGA | AGGCAAACCACAGCACAGTC | 404 bp |
Exon17 | GTTTACCCAATGGGGTCATG | AGCAGCTGCCAAGACAAAAG | 448 bp |
Exon18 | TCTTCTGCCAAGATGTGGTG | CAGGGGAGTACCTCGGAAA | 358 bp |
Exon19 | CTACCCAGCAATCATTTGTGG | TGCTAATTTATTTCCTGAGCTTTTT | 310 bp |
Exon20 | GTGCAAGGGCCTATCCTAGG | CCAAGTCACATCTGGTAGAACCA | 304 bp |
Exon21 | ATGTGCAGTGAGTTTGCCAA | CGGCTGACTTTGCTAGAGTC | 338 bp |
Exon22 | GTTTACCCAATGGGGTCATG | AGCAGCTGCCAAGACAAAAG | 448 bp |
Exon23.1 | AGGTGGAATCAAAGCAGCCT | CACGCCTTCCTATGAAGTCC | 414 bp |
Exon23.2 | AATCAGAATGCCTGTTTGTGG | TTCTTAGGCTTGTAAGCAATGAG | 452 bp |
3′UTR region | TCTCAATTTTATCCCTCACCTG | TAAAGTATAATAAGGACATGTGGCA | 472 bp |
bp: base pair.
3′UTR: 3′ untranslated region.
The DNA was amplified in a thermocycler for PCR (Applied Biosystems, Foster, CA), using the primers described in Table 1. The medium of the DNA amplification reaction was composed of 50 ng of DNA, 25 μM of each primer, and 2X Promega PCR Master Mix (Promega). The PCR conditions were as follows: 5 minutes at 95°C followed by 35 cycles of 30 seconds of denaturation at 95°C, primer annealing at 60°C for 30 seconds, and elongation at 72°C followed by one cycle at 72°C for 10 minutes.
After checking the quality and size of the PCR products by agarose gel (1.5%) electrophoresis, a bidirectional sequencing was performed. The amplification products were bidirectionally sequenced with Mix BigDye Terminator kit version 3.1 (ABI). The sequences of the 23 exons and their flanking regions were compared with the TEK gene reference sequence published in Ensembl [18], using the SeqScape v2.5 software (ABI).
3. Results
3.1. Phenotype of Patients
Table 2 shows the clinical data of eleven patients with VM, ten of which had a lip malformation and one had a genio-cervical malformation (one of the eleven patients was not included in the molecular study). Eight patients are female; one of the ten families (VMF04) accounts for two patients with venous malformation (Figure 1).
Table 2
Descriptions of patients with venous malformation.
Family | Patient symbol | Gender | Number of lesions | Location | Other patients in family |
VMF01 | VMF01.II.2 | F | 1 | Lip | No |
VMF02 | VMF02.III.2 | F | 1 | Lip | No |
VMF03 | VMF03.III.2 | F | 1 | Lip | No |
VMF04 | VMF04.III.3 | F | 1 | Lip | Yes |
VMF04 | VMF04.III.9 | F | 1 | Lip | Yes |
VMF05 | VMF05.III.3 | F | 1 | Lip | No |
VMF06 | VMF06.III.1 | M | 1 | Lip | No |
VMF07 | VMF07.III.4 | M | 1 | Genio-cervical | No |
VMF08 | VMF08.III.7 | F | 1 | Lip | No |
VMF09 | VMF09.III.5 | F | 1 | Lip | No |
VMF10 | VMF10.III.2 | M | 1 | Lip | No |
F: female; M: male.
3.2. Molecular Analysis of the TEK Gene
The amplification fragments were obtained for each of the 23 exons of the TEK gene, using DNA from blood samples of ten patients and VM lip tissues from one patient (VMF03.III.2) after surgery. Figure 4 shows the amplification fragments of exon 17 from genomic DNA of the ten patients included in this study and from somatic DNA of patient VMF03.III.2.
[figure omitted; refer to PDF]None of the mutations previously described, including even the mutation of the CGG codon 849 (2545C>T) in exon 15, reported by Wouters et al. [13], in six out of twelve Belgian families with a hereditary form of VM, has been detected after ten blood and one VM tissue DNA analyses of all the 23 exons of the TEK gene (Figure 5).
[figure omitted; refer to PDF]4. Discussion
In this study, we present the results of the TEK gene sequencing in ten unrelated patients from Tlemcen in the north-western region of Algeria with VM.
