1. Introduction
Clostridium perfringens, a spore-forming, Gram-positive, rod-shaped, anaerobic bacterium, may induce gastroenteritis with diarrhea and abdominal pain. Categorizing C. perfringens is based on toxin production (alpha, beta, epsilon, and iota toxins) divided into types A–E [1]. Recently, the new categorization of C. perfringens that produces alpha toxin and C. perfringens enterotoxin (CPE) is type F, and strains that possess alpha and NetB toxins are now categorized as type G [1]. CPE is mainly responsible for gastrointestinal symptoms, and importantly, in Japan, an average of 20–40 C. perfringens-associated foodborne outbreaks (involving up to 3000 victims) were recognized each year, which is the second leading cause of bacterial food poisoning in the country [2]. Clostridium perfringens producing CPE and/or CPE in feces from patients has been found in outbreaks [3,4,5]. CPE-producing C. perfringens causes both foodborne outbreaks and non-foodborne diarrhea [6,7,8] and was isolated from healthy humans, animals with enteric diseases, retail foods, and environmental samples [9,10,11,12,13,14,15,16,17,18,19,20,21].
Clostridium perfringens is an effective human sewage indicator because of its direct link and environmental stability [22,23]. Additionally, type F C. perfringens was reported as an essential indicator of human fecal pollution in aquatic environments because most of the isolates were not observed in livestock-related samples including animal feces and wastewater of a pig farm and an abattoir but observed in human feces and sewage influents and effluents [18]. Various studies have shown that shellfishes were contaminated with viral pathogens and induced gastroenteritis [24,25,26,27,28] due to the greater concentrations of pathogen accumulation in sewage than those of the water surrounding them [29,30,31,32,33]. Therefore, type F C. perfringens discharged in sewage effluents should contaminate seawater and may be accumulated by shellfishes. If this is true, the impact of shellfishes on type F C. perfringens infection to humans and infected humans on the water environment are critical; however, these are not well known.
This study estimated the importance of Ruditapes philippinarum (asari clams) as an infection source and humans as a pollution source of type F C. perfringens by comparing the characteristics among the isolates from influents and effluents of two wastewater treatment plants (WWTPs), asari clams bought in the same study areas and humans. 2. Results 2.1. Distribution of Type F C. perfringens
Using conventional PCR in this study, the isolation rates of cpe-positive C. perfringens from sewage influent, effluent, and asari clams including shells were 80% (69/86), 56% (20/36), and 9% (7/76), and 131, 37, and 28 isolates were obtained, respectively (Figure 1). Among the isolates from foodborne cases, 73% (8/11) were typable serotypes, whereas 98% (128/131), 100% (37/37), 100% (28/28), and 85% (22/26) of the isolates from influents, effluents, asari clams, and non-foodborne cases were untypable, respectively (Figure 2). All isolates such as 37 human isolates were categorized as C. perfringens type F, which is positive for C. perfringens alpha toxin gene and cpe. Additionally, 94% (123/131), 57% (21/37), 96% (27/28), and 81% (21/26) of the isolates from influents, effluents, asari clams, and non-foodborne cases, respectively, were positive for C. perfringens beta2 toxin gene (cpb2). Conversely, only one (9%) isolate from a foodborne case had cpb2 (Figure 3). The ratio(s) of the isolates with a chromosomal cpe among those from foodborne cases was 73% (8/11), while those with a plasmid IS1151 sequence downstream of cpe among those from influents, effluents, asari clams, and non-foodborne cases were 94% (123/131), 54% (20/37), 100% (28/28), and 62% (16/26), respectively (Figure 4). The ratio of the isolates with a plasmid IS1151-cpe among the isolates from influents was significantly higher than those from effluents (p < 0.01). In total, the ratio of the isolates with cpb2 among the isolates with a plasmid IS1151-cpe (96%) was significantly higher than those with a chromosomal cpe (14%) (p < 0.01). The isolates with a plasmid IS1470-like sequence downstream of cpe were detected from all sources but asari clams. Table 1 and Table 2 show the number of isolates and isolation period from influents and effluents, respectively. No seasonal trend for the isolation from each kind of sample was observed and no significant difference between WWTP-A and WWTP-B for the isolation was also observed.
2.2. Characterization of Type F C. perfringens by Multilocus Sequence Typing (MLST)
The genetic comparison of the isolates by MLST assessing eight housekeeping genes has shown that C. perfringens with a plasmid IS1151-cpe or a plasmid IS1470-like-cpe were divided into two clusters, regardless of their sources, a cluster only comprising isolates with a IS1470-like-cpe and a cluster mainly comprising those with a plasmid IS1151-cpe, both of which were different from strains with a chromosomal cpe. In a cluster that principally comprises the isolates with a plasmid IS1151-cpe, isolates from a human, four sewage influents, two effluents, and four asari clams have a completely conserved sequence of eight genes identified as the asari clam clone. The ratios of asari clam clone were 40% (4/10), 50% (2/4), and 57% (4/7) among the tested isolates with a plasmid IS1151-cpe from influents, effluents, and asari clams, respectively. Strain T1 isolated from a foodborne case described by Tanaka et al. [34] was also categorized as an asari clam clone but strains TM111C1 and TM178 isolated from retail meats in Japan [15] were not classified (Figure 5). These clones were isolated from July to December 2016 or from February to December 2019.
3. Discussion This study has shown the characteristics of type F C. perfringens isolated from sewage influents, effluents, asari clams, and humans to check whether they are predominant from those of humans and environments in the study area. Additionally, we have shown the genetic relationship of the isolates to show their behavior in the water environment, as well as the isolation rate of the isolates in asari clams to consider them as an infection source for healthy humans and foodborne cases.
We explored the characteristics of the isolates from influents, effluents, asari clams, and humans to understand the behavior of type F C. perfringens due to four reasons. First, asari clams can probably show an infection source of type F C. perfringens for humans because of the accumulation of pathogens in the water environment [29,30,31,32,33]. Second, it is impossible to know the prevalence of type F C. perfringens isolated from clinical and nonclinical cases using the present passive surveillance system because this surveillance system hardly reports nonclinical cases to public health officials [35]. Third, the characteristics of Salmonella enterica isolated from sewage influents and humans were closely associated with each other, indicating that isolates from unreported cases were obtained from influents in our previous study [36]. Finally, the isolates from humans infected by asari clams may become a pollution source of water environment via sewage influents and effluents when the impact of asari clams on human infection is significant. The isolation rates of type F C. perfringens were 80%, 56%, and 9% from influents, effluents, and asari clams, respectively, which were higher than the previous report of 29% and 32% from influents and effluents, respectively [18]. The differences in isolation rates may be because of the difference in the amount of samples to be cultured in an enrichment broth and that in the geographical circumstances.
