This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
1. Introduction
Cataracts are a widely prevalent eye disease, which are the leading cause of blindness worldwide and involve a complicated pathogenesis. It is generally accepted that the main mechanism of cataract onset is oxidative damage [1, 2], and the molecular mechanism of cataract pathogenesis has long been a research hotspot.
The bone morphogenetic protein (BMP) is a multifunctional growth factor belonging to the transforming growth factor β (TGF-β) superfamily that has been shown to play important roles in both the development and regeneration of different tissues [3]. Previous research has shown that BMPs and their receptors play an important role in the development of lens during eyeball development [4]. BMPs are highly expressed in mouse embryos, and blocking of BMP signals in the lens ectoderm of cultured mouse embryos prevented lens formation. The BMP inhibitor Noggin, when added to chick lens epithelial cells, results in abnormal development of the lens [5]. BMP-4 is a member of the BMP family, and targeted deletion of BMP-4 in mice impairs lens placode formation [6]. Moreover, the absence of BMP-4 in mice can lead to irregular turbidity or white patches in the vitreous bodies [7]. Previous studies have reported that BMPs play an antiapoptotic role in some cells under oxidative stress, and the BMP-4 signal is important in the regulation of inflammation and homeostasis [8, 9]. However, limited information is available regarding the role and mechanism of BMP-4 in human lens.
2. Materials and Methods
2.1. Cell Culture
The human lens epithelial cell line HLE-B3 was obtained from laboratories of the Tianjin Medical University Eye Hospital (Tianjin, China) and incubated in Dulbecco’s Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS; Gibco, USA), 100 U/mL penicillin, and 100 U/mL streptomycin at 37°C in a humidified atmosphere of 5% CO2. The cells were cultured on a 96-well plate following the normal procedure and divided into the control group, H2O2 group, and H2O2+BMP-4 group.
For H2O2-induced oxidative stress, the cells were cultured following the routine procedure. The medium of each group was replaced with serum-free medium for 16 h, then cells were exposed to 300 μM H2O2 and incubated at 37°C for 1.5 h. Then, serum-free medium containing BMP-4 (100 ng/mL) was added to the H2O2+BMP-4 group. All experiments were performed in triplicate.
2.2. Cell Counting Kit-8 (CCK-8)
The cell suspension was inoculated in groups of 200 μL in a 96-well plate with
The culture medium of the corresponding detection well plate was removed and washed with phosphate-buffered saline (PBS; Gibco, USA). Afterwards, a fresh blank of 100 μL DMEM and 10 μL CCK-8 reagent (Dojindo, Kyushu, Japan) was added into each well, then the culture plate was placed in an incubator with 5% CO2 at 37°C for 2 h. A microplate reader was used to measure the cell optical density (OD) value at 450 nm.
2.3. Flow Cytometric Analysis of Apoptosis
The HLE-B3 cells were prestimulated with 100 ng/mL BMP-4 in serum-free medium for 2 h, then 300 μM/L H2O2 was added for 12 h. Next, serum-free medium containing 100 ng/mL BMP-4 was added for 24 h. Then, the HLE-B3 cells were collected and washed with PBS and subjected to a PI/Annexin V FITC Apoptosis Detection kit (CoWin Biosciences, Beijing, China): Briefly, each sample was diluted in 100 μL Annexin binding buffer and then was stained with 5 μL Annexin V-fluorescein isothiocyanate and 5 μL propidium iodide (PI) for 15 min at room temperature in the dark. Following incubation, the cells were analyzed with a FACSCalibur flow cytometer (BD Biosciences, San Diego, CA, USA). Flow cytometric analysis was performed in triplicate.
2.4. Analysis of Mitochondrial Membrane Depolarization
The change in the mitochondrial membrane potential (ΔΨm) in HLE-B3 cells was monitored using the mitochondrial membrane potential detection kit (JC-1, T4069, Sigma-Aldrich) according to the manufacturer’s instructions. Briefly, HLE-B3 cells cultured in a 96-well plate (
2.5. Detection of ROS
After 100 ng/mL serum-free BMP-4 was added to the cells for 2 h, they were stimulated for 1.5 h with 300 μM/L H2O2. The cells were then cultured again in serum-free medium containing 100 ng/mL BMP-4 for 2 h. The Image-iT™ LIVE Green Reactive Oxygen Species (ROS) Detection Kit obtained from Invitrogen (Thermo Fisher Scientific) was used to estimate the ROS level in live HLE-B3 cells. Following treatment of cells according to the experimental conditions, cells were incubated with 15 mM dichlorodihydrofluorescein diacetate (DCFH-DA) (Sigma-Aldrich) for 45 min, briefly centrifuged to remove the dye, and resuspended in 4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid (HEPES) buffer (Thermo Fisher Scientific). The change in fluorescence was measured in a spectrofluorometer set at 485 nm excitation and 530 nm emission. Change in fluorescence intensity was represented in arbitrary units.