According to the previous analyses for different mutations in the germline DNA [11, 13, 14], we have to firstly look for these mutations, and, then, we extended analyses to all the 23 exons of the TEK gene. Since no germinal mutation was found in all the samples, we searched for somatic mutations in tissues of a VM biopsy.
The lack of mutation suggests that there is a mutated gene other than TEK or other factors which would be involved and responsible for VM development in our population.
The vascular endothelial cell (EC) specific receptor tyrosine kinase TEK plays a crucial role in angiogenesis and cardiovascular development [19–27]. Its ligands, the angiopoietins (Ang), induce receptor dimerization and phosphorylation [28], with Ang-1 acting as an agonist and Ang-2 as context-dependent antagonist or weak agonist [29, 30].
Other mutation players within the TEK pathway, especially those proximal to the receptor, could also be expected to yield similar, specific phenotypes. These include TIE-1, which can heterodimerise with TEK [31, 32]; the Ang ligands [29–35]; and the vascular endothelial protein tyrosine phosphatase (VE-PTP), which can specifically regulate TEK activation [36, 37].
Ang-1 stimulation of TEK has recently been found to induce the expression of Apelin, a ligand for the G-protein-coupled receptor (GPCR, also known as the APJ receptor), in ECs. This system in turn regulates the caliber of blood vessels [38] making it an attractive, as yet untested, candidate pathway through which the dilated channels in VM may occur.
Venous anomalies represent a significant fraction of patients seen at centers specialized in treating VM, as they can cause pain and affect appearance or organ function, due to their size, localization, and expansion.
The majority of VM are sporadic in nature and characterized by extensive, unifocal lesions of variable size, which can infiltrate deep into underlying tissues.
The search for mutations in other candidate genes (ANG1, ANG2, TIE1, VE-PTP [vascular endothelial protein tyrosine phosphatase] and the APLN genes) in the DNA from biopsies is the next step. If this proves unsuccessful, it will be necessary to achieve exome sequencing analysis, or whole genome sequencing, and to compare the sequences with those of exons and the entire genome of germline DNA from leukocytes of corresponding patient.
5. Conclusions
The absence of mutation in the TEK gene in the population studied suggests that the TEK gene is not necessarily and not the sole gene involved in the onset of VM. It will be interesting to search on other mutated gene(s) responsible for the development of these malformations on much more patients. The exome sequencing should greatly help to unmask the other involved gene(s), which will be validated only after a study of random samples of the Tlemcen population, in order to ensure that it is not a neutral polymorphism, and that the mutation(s) is or are not found in healthy subjects. If so, the knowledge of the molecular and cellular dysfunctions in the signaling pathway that occur in the formation of the vascular network in endothelial cells will be greatly improved. Consequently, better therapeutic approaches to treat the abnormal angiogenesis of these patients could be developed.
Conflict of Interests
The authors declare that they have no competing interests.
[1] R. G. Elluru, "Cutaneous vascular lesions," Facial Plastic Surgery Clinics of North America, vol. 21 no. 1, pp. 111-126, DOI: 10.1016/j.fsc.2012.11.001, 2013.
[2] O. Enjolras, "Hemangiomes," Atlas des Hémangiomes et Malformations Vasculaires Superficielles, pp. 17-54, 1990.
[3] F. Lemarchand-Venencien, "Classification of angiomas: hemangiomas and superficial vascular malformations," Revue du Praticien, vol. 42 no. 16, pp. 1998-2004, 1992.
[4] D. A. Marchuk, S. Srinivasan, T. L. Squire, J. S. Zawistowski, "Vascular morphogenesis: tales of two syndromes," Human Molecular Genetics, vol. 12 no. 1, pp. R97-R112, 2003.
[5] J. Murthy, "Vascular anomalies," Indian Journal of Plastic Surgery, vol. 38 no. 1, pp. 56-62, 2005.
[6] G. T. Richter, A. B. Friedman, "Hemangiomas and vascular malformations: current theory and management," International Journal of Pediatrics, vol. 2012,DOI: 10.1155/2012/645678, 2012.
[7] A. Di Giovanni, L. Revelli, "Venous angiodysplasias with endoral manifestation. The problems of therapy," Minerva stomatologica, vol. 45 no. 3, pp. 113-119, 1996.
[8] L. B. Kaban, J. B. Mulliken, "Vascular anomalies of the maxillofacial region," Journal of Oral and Maxillofacial Surgery, vol. 44 no. 3, pp. 203-213, 1986.