The results of serotyping, toxin genotyping, and cpe genotyping assay indicated a different distribution between sewage influents, effluents, humans in non-foodborne cases, and asari clams and humans in foodborne cases. The isolate with an untypable serotype, positive for cpb2, a plasmid IS1151-cpe, was predominant in the isolates from influents, effluents, humans in non-foodborne cases, and asari clams, while that with a typable serotype, negative for cpb2, and a chromosomal cpe was predominant in the isolates from humans in foodborne cases. Most of the type F C. perfringens isolated from influents are probably not from foodborne cases but from non-foodborne cases, such as healthy humans, as observed in our results and in the following three facts. First, several reports have shown that the frequency of type F C. perfringens among healthy humans was 6–31% [9,10,11,12]. Second, the predominant cpe locus of the isolates from healthy humans and sporadic diarrhea cases in Japan was a plasmid with a IS1151 sequence [37,38]. Finally, type F C. perfringens was isolated from few human-unrelated samples [18]. These results showed that the isolates from sewage influents have a great association with those from healthy humans. Deguchi et al. have shown that 11 strains with a chromosomal cpe, which were all tested in their study, were negative for cpb2, whereas some of those with a plasmid cpe were positive [39]. Our results show that the ratio of the isolates with cpb2 among the isolates with a plasmid IS1151-cpe was significantly higher than that with a chromosomal cpe and the study by Deguchi et al. [39] demonstrated that the possession of cpb2 is associated with the locus of cpe.
Analysis by MLST indicated that the isolates with plasmid IS1151-cpe from a human, four influents, two effluents, and four asari clams were categorized as an identical clone identified as the asari clam clone, which was clearly different from strains with chromosomal cpe and plasmid IS1470-like-cpe isolated from meats. In addition, this result agrees with studies that have shown that strains with chromosomal cpe belonged to a single distinct cluster [39,40] and exhibited different genetic characteristics from those with plasmidal cpe revealed by analysis based on whole genome sequencing [41,42]. Additionally, the asari clam clone was predominant among the isolates from influents (40%), suggesting that the asari clam clone is also predominant among unreported human isolates, effluents (50%), and asari clams (57%) with plasmid IS1151-cpe tested in this study. These results suggested that asari clams have an important impact on infection of type F C. perfringens to humans and that the asari clam clones pollute the water environment and are widely distributed among humans and water environment through asari clams. Although type F C. perfringens may be circulating among humans, water environment, and bivalves, it is difficult to experimentally validate this hypothesis, lacking the result of human isolates in Aichi or Kumamoto. Additionally, performing whole genome sequencing would need to prove this hypothesis as a method for genetic comparison.
The frequency of type F C. perfringens isolation among healthy humans (6–31%) [9,10,11,12] is much higher than that of Salmonella spp. (0.013%) [43], enterohemorrhagic Escherichia coli (EHEC) (0.2%) [44], and Campylobacter spp. (1%) [45], which are the principal pathogens of gastroenteritis in Japan [2]. This means that type F C. perfringens is more often detected from infection sources such as foods and/or environments. The isolation rate of type F C. perfringens vegetative cells and spores from investigated foods, principally meat products (0–5%) [11,14,15,16,46,47,48], was lower than that of Salmonella (8–10%), EHEC (16.6%), and Campylobacter (21–27%) from foods [49,50,51,52]. However, the actual infection risks of type F C. perfringens infection from foods would be higher since most of these contaminated foods are heated well before eating them, so bacteria in foods would be killed excluding type F C. perfringens spores, which are heat resistant. In our study, the isolation rate of type F C. perfringens from asari clams heated at 80 °C for 10 min was 9%, which is the same with the results of previous studies showing isolation rates of 8% and 12%, respectively, in scallops and oysters [16,19]. Zhang et al. [53] described that C. perfringens in beach sand showed a slower decay than that in seawater, supporting our results that showed a high isolation rate of asari clams in beach sand, while those of benthic crabs in a sewage-polluted estuary and fish were 1% and 1.4%, respectively [54,55]. These results suggested that the isolation rate of type F C. perfringens spores from bivalves is higher than those from other foods, primarily meat products. Additionally, probably the high detection frequency of type F C. perfringens from healthy humans is partially because of bivalves such as asari clams since our MLST result has shown that the sequences of the isolates from a human and asari clams were linked to each other, but those from retail meats were clearly different. The MLST result of Matsuda et al. has shown that some of the isolates from humans were ST41 [38] by Xiao’s scheme [40], which is the same as the asari clam clone.
Foodborne outbreaks due to C. perfringens are principally responsible for those with a chromosomal cpe since they have spores that are resistant to heat (100 °C for 10 min), cold, osmotic stress, and nitrites, whereas those spores with a plasmid cpe are relatively sensitive to these [34,56,57,58,59,60]. In our study, there was no isolate with a chromosomal cpe from asari clams, in which the isolates with a plasmid IS1151-cpe were identified. Regardless of this, here, we believe that type F C. perfringens in bivalves such as asari clams induce both asymptomatic carriers and foodborne outbreaks because of the following three reasons. First, several reports have argued that foodborne outbreaks are caused or associated by heat-sensitive C. perfringens with a plasmid IS1151-cpe or IS1470-like-cpe [11,34,57,60,61], one of which includes strain T1 observed to belong to asari clam clones in our study. Additionally, Kiu et al. have reported that C. perfringens strains with a plasmid IS1151-cpe or IS1470-like-cpe were predominantly associated with food poisoning cases [41]. Moreover, Grant et al. suggested that the isolate with a plasmid cpe formed spores with high resistance to heating at 95 °C for 30 min [62]. Second, the isolates with a chromosomal cpe were recognized from effluents, meaning there may be an accumulation of those by bivalves. Finally, there may be some foods that are heated below 100 °C for 10 min in accordance with the fact that the heating condition at 80 °C for 10 min, at which the spores of the isolates with a plasmid cpe can survive, could open all asari clams in our study. Thus, the foods including bivalves, such as clam chowder or seafood curry, can cause food poisoning by type F C. perfringens unless the foods are served right after cooking since the requirement for food to still be consumed without reaching a toxin level is less than 105 organisms/g [63].