[9] J. A. Werner, A. A. Dünne, B. J. Folz, R. Rochels, S. Bien, A. Ramaswamy, B. M. Lippert, "Current concepts in the classification, diagnosis and treatment of hemangiomas and vascular malformations of the head and neck," European Archives of Oto-Rhino-Laryngology, vol. 258 no. 3, pp. 141-149, DOI: 10.1007/s004050100318, 2001.
[10] D. Herbreteau, O. Enjolras, M. C. Riché, "Superficial venous malformations," Revue du Praticien, vol. 42 no. 16, pp. 2025-2030, 1992.
[11] M. Vikkula, L. M. Boon, K. L. Carraway, J. T. Calvert, A. J. Diamonti, B. Goumnerov, K. A. Pasyk, D. A. Marchuk, M. L. Warman, L. C. Cantley, J. B. Mulliken, B. R. Olsen, "Vascular dysmorphogenesis caused by an activating mutation in the receptor tyrosine kinase TIE2," Cell, vol. 87 no. 7, pp. 1181-1190, DOI: 10.1016/S0092-8674(00)81814-0, 1996.
[12] L. M. Boon, J. B. Mulliken, M. Vikkula, H. Watkins, J. Seidman, B. R. Olsen, M. L. Warman, "Assignment of a locus for dominantly inherited venous malformations to chromosome 9p," Human Molecular Genetics, vol. 3 no. 9, pp. 1583-1587, 1994.
[13] V. Wouters, N. Limaye, M. Uebelhoer, A. Irrthum, L. M. Boon, J. B. Mulliken, O. Enjolras, E. Baselga, J. Berg, A. Dompmartin, S. A. Ivarsson, L. Kangesu, Y. Lacassie, J. Murphy, A. S. Teebi, A. Penington, P. Rieu, M. Vikkula, "Hereditary cutaneomucosal venous malformations are caused by TIE2 mutations with widely variable hyper-phosphorylating effects," European Journal of Human Genetics, vol. 18 no. 4, pp. 414-420, DOI: 10.1038/ejhg.2009.193, 2010.
[14] N. Limaye, L. M. Boon, M. Vikkula, "From germline towards somatic mutations in the pathophysiology of vascular anomalies," Human Molecular Genetics, vol. 18 no. 1, pp. R65-R74, DOI: 10.1093/hmg/ddp002, 2009.
[15] B. Sari, M. Aribi, B. Saari, "Effect of endogamy and consanguinity on the development of labial venous malformations in area of Tlemcen (West Algeria)," The Open Genomics Journal, vol. 1,DOI: 10.2174/1875693X00801010001, 2008.
[16] O. Enjolras, M. C. Riche, J. J. Merland, "Superficial arterial and venous malformations: clinical features and complementary investigations," Annales de Chirurgie Plastique et Esthetique, vol. 36 no. 4, pp. 271-278, 1991.
[17] S. Rozen, H. Skaletsky, "Primer3 on the WWW for general users and for biologist programmers," Methods in Molecular Biology, vol. 132, pp. 365-386, 2000.
[18] T. Hubbard, D. Barker, E. Birney, G. Cameron, Y. Chen, L. Clark, T. Cox, J. Cuff, V. Curwen, T. Down, R. Durbin, E. Eyras, J. Gilbert, M. Hammond, L. Huminiecki, A. Kasprzyk, H. Lehvaslaiho, P. Lijnzaad, C. Melsopp, E. Mongin, R. Pettett, M. Pocock, S. Potter, A. Rust, E. Schmidt, S. Searle, G. Slater, J. Smith, W. Spooner, A. Stabenau, J. Stalker, E. Stupka, A. Ureta-Vidal, I. Vastrik, M. Clamp, "The Ensembl genome database project," Nucleic Acids Research, vol. 30 no. 1, pp. 38-41, 2002.
[19] D. J. Dumont, T. P. Yamaguchi, R. A. Conlon, J. Rossant, M. L. Breitman, "Tek, a novel tyrosine kinase gene located on mouse chromosome 4, is expressed in endothelial cells and their presumptive precursors," Oncogene, vol. 7 no. 8, pp. 1471-1480, 1992.
[20] H. Schnurch, W. Risau, "Expression of tie-2, a member of a novel family of receptor tyrosine kinases, in the endothelial cell lineage," Development, vol. 119 no. 3, pp. 957-968, 1993.
[21] T. N. Sato, Y. Qin, C. A. Kozak, K. L. Audus, "Tie-1 and tie-2 define another class of putative receptor tyrosine kinase genes expressed in early embryonic vascular system," Proceedings of the National Academy of Sciences of the United States of America, vol. 90 no. 24, pp. 9355-9358, 1993.