The ratio of the isolates with a plasmid IS1151-cpe among the isolates from influents was 94%, which was significantly higher than that from effluents (54%) in which the relatively high proportion of the isolates with chromosomal cpe (24%) was observed. The proportional modification of F-specific RNA coliphage genogroups via a wastewater treatment process was described previously [64]. Similarly, it is plausible that the different behaviors of the isolates through a wastewater treatment process depend on their locus of cpe or other factors. Considering spore formation, the isolates with a chromosomal cpe are more resistant to some kinds of stresses than those with a plasmid cpe and other C. perfringens [34,57,58,59,60,61], raising the possibility that the isolates with a chromosomal cpe are resistant to some stress in WWTPs, which needs further studies to be experimentally proven.
4. Materials and Methods 4.1. Sample Collection Sewage influent and effluent samples were collected from two WWTPs (WWTP-A and WWTP-B) located in Yamanashi, Japan, monthly for 43 months between July 2016 and January 2020 and for 18 months between August 2018 and January 2020, respectively. These WWTPs serve a population of ~350,000 and treat a total of ~180,000 m3/day of wastewater. All samples were collected in normal weather and stored at 4 °C after sampling and tested within 24 h. Seventy-six packs of asari clams collected in Aichi or Kumamoto, central and southern parts of Japan, ~100 and ~750 km apart from estuary downstream of the effluents, respectively, were bought from supermarkets in Yamanashi between June 2019 and January 2020. 4.2. Isolation of Clostridium Perfringens
Four hundred milliliters of each sewage sample was centrifuged at 21,000× g for 25 min to obtain 2-mL suspensions. Subsequently, 0.1 mL of each suspension and 10 asari clams from each pack were added to 10 and 250 mL of thioglycolate broth (Nissui Pharmaceutical, Tokyo, Japan), respectively, followed by heating at 80 °C for 10 min and incubation at 35 °C for 20–24 h. Asari clams with shells were examined in this study because they are usually cooked in foods together, such as miso soup in Japan. The culture was inoculated onto CW agar plates (Nissui Pharmaceutical) that contained 50% egg yolk-enriched saline (Kyokuto Tokyo, Japan) and then incubated under anaerobic conditions at 35 °C for 20–24 h. Ten suspected colonies showing lecithinase production and lactose fermentation were isolated and suspended in sterilized distilled water, and DNA was extracted by heating at 100 °C for 10 min. The detection of cpe of the isolates was performed by conventional PCR using Thermal Cycler Dice Touch TP350 (Takara Bio). The amplification of cpe was performed with a primer pair as listed in Table 3. Each 25-μL reaction mixture contained 2.5 μL of template DNA, 12.5 μL of 2× Multiplex PCR Buffer, 0.125 μL of 2× Multiplex PCR Enzyme Mix (Takara Bio), and 2 μL each of 2.5-pmol/μL forward and reverse primers. PCR was performed under the following conditions: Initial denaturation at 94 °C for 1 min, followed by 35 cycles at 94 °C for 5 s, and 64 °C for 45 s. PCR products were electrophoresed on a 2.5% agarose gel with ethidium bromide, and the isolates with PCR products of 383 bp were found to be cpe-positive C. perfringens.
4.3. Human Isolates Eleven isolates from human feces in foodborne cases and 26 isolates from those in non-foodborne cases in Yamanashi, which were obtained from administrative inspections by the Yamanashi Institute of Public Health and Environment between 2012 and 2019, were used. One isolate was used from each case. 4.4. Characterization of the Isolates
C. perfringens isolates with cpe were distinguished by serotyping, cpe genotyping assay, and toxin genotyping. Serotyping was performed using commercial Clostridium perfringens type A antisera set (Denka Seiken, Tokyo, Japan), and cpe genotyping assay was performed using the multiplex PCR described by Miyamoto et al. [65] to know the locus of cpe, including chromosomal cpe and plasmid cpe (IS1151 or IS1470-like sequence downstream of cpe). Toxin genotyping was performed using the multiplex PCR described by van Asten et al. [66].
4.5. Statistical Analysis Differences between the rate of C. perfringens isolates with cpb2 among the isolates with a plasmid IS1151-cpe and those with a chromosomal cpe and the rate of C. perfringens isolates with a plasmid IS1151-cpe from influents and those from effluents was compared using the chi-square test. Moreover, p < 0.01 was considered statistically significant. 4.6. MLST Analysis
The representative 36 isolates listed in Table 4 were assessed using the MLST comparing sequence of concatenated eight housekeeping genes, such as plc, colA (toxin genes), nadA, pgk (putative metabolic genes), sodA, groEL (stress response gene), sigK (sigma factor involved in sporulation), and gyrB (DNA replication gene) to reveal the relationship among the isolates [39]. Additionally, sequence data of these genes obtained from GenBank (accession numbers AB477535, AB477536, AB477540–AB477542, AB477558, AB477568, AB477575, AB477579, AB477582, AB477585, AB477586, AB477588–AB477590, AB477594–AB477596, AB477612, AB477622, AB477629, AB477633, AB477636, AB477639, AB477640, AB477642–AB477644, AB477648–AB477650, AB477666, AB477676, AB477683, AB477687, AB477690, AB477693, AB477694, AB477696–AB477698, AB477702–AB477704, AB477720, AB477730, AB477737, AB477741, AB477744, AB477747, AB477748, AB477750–AB477752, AB477756–AB477758, AB477774, AB477784, AB477791, AB477795, AB477798, AB477801, AB477802, AB477804–AB477806, AB477810–AB477812, AB477828, AB4778838, AB477845, AB477849, AB477852, AB477855, AB477856, AB477858–AB477860, AB477864–AB477866, AB477882, AB477892, AB477899, AB477903, AB477906, AB477909, AB477910, AB477912–AB477914, AB477918–AB477920, AB477936, AB477946, AB477953, AB477957, AB477960, AB477963, AB477964, and AB477966for strains ATCC3624, ATCC13124, F4013, F4969, F5603, MR2-4, NCTC8239, OSAKA1, T1, TM111C1 TM178, W4232, and W6205) were also assessed. Sequence data were analyzed with the Clustal W format using a genetic information processing software (GENETYX Ver. 13, GENETYX, Tokyo, Japan).
4.7. Nucleotide Sequence Accession Numbers The sequence data obtained in this study were deposited in the DNA Data Bank of Japan with accession numbers LC548776 to LC549063. 5. Conclusions In conclusion, our results suggest that asari clams are an important infection source of type F C. perfringens to cause asymptomatic carriers and foodborne diseases. In addition, the isolates from humans infected by asari clams should become a pollution source of water environment through sewage influents and effluents and be widely distributed among the human and water environment. Sewage samples would provide several hygiene information about not only a specific human but also all the humans in the area, contributing to the understanding of what kinds of enteric pathogens spread in the community and investigating whether suspicious foods are infection sources. When the dynamics of pathogens are explored, it would be efficient to assess the isolates from sewage, reflecting the trend of those from the community.
Enlarge this image.Figure 1. PCR assay identifying cpe gene of C. perfringens isolates using 2.5% agarose gel electrophoresis. M: 100 bp DNA Ladder (Takara Bio, Kusatsu, Japan); 1: cpe-positive C. perfringens; 2: cpe-negative C. perfringens.
Enlarge this image.Figure 2. Characterization of the isolates from foodborne cases, non-foodborne cases, influents, effluents, and asari clams by serotyping.
Enlarge this image.Figure 3. Characterization of the isolates from foodborne cases, non-foodborne cases, influents, effluents, and asari clams positive or negative for cpb2.
Enlarge this image.Figure 4. Characterization of the isolates from foodborne cases, non-foodborne cases, influents, effluents, and asari clams by cpe genotyping assay.
Enlarge this image.Figure 5. Genetic characterization of 36 type F C. perfringens isolates and 13 collection strains by multilocus sequence typing (MLST). Construction of phylogenetic tree based on a concatenated sequence of eight housekeeping genes was conducted with the Clustal W format. The asterisk (*) shows asari clam clones. A variation scale is supplied at the bottom.
| Period | cpe Genotyping Assay | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Chromosomal cpe | IS1151-cpe | IS1470-Like-cpe | Untypable cpe | ||||||
| A | B | A | B | A | B | A | B | ||
| 2016 | 7 | 0 | 0 | 2 | 3 | 0 | 0 | 0 | 0 |
| 8 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | |
| 9 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | |
| 10 | 0 | 0 | 3 | 0 | 0 | 1 | 0 | 0 | |
| 11 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | |
| 12 | 0 | 0 | 2 | 4 | 0 | 0 | 0 | 1 | |
| 2017 | 1 | 0 | 0 | 3 | 3 | 0 | 0 | 0 | 0 |
| 2 | 0 | 0 | 2 | 2 | 0 | 0 | 0 | 0 | |
| 3 | 0 | 0 | 5 | 2 | 0 | 0 | 0 | 1 | |
| 4 | 0 | 0 | 3 | 3 | 0 | 0 | 0 | 0 | |
| 5 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | |
| 6 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | |
| 7 | 0 | 0 | 1 | 1 | 2 | 0 | 0 | 0 | |
| 8 | 0 | 0 | 1 | 2 | 0 | 0 | 0 | 0 | |
| 9 | 0 | 0 | 0 | 3 | 0 | 0 | 1 | 0 | |
| 10 | 0 | 0 | 2 | 3 | 0 | 0 | 0 | 0 | |
| 11 | 0 | 0 | 1 | 2 | 0 | 0 | 0 | 0 | |
| 12 | 0 | 0 | 0 | 3 | 0 | 0 | 0 | 0 | |
| 2018 | 1 | 0 | 0 | 2 | 3 | 0 | 0 | 0 | 0 |
| 2 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | |
| 3 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | |
| 4 | 0 | 0 | 1 | 2 | 0 | 0 | 0 | 0 | |
| 5 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | |
| 6 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | |
| 7 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | |
| 8 | 0 | 0 | 1 | 0 | 0 | 1 | 0 | 0 | |
| 9 | 0 | 0 | 1 | 3 | 0 | 0 | 0 | 0 | |
| 10 | 0 | 0 | 1 | 4 | 0 | 0 | 0 | 0 | |
| 11 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | |
| 12 | 0 | 0 | 2 | 3 | 0 | 0 | 0 | 0 | |
| 2019 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| 2 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | |
| 3 | 0 | 0 | 1 | 2 | 0 | 0 | 0 | 0 | |
| 4 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | |
| 5 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | |
| 6 | 0 | 0 | 4 | 0 | 0 | 0 | 0 | 0 | |
| 7 | 0 | 0 | 2 | 2 | 0 | 0 | 0 | 0 | |
| 8 | 0 | 0 | 3 | 0 | 0 | 0 | 0 | 0 | |
| 9 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | |
| 10 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | |
| 11 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | |
| 12 | 0 | 0 | 3 | 1 | 0 | 0 | 0 | 0 | |
| 2020 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 |
| Total | 0 | 0 | 60 | 63 | 3 | 2 | 1 | 2 | |
A shows WWTP-A; B shows WWTP-B.
| Period | cpe Genotyping Assay | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Chromosomal cpe | IS1151-cpe | IS1470-Like-cpe | Untypable cpe | ||||||
| A | B | A | B | A | B | A | B | ||
| 2018 | 8 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 |
| 9 | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 10 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 11 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | |
| 12 | 0 | 0 | 1 | 0 | 0 | 2 | 0 | 0 | |
| 2019 | 1 | 0 | 0 | 0 | 1 | 0 | 1 | 1 | 0 |
| 2 | 0 | 0 | 3 | 1 | 0 | 0 | 0 | 0 | |
| 3 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | |
| 4 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | |
| 5 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | |
| 6 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 7 | 0 | 1 | 6 | 1 | 0 | 0 | 0 | 0 | |
| 8 | 0 | 2 | 1 | 0 | 0 | 0 | 0 | 0 | |
| 9 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 10 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | |
| 11 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | |
| 12 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
| 2020 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Total | 5 | 4 | 13 | 7 | 1 | 6 | 1 | 0 | |
A shows WWTP-A; B shows WWTP-B.