[22] D. J. Dumont, G. Gradwohl, G. H. Fong, M. C. Puri, M. Gertsenstein, A. Auerbach, M. L. Breitman, "Dominant-negative and targeted null mutations in the endothelial receptor tyrosine kinase, tek, reveal a critical role in vasculogenesis of the embryo," Genes and Development, vol. 8 no. 16, pp. 1897-1909, 1994.
[23] D. J. Dumont, G. H. Fong, M. C. Puri, G. Gradwohl, K. Alitalo, M. L. Breitman, "Vascularization of the mouse embryo: a study of flk-1, tek, tie, and vascular endothelial growth factor expression during development," Developmental Dynamics, vol. 203 no. 1, pp. 80-92, 1995.
[24] T. N. Sato, Y. Tozawa, U. Deutsch, K. Wolburg-Buchholz, Y. Fujiwara, M. Gendron-Maguire, T. Gridley, H. Wolburg, W. Risau, Y. Qin, "Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation," Nature, vol. 376 no. 6535, pp. 70-74, 1995.
[25] C. Suri, P. F. Jones, S. Patan, S. Bartunkova, P. C. Maisonpierre, S. Davis, T. N. Sato, G. D. Yancopoulos, "Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis," Cell, vol. 87 no. 7, pp. 1171-1180, DOI: 10.1016/S0092-8674(00)81813-9, 1996.
[26] J. Partanen, D. J. Dumont, "Functions of Tie1 and Tie2 receptor tyrosine kinases in vascular development," Current Topics in Microbiology and Immunology, vol. 237, pp. 159-172, 1999.
[27] N. Jones, K. Iljin, D. J. Dumont, K. Alitalo, "Tie receptors: new modulators of angiogenic and lymphangiogenic responses," Nature Reviews Molecular Cell Biology, vol. 2 no. 4, pp. 257-267, DOI: 10.1038/35067005, 2001.
[28] L. Eklund, B. R. Olsen, "Tie receptors and their angiopoietin ligands are context-dependent regulators of vascular remodeling," Experimental Cell Research, vol. 312 no. 5, pp. 630-641, DOI: 10.1016/j.yexcr.2005.09.002, 2006.
[29] P. C. Maisonpierre, C. Suri, P. F. Jones, S. Bartunkova, S. J. Wiegand, C. Radziejewski, D. Compton, J. McClain, T. H. Aldrich, N. Papadopoulos, T. J. Daly, S. Davis, T. N. Sato, G. D. Yancopoulos, "Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis," Science, vol. 277 no. 5322, pp. 55-60, DOI: 10.1126/science.277.5322.55, 1997.
[30] S. Loughna, T. N. Sato, "Angiopoietin and Tie signaling pathways in vascular development," Matrix Biology, vol. 20 no. 5-6, pp. 319-325, DOI: 10.1016/S0945-053X(01)00149-4, 2001.
[31] P. Saharinen, K. Kerkelä, N. Ekman, M. Marron, N. Brindle, G. M. Lee, H. Augustin, G. Y. Koh, K. Alitalo, "Multiple angiopoietin recombinant proteins activate the Tie1 receptor tyrosine kinase and promote its interaction with Tie2," Journal of Cell Biology, vol. 169 no. 2, pp. 239-243, DOI: 10.1083/jcb.200411105, 2005.
[32] H. T. Yuan, S. Venkatesha, B. Chan, U. Deutsch, T. Mammoto, V. P. Sukhatme, A. S. Woolf, S. A. Karumanchi, "Activation of the orphan endothelial receptor Tie1 modifies Tie2-mediated intracellular signaling and cell survival," FASEB Journal, vol. 21 no. 12, pp. 3171-3183, DOI: 10.1096/fj.07-8487com, 2007.
[33] D. M. Valenzuela, J. A. Griffiths, J. Rojas, T. H. Aldrich, P. F. Jones, H. Zhou, J. Mcclain, N. G. Copeland, D. J. Gilbert, N. A. Jenkins, T. Huang, N. Papadopoulos, P. C. Maisonpierre, S. Davis, G. D. Yancopoulos, "Angiopoietins 3 and 4: diverging gene counterparts in mice and humans," Proceedings of the National Academy of Sciences of the United States of America, vol. 96 no. 5, pp. 1904-1909, DOI: 10.1073/pnas.96.5.1904, 1999.