| Primer | Sequence (5′–3′) | Product Size (bp) |
|---|---|---|
| cpe-F | GATAAAGGAGATGGTTGGATATTAGGGGAAC | 383 |
| cpe-R | CCTAAGCTATCTGCAGATGTTTTACTAAGCC |
| Strain | Location of cpe | cpb2 | Source | Isolation Date |
|---|---|---|---|---|
| 14-12 | Plasmid with an IS1151 sequence | + | Human feces in non-foodborne case | June 2014 |
| 14-14 | Plasmid with an IS1151 sequence | + | Human feces in non-foodborne case | July 2014 |
| 18-229 | Plasmid with an IS1151 sequence | + | Human feces in non-foodborne case | November 2018 |
| 14-15 | Plasmid with an IS1151 sequence | + | Human feces in non-foodborne case | July 2014 |
| 14-133 | Plasmid with an IS1151 sequence | + | Human feces in non-foodborne case | December 2014 |
| 19-14 | Plasmid with an IS1151 sequence | + | Human feces in non-foodborne case | April 2019 |
| 16-101 | Plasmid with an IS1151 sequence | – | Sewage influent from WWTP-A | July 2016 |
| 17-29 | Plasmid with an IS1151 sequence | – | Sewage influent from WWTP-A | October 2016 |
| 17-82 | Plasmid with an IS1151 sequence | + | Sewage influent from WWTP-A | December 2016 |
| 18-101 | Plasmid with an IS1151 sequence | – | Sewage influent from WWTP-A | January 2018 |
| 19-100 | Plasmid with an IS1151 sequence | + | Sewage influent from WWTP-A | June 2019 |
| 17-37 | Plasmid with an IS1151 sequence | + | Sewage influent from WWTP-B | November 2016 |
| 17-100 | Plasmid with an IS1151 sequence | + | Sewage influent from WWTP-B | December 2016 |
| 18-29 | Plasmid with an IS1151 sequence | + | Sewage influent from WWTP-B | July 2017 |
| 18-340 | Plasmid with an IS1151 sequence | + | Sewage influent from WWTP-B | November 2018 |
| 19-43 | Plasmid with an IS1151 sequence | + | Sewage influent from WWTP-B | March 2019 |
| 18-350 | Plasmid with an IS1151 sequence | + | Sewage effluent from WWTP-A | February 2019 |
| 19-16 | Plasmid with an IS1151 sequence | – | Sewage effluent from WWTP-A | March 2019 |
| 18-353 | Plasmid with an IS1151 sequence | + | Sewage effluent from WWTP-B | January 2019 |
| 19-5 | Plasmid with an IS1151 sequence | – | Sewage effluent from WWTP-B | February 2019 |
| 19-124 | Plasmid with an IS1151 sequence | + | Asari clam from Aichi | July 2019 |
| 19-141 | Plasmid with an IS1151 sequence | + | Asari clam from Aichi | August 2019 |
| 19-146 | Plasmid with an IS1151 sequence | + | Asari clam from Aichi | September 2019 |
| 19-169 | Plasmid with an IS1151 sequence | – | Asari clam from Kumamoto | November 2019 |
| 19-170 | Plasmid with an IS1151 sequence | + | Asari clam from Kumamoto | November 2019 |
| 19-171 | Plasmid with an IS1151 sequence | + | Asari clam from Kumamoto | December 2019 |
| 19-172 | Plasmid with an IS1151 sequence | + | Asari clam from Kumamoto | December 2019 |
| 14-13 | Plasmid with an IS1470-like sequence | + | Human feces in non-foodborne case | June 2014 |
| 13-11 | Plasmid with an IS1470-like sequence | – | Human feces in non-foodborne case | April 2013 |
| 19-15 | Plasmid with an IS1470-like sequence | + | Human feces in non-foodborne case | April 2019 |
| 18-25 | Plasmid with an IS1470-like sequence | + | Sewage influent from WWTP-A | July 2017 |
| 17-36 | Plasmid with an IS1470-like sequence | – | Sewage influent from WWTP-B | January 2016 |
| 18-268 | Plasmid with an IS1470-like sequence | – | Sewage influent from WWTP-B | August 2018 |
| 18-262 | Plasmid with an IS1470-like sequence | – | Sewage effluent from WWTP-B | August 2018 |
| 18-289 | Plasmid with an IS1470-like sequence | – | Sewage effluent from WWTP-B | December 2018 |
| 19-62 | Plasmid with an IS1470-like sequence | – | Sewage effluent from WWTP-B | April 2019 |
Author Contributions
Conceptualization, K.Y. and E.H.; methodology, K.Y.; investigation, K.Y., K.U., and T.Y.; resources, K.Y. and K.U.; data curation, K.Y. and K.U.; writing-original draft preparation, K.Y.; writing-review and editing, E.H.; supervision, E.H.; project administration, K.Y. and E.H. All authors have read and agreed to the published version of the manuscript.
Funding
This research received no external funding.
Acknowledgments
We are grateful to Masayuki Ohnuma, Tsuyoshi Nishigata, and Kouichi Asayama for technical assistance and to the members of the WWTPs for providing the influent sewage samples.
Conflicts of Interest
The authors declare no conflict of interest.
1. Rood, J.I.; Adams, V.; Lacey, J.; Lyras, D.; McClane, B.A.; Melville, S.B.; Moore, R.J.; Popoff, M.R.; Sarker, M.R.; Songer, J.G.; et al. Expansion of the Clostridium perfringens toxin-based typing scheme. Anaerobe 2018, 53, 5-10.
2. Ministry of Health, Labor and Welfare (MHLW). Statistics of Food Poisoning in Japan. Available online: http://www.mhlw.go.jp/stf/seisakunitsuite/bunya/kenkou_iryou/shokuhin/syokuchu/04.html (accessed on 12 March 2020). (In Japanese).
3. Moffatt, C.R.; Howard, P.J.; Burns, T. A mild outbreak of gastroenteritis in long-term care facility residents due to Clostridium perfringens, Australia 2009. Foodborne Pathog. Dis. 2011, 8, 791-796.