[34] I. Cascone, L. Napione, F. Maniero, G. Serini, F. Bussolino, "Stable interaction between α 5 β 1 integrin and Tie2 tyrosine kinase receptor regulates endothelial cell response to Ang-1," Journal of Cell Biology, vol. 170 no. 6, pp. 993-1004, DOI: 10.1083/jcb.200507082, 2005.
[35] K. L. Kim, I. S. Shin, J. M. Kim, J. H. Choi, J. Byun, E. S. Jeon, W. Suh, D. K. Kim, "Interaction between Tie receptors modulates angiogenic activity of angiopoietin2 in endothelial progenitor cells," Cardiovascular Research, vol. 72 no. 3, pp. 394-402, DOI: 10.1016/j.cardiores.2006.08.002, 2006.
[36] G. Fachinger, U. Deutsch, W. Risau, "Functional interaction of vascular endothelial-protein-tyrosine phosphatase with the Angiopoietin receptor Tie-2," Oncogene, vol. 18 no. 43, pp. 5948-5953, DOI: 10.1038/sj.onc.1202992, 1999.
[37] M. G. Dominguez, V. C. Hughes, L. Pan, M. Simmons, C. Daly, K. Anderson, I. Noguera-Troise, A. J. Murphy, D. M. Valenzuela, S. Davis, G. Thurston, G. D. Yancopoulos, N. W. Gale, "Vascular endothelial tyrosine phosphatase (VE-PTP)-null mice undergo vasculogenesis but die embyronically because of defects in angiogenesis," Proceedings of the National Academy of Sciences of the United States of America, vol. 104 no. 9, pp. 3243-3248, DOI: 10.1073/pnas.0611510104, 2007.
[38] H. Kidoya, M. Ueno, Y. Yamada, N. Mochizuki, M. Nakata, T. Yano, R. Fujii, N. Takakura, "Spatial and temporal role of the apelin/APJ system in the caliber size regulation of blood vessels during angiogenesis," EMBO Journal, vol. 27 no. 3, pp. 522-534, DOI: 10.1038/sj.emboj.7601982, 2008.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright © 2013 Nabila Brahami et al. This work is licensed under http://creativecommons.org/licenses/by/4.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Background. Venous malformations (VM) result from an error in vascular morphogenesis. The first gene suspected in their development is the TEK gene (tyrosine kinase, endothelial). Mutations of this gene have been identified in several Belgian families with a dominant form of the disease. Therefore, we investigated whether mutations in this TEK gene could explain the MV development in patients of families from Tlemcen region (north-western Algeria). Methods. Genomic DNA was extracted from leucocytes of ten patients. The search for mutations in all the 23 exons and in the 5′ and 3′ intronic sequences flanking the TEK gene was performed using PCR amplification and direct sequencing of amplified genomic DNA. Additionally, a search for somatic mutations of the gene TEK was performed on a biopsy of the venous malformation from one of the ten eligible patients. Results. The sequencing of the 23 exons of the TEK gene revealed neither germinal mutation in our ten patients nor somatic mutation in the tissue of the biopsy. Conclusion. The absence of mutation in the TEK gene in the population studied suggests that the TEK gene is not necessarily involved in the onset of VM; its association with these malformations may differ from one population to another.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details


1 Laboratory of Applied Molecular Biology and Immunology, University of Tlemcen, 13000 Tlemcen, Algeria
2 Laboratory of Applied Molecular Biology and Immunology, University of Tlemcen, 13000 Tlemcen, Algeria; Service de Stomatologie et de Chirurgie Buccale du Centre Hospitalier et Universitaire de Tlemcen, 13000 Tlemcen, Algeria
3 Génétique Médicale, Laboratoire de Cytologie Clinique et Cytogénétique, CHU de Nîmes, Place du Professeur Robert Debré, 30029 Nimes Cedex 9, France
4 Unité Médicale des Maladies Auto-Inflammatoires, Département de Génétique, CHRU, Montpellier, 34961 Montpellier Cedex 2, France; Université Montpellier 1, 34961 Montpellier Cedex 2, France; Génétique des Maladies Auto-Inflammatoires et des Ostéo-Arthropathies Chroniques, INSERM U844, 34091 Montpellier Cedex 5, France
5 Laboratoire d’Immunogénétique Moléculaire, Institut de Génétique Humaine, CNRS UPR 1142, et Université Montpellier 2, 34095 Montpellier Cedex 5, France
6 Unité Médicale des Maladies Auto-Inflammatoires, Département de Génétique, CHRU, Montpellier, 34961 Montpellier Cedex 2, France