4. Tallis, G.; Ng, S.; Ferreira, C.; Tan, A.; Griffith, J. A nursing home outbreak of Clostridium perfringens associated with pureed food. Aust. N. Z. J. Public Health 1999, 23, 421-423.
5. Ochiai, H.; Ohtsu, T.; Tsuda, T.; Kagawa, H.; Kawashita, T.; Takao, S.; Tsutsumi, A.; Kawakami, N. Clostridium perfringens foodborne outbreak due to braised chop suey supplied by chafing dish. Acta Med. Okayama 2005, 59, 27-32.
6. Borriello, S.P.; Larson, H.E.; Welch, A.R.; Barclay, F.; Stringer, M.F.; Bartholomew, B.A. Enterotoxigenic Clostridium perfringens: A possible cause of antibiotic-associated diarrhoea. Lancet 1984, 323, 305-307.
7. Brett, M.M.; Rodhouse, J.C.; Donovan, T.J.; Tebbutt, G.M.; Hutchinson, D.N. Detection of Clostridium perfringens and its enterotoxin in cases of sporadic diarrhoea. J. Clin. Pathol. 1992, 45, 609-611.
8. Jackson, S.G.; Yip-Chuck, D.A.; Clark, J.B.; Brodsky, M.H. Diagnostic importance of Clostridium perfringens enterotoxin analysis in recurring enteritis among elderly, chronic care psychiatric patients. J. Clin. Microbiol. 1986, 23, 748-751.
9. Heikinheimo, A.; Lindström, M.; Granum, P.E.; Korkeala, H. Humans as reservoir for enterotoxin gene-carrying Clostridium perfringens type A. Emerg. Infect. Dis. 2006, 12, 1724-1729.
10. Carman, R.J.; Sayeed, S.; Li, J.; Genheimer, C.W.; Hiltonsmith, M.F.; Wilkins, T.D.; McClane, B.A. Clostridium perfringens toxin genotypes in the feces of healthy North Americans. Anaerobe 2008, 14, 102-108.
11. Lindström, M.; Heikinheimo, A.; Lahti, P.; Korkeala, H. Novel insights into the epidemiology of Clostridium perfringens type A food poisoning. Food Microbiol. 2011, 28, 192-198.
12. Yadav, J.P.; Das, S.C.; Dhaka, P.; Vijay, D.; Kumar, M.; Mukhopadhyay, A.K.; Chowdhury, G.; Chauhan, P.; Singh, R.; Dhama, K.; et al. Molecular characterization and antimicrobial resistance profile of Clostridium perfringens type a isolates from humans, animals, fish and their environment. Anaerobe 2017, 47, 120-124.
13. Park, M.; Rafii, F. The prevalence of plasmid-coded CPE enterotoxin, β2 toxin, tpeL toxin, and tetracycline resistance in Clostridium perfringens strains isolated from different sources. Anaerobe 2019, 56, 124-129.
14. Wen, Q.; McClane, B.A. Detection of enterotoxigenic Clostridium perfringens type A isolates in American retail foods. Appl. Environ. Microbiol. 2004, 70, 2685-2691.
15. Miki, Y.; Miyamoto, K.; Kaneko-Hirano, I.; Fujiuchi, K.; Akimoto, S. Prevalence and characterization of enterotoxin gene-carrying Clostridium perfringens isolates from retail meat products in Japan. Appl. Environ. Microbiol. 2008, 74, 5366-5372.
16. Saito, M. Production of Enterotoxin by Clostridium perfringens derived from humans, animals, foods, and the natural environment in Japan. J. Food Prot. 1990, 53, 115-118.
17. Mueller-Spitz, S.R.; Stewart, L.B.; Klump, J.V.; McLellan, S.L. Freshwater suspended sediments and sewage are reservoirs for enterotoxin-positive Clostridium perfringens. Appl. Environ. Microbiol. 2010, 76, 5556-5562.
18. Hashimoto, A.; Tsuchioka, H.; Higashi, K.; Ota, N.; Harada, H. Distribution of enterotoxin gene-positive Clostridium perfringens spores among human and livestock samples and its potential as a human fecal source tracking indicator. J. Water. Environ. Technol. 2016, 14, 447-454.
19. Oka, S.; Ando, Y.; Oishi, K. Distribution of enterotoxigenic Clostridium perfringens in fish and shellfish. Nippon Suisan Gakkaishi 1989, 55, 79-86.
20. Li, J.; Sayeed, S.; McClane, B.A. Prevalence of enterotoxigenic clostridium perfringens isolates in pittsburgh (pennsylvania) area soils and home kitchens. Appl. Environ. Microbiol. 2007, 73, 7218-7224.
21. Rahmati, T.; Labbe, R. Levels and toxigenicity of Bacillus cereus and Clostridium perfringens from retail seafood. J. Food Prot. 2008, 71, 1178-1185.
22. Miller-Pierce, M.R.; Rhoads, N.A. Clostridium perfringens testing improves the reliability of detecting non-point source sewage contamination in Hawaiian coastal waters compared to using Enterococci alone. Mar. Pollut. Bull. 2019, 144, 36-47.
23. Stelma, G.N., Jr. Use of bacterial spores in monitoring water quality and treatment. J. Water Health 2018, 164, 491-500.
24. Muniain-Mujika, I.; Calvo, M.; Lucena, F.; Girones, R. Comparative analysis of viral pathogens and potential indicators in shellfish. Int. J. Food Microbiol. 2003, 83, 75-85.
25. Kaas, L.; Ogorzaly, L.; Lecellier, G.; Berteaux-Lecellier, V.; Cauchie, H.M.; Langlet, J. Detection of human enteric viruses in French Polynesian wastewaters, environmental waters and giant clams. Food Environ. Virol. 2019, 11, 52-64.
26. Onosi, O.; Upfold, N.S.; Jukes, M.D.; Luke, G.A.; Knox, C. The first molecular detection of aichi virus 1 in raw sewage and mussels collected in South Africa. Food Environ. Virol. 2019, 11, 96-100.
27. Tsukada, R.; Ono, S.; Kobayashi, H.; Wada, Y.; Nishizawa, K.; Fujii, M.; Takeuchi, M.; Kuroiwa, K.; Kobayashi, Y.; Ishii, K.; et al. A cluster of hepatitis A infections presumed to be related to asari clams and investigation of the spread of viral contamination from asari clams. Jpn. J. Infect. Dis. 2019, 72, 44-48.
28. Nishigata, T.; Oonuma, M. Survey of the viral contamination in shellfish supplied in Yanamashi Prefecture (In Japanese). Annu. Rep. Yamanashi Inst. Pub. Health 2017, 61, 47-49.
29. Metcalf, T.G.; Mullin, B.; Eckerson, D.; Moulton, E.; Larkin, E.P. Bioaccumulation and depuration of enteroviruses by the soft-shelled clam. Mya arenaria. Appl. Environ. Microbiol. 1979, 38, 275-282.
30. Burkhardt, W., 3rd; Watkins, W.D.; Rippey, S.R. Seasonal effects on accumulation of microbial indicator organisms by Mercenaria mercenaria. Appl. Environ. Microbiol. 1992, 58, 826-831.
31. Rippey, S.R. Infectious diseases associated with molluscan shellfish consumption. Clin. Microbiol. Rev. 1994, 7, 419-425.
32. Burkhardt, W., 3rd; Calci, K.R. Selective accumulation may account for shellfish-associated viral illness. Appl. Environ. Microbiol. 2000, 66, 1375-1378.
33. Schaeffer, J.; Treguier, C.; Piquet, J.C.; Gachelin, S.; Cochennec-Laureau, N.; Le Saux, J.C.; Garry, P.; Le Guyader, F.S. Improving the efficacy of sewage treatment decreases norovirus contamination in oysters. Int. J. Food Microbiol. 2018, 286, 1-5.
34. Tanaka, D.; Isobe, J.; Hosorogi, S.; Kimata, K.; Shimizu, M.; Katori, K.; Gyobu, Y.; Nagai, Y.; Yamagishi, T.; Karasawa, T.; et al. An outbreak of food-borne gastroenteritis caused by Clostridium perfringens carrying the cpe gene on a plasmid. Jpn. J. Infect. Dis. 2003, 56, 137-139.
35. Tauxe, R.V. Emerging foodborne diseases: An evolving public health challenge. Emerg. Infect. Dis. 1997, 3, 425-434.
36. Yanagimoto, K.; Yamagami, T.; Uematsu, K.; Haramoto, E. Characterization of Salmonella isolates from wastewater treatment plant influents to estimate unreported cases and infection sources of salmonellosis. Pathogens 2020, 52.
37. Tanaka, D.; Kimata, K.; Shimizu, M.; Isobe, J.; Watahiki, M.; Karasawa, T.; Yamagishi, T.; Kuramoto, S.; Serikawa, T.; Ishiguro, F.; et al. Genotyping of Clostridium perfringens isolates collected from food poisoning outbreaks and healthy individuals in Japan based on the cpe locus. Jpn. J. Infect. Dis. 2007, 60, 68-69.
38. Matsuda, A.; Aung, M.S.; Urushibara, N.; Kawaguchiya, M.; Sumi, A.; Nakamura, M.; Horino, Y.; Ito, M.; Habadera, S.; Kobayashi, N. Prevalence and genetic diversity of toxin genes in clinical isolates of Clostridium perfringens: Coexistence of alpha-toxin variant and binary enterotoxin genes (bec/cpile). Toxins 2019, 11, 326.
39. Deguchi, A.; Miyamoto, K.; Kuwahara, T.; Miki, Y.; Kaneko, I.; Li, J.; McClane, B.A.; Akimoto, S. Genetic characterization of type A enterotoxigenic Clostridium perfringens strains. PLoS ONE 2009, 4, e5598.
40. Xiao, Y.; Wagendorp, A.; Moezelaar, R.; Abee, T.; Wells-Bennik, M.H. A wide variety of Clostridium perfringens type A food-borne isolates that carry a chromosomal cpe gene belong to one multilocus sequence typing cluster. Appl. Environ. Microbiol. 2012, 78, 7060-7068.
41. Kiu, R.; Caim, S.; Painset, A.; Pickard, D.; Swift, C.; Dougan, G.; Mather, A.E.; Amar, C.; Hall, L.J. Phylogenomic analysis of gastroenteritis-associated Clostridium perfringens in England and Wales over a 7-year period indicates distribution of clonal toxigenic strains in multiple outbreaks and extensive involvement of enterotoxin-encoding (CPE) plasmids. Microb. Genom. 2019, 5, e000297.
42. Mahamat Abdelrahim, A.; Radomski, N.; Delannoy, S.; Djellal, S.; Le Négrate, M.; Hadjab, K.; Fach, P.; Hennekinne, J.A.; Mistou, M.Y.; Firmesse, O. Large-scale genomic analyses and toxinotyping of Clostridium perfringens implicated in foodborne outbreaks in France. Front. Microbiol. 2019, 10.
43. Okonogi, A.; Ishihara, Y.; Kubo, S. The relevance of Salmonella screening results for food-related workers and poultry farms in Japan (In Japanese). J. Jpn. Soc. Clin. Microbiol. 2019, 29, 15-20.
44. Wang, L.; Zhang, S.; Zheng, D.; Fujihara, S.; Wakabayashi, A.; Okahata, K.; Suzuki, M.; Saeki, A.; Nakamura, H.; Hara-Kudo, Y.; et al. Prevalence of diarrheagenic Escherichia coli in foods and fecal specimens obtained from cattle, pigs, chickens, asymptomatic carriers, and patients in Osaka and Hyogo, Japan. Jpn. J. Infect. Dis. 2017, 70, 464-469.
45. Matsusaki, S.; Katayama, A.; Kawaguchi, N.; Tanaka, K.; Hayashi, Y. Incidence of Campylobacter jejuni/coli from healthy people in Yamaguchi, Japan (In Japanese). Kansenshogaku Zasshi 1983, 57, 1-6.
46. Miwa, N.; Nishina, T.; Kubo, S.; Atsumi, M.; Honda, H. Amount of enterotoxigenic Clostridium perfringens in meat detected by nested PCR. Int. J. Food Microbiol. 1998, 42, 195-200.
47. Ghoneim, N.H.; Hamza, D.A. Epidemiological studies on Clostridium perfringens food poisoning in retail foods. Rev. Sci. Tech. 2017, 36, 1025-1032.
48. Lin, Y.T.; Labbe, R. Enterotoxigenicity and genetic relatedness of Clostridium perfringens isolates from retail foods in the United States. Appl. Environ. Microbiol. 2003, 69, 1642-1646.
49. Asakura, H.; Saito, E.; Momose, Y.; Ekawa, T.; Sawada, M.; Yamamoto, A.; Hasegawa, A.; Iwahori, J.; Tsutsui, T.; Osaka, K.; et al. Prevalence and growth kinetics of Shiga toxin-producing Escherichia coli (STEC) in bovine offal products in Japan. Epidemiol. Infect. 2012, 140, 655-664.
50. Hiroi, M.; Kawamori, F.; Harada, T.; Sano, Y.; Miwa, N.; Sugiyama, K.; Hara-Kudo, Y.; Masuda, T. Antibiotic resistance in bacterial pathogens from retail raw meats and food-producing animals in Japan. J. Food Prot. 2012, 75, 1774-1782.
51. Hara-Kudo, Y.; Konuma, H.; Kamata, Y.; Miyahara, M.; Takatori, K.; Onoue, Y.; Sugita-Konishi, Y.; Ohnishi, T. Prevalence of the main food-borne pathogens in retail food under the national food surveillance system in Japan. Food Addit. Contam. Part A 2012, 30, 1450-1458.
52. Furukawa, I.; Ishihara, T.; Teranishi, H.; Saito, S.; Yatsuyanagi, J.; Wada, E.; Kumagai, Y.; Takahashi, S.; Konno, T. Prevalence and characteristics of Salmonella and Campylobacter in retail poultry meat in Japan. Jpn. J. Infect. Dis. 2017, 70, 239-247.
53. Zhang, Q.; He, X.; Yan, T. Differential decay of wastewater bacteria and change of microbial communities in beach sand and seawater microcosms. Environ. Sci. Technol. 2015, 49, 8531-8540.
54. La Sala, L.F.; Redondo, L.M.; Díaz Carrasco, J.M.; Pereyra, A.M.; Farber, M.; Jost, H.; Fernández-Miyakawa, M.E. Carriage of Clostridium perfringens by benthic crabs in a sewage-polluted estuary. Mar. Pollut. Bull. 2015, 97, 365-372.
55. Sabry, M.; Abd El-Moein, K.; Hamza, E.; Abdel Kader, F. Occurrence of Clostridium perfringens types A, E, and C in fresh fish and its public health significance. J. Food Prot. 2016, 79, 994-1000.
56. Sarker, M.R.; Shivers, R.P.; Sparks, S.G.; Juneja, V.K.; McClane, B.A. Comparative experiments to examine the effects of heating on vegetative cells and spores of Clostridium perfringens isolates carrying plasmid genes versus chromosomal enterotoxin genes. Appl. Environ. Microbiol. 2000, 66, 3234-3240.
57. Nakamura, M.; Kato, A.; Tanaka, D.; Gyobu, Y.; Higaki, S.; Karasawa, T.; Yamagishi, T. PCR identification of the plasmid-borne enterotoxin gene (CPE) in Clostridium perfringens strains isolated from food poisoning outbreaks. Int. J. Med. Microbiol. 2004, 294, 261-265.
58. Li, J.; Mc Clane, B.A. Further comparison of temperature effects on growth and survival of Clostridium perfringens type A isolates carrying a chromosomal or plasmid-borne enterotoxin gene. Appl. Environ. Microbiol. 2006, 72, 4561-4568.
59. Li, J.; Mc Clane, B.A. Comparative effects of osmotic, sodium nitrite-induced, and pH-induced stress on growth and survival of Clostridium perfringens type a isolates carrying chromosomal or plasmid-borne enterotoxin genes. Appl. Environ. Microbiol. 2006, 72, 7620-7625.
60. Miyamoto, K.; Li, J.; McClane, B.A. Enterotoxigenic Clostridium perfringens: Detection and identification. Microbes Environ. 2012, 27, 343-349.
61. Lahti, P.; Heikinheimo, A.; Johansson, T.; Korkeala, H. Clostridium perfringens type A strains carrying a plasmid-borne enterotoxin gene (genotype IS1151-cpe or IS1470-like-cpe) as a common cause of food poisoning. J. Clin. Microbiol. 2008, 46, 371-373.
62. Grant, K.A.; Kenyon, S.; Nwafor, I.; Plowman, J.; Ohai, C.; Halford-Maw, R.; Peck, M.W.; McLauchlin, J. The identification and characterization of Clostridium perfringens by real-time PCR, location of enterotoxin gene, and heat resistance. Foodborne Pathog. Dis. 2008, 5, 629-639.
63. Shandera, W.X.; Tacket, C.O.; Blake, P.A. Food poisoning due to Clostridium perfringens in the United States. J. Infect. Dis. 1983, 147, 167-170.
64. Haramoto, E.; Fujino, S.; Otagiri, M. Distinct behaviors of infectious F-specific RNA coliphage genogroups at a wastewater treatment plant. Sci. Total Environ. 2015, 520, 32-38.
65. Miyamoto, K.; Wen, Q.; Mc Clane, B.A. Multiplex PCR genotyping assay that distinguishes between isolates of Clostridium perfringens type A carrying a chromosomal enterotoxin gene (CPE) locus, a plasmid CPE locus with an IS1470-like sequence, or a plasmid cpe locus with an IS1151 sequence. J. Clin. Microbiol. 2004, 42, 1552-1558.
66. van Asten, A.J.; van der Wiel, C.W.; Nikolaou, G.; Houwers, D.J.; Gröne, A. A multiplex PCR for toxin typing of Clostridium perfringens isolates. Vet. Microbiol. 2009, 136, 411-412.
Keita Yanagimoto1,2, Kosei Uematsu1, Takaya Yamagami1 and Eiji Haramoto3,*
1Department of Microbiology, Yamanashi Institute of Public Health and Environment, 1-7-31 Fujimi, Kofu, Yamanashi 400-0027, Japan
2Environmental and Social System Science Course, University of Yamanashi, 4-3-11 Takeda, Kofu, Yamanashi 400-8511, Japan
3Interdisciplinary Center for River Basin Environment, University of Yamanashi, 4-3-11 Takeda, Kofu, Yamanashi 400-8511, Japan
*Author to whom correspondence should be addressed.
© 2020. This work is licensed under http://creativecommons.org/licenses/by/3.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