2.6. Caspase-3 Measurement
The cells were routinely treated as mentioned above. The activity of caspase-3 in cells was measured using a caspase-3 activity kit according to the manufacturer’s protocol (BioVision Inc., Milpitas, CA, USA). In brief, cytosolic proteins (200 μg in 50 μL) were mixed with the caspase-3-specific substrate Ac-DEVD-pNA (Jiancheng, Nanjing, China) and incubated at 37°C for 4 h. The absorbance was measured at 405 nm with an enzyme marker.
2.7. Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Analysis
The mRNA expression of activating transcription factor- (ATF-) 6 and Krüppel-like factor- (KLF-) 6 in HLE-B3 cells was analyzed using an ABI 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The cells were collected and examined by RT-PCR. The sequences of the primers used for the PCR are listed in Table 1.
Table 1
The sequences of the primers.
No. | Primer | Sequences (5 |
1 | ho ATF-6 U | TCAGCCCAAGCCTTTATTGC |
2 | ho ATF-6 D | TGATGGTTTTTGCTGGAACACT |
3 | ho KLF-6 U | GGTCAGCTCGGGAAAATTGA |
4 | ho KLF-6 D | CCTGCTCAGTTCCGGAGAAG |
2.8. Statistical Analysis
SPSS 20.0 statistical software (IBM, USA) was used for statistical analysis. The data of each group were normally distributed by the Shapiro-Wilk test and expressed as
3. Results
3.1. Effects of BMP-4 on Human Lens Epithelium Cells under Oxidative Stress
Under the oxidative stress of H2O2 (300 μM/L, 1.5 h), cell proliferation was significantly inhibited compared to that in the control group (
[figures omitted; refer to PDF]
3.2. Changes in HLECSs Assessed by Light Microscopy
The cultured cells were stimulated with H2O2 for 1.5 h, then 100 ng/mL BMP-4 in serum-free medium was added for 24 h.
Cells in the different groups were stained with haematoxylin-eosin (HE) and observed under light microscopy (Figures 2(a)–2(c)). The micrographs show that normal cells stained by HE were densely packed; however, under oxidative stress by H2O2, the number of HE-labelled cells decreased. After BMP-4 treatment, the number of cells increased significantly.
[figures omitted; refer to PDF]
Hoechst 33258-2 was used to stain the nuclei of cells (Figures 3(a)–3(c)). The nuclei of normal untreated cells were stained lightly and uniformly by Hoechst 33258-2; however, under oxidative stress by H2O2, the nuclei were fragmented and appeared loosely packed. After BMP-4 treatment, the nucleus fragmentation was markedly improved.
[figures omitted; refer to PDF]
3.3. The Effect of BMP-4 on H2O2-Induced Apoptosis, ER (Endoplasmic Reticulum) Stress, Increased Caspase-3 Level, and ROS in HLECSs
3.3.1. The Apoptosis of HLECSs under H2O2 Oxidative Stress
After exposure to 100 ng/mL serum-free BMP-4 for 2 h, HLECSs were stimulated for 12 h with 300 μM/L H2O2 to enter apoptosis and then were cultured again in serum-free medium containing 100 ng/mL BMP-4 for 24 h. The apoptotic cells were detected by flow cytometry. As seen in Figures 4(a) and 4(b), when compared with the control group, apoptosis in the H2O2 group was significantly increased, whereas the percentage of apoptotic cells in the H2O2+BMP-4 group was significantly reduced compared with that in the H2O2 group, which indicated that BMP-4 could inhibit H2O2-induced apoptosis of HLECSs.
[figures omitted; refer to PDF]
To determine the early changes in cell apoptosis, JC-1, a fluorescent lipophilic carbocyanine dye, was used to measure mitochondrial membrane potential (ΔΨm) in HLECSs. JC-1 forms complexes known as aggregates (red fluorescence) at high ΔΨm. While in cells with low ΔΨm, JC-1 remains in the monomeric form (green fluorescence). Figure 5 shows the transition from red to green fluorescence. Under oxidative stress, the membrane potentials significantly decreased, and the green fluorescence intensity markedly increased. However, upon subsequent BMP-4 treatment, the red fluorescence increased significantly, indicating cells with high ΔΨm.
[figures omitted; refer to PDF]
3.3.2. Effects of H2O2 Oxidative Stress on ROS Expression in HLECSs
To further examine the role of H2O2 oxidative stress in HLE-B3 apoptosis, the production of ROS in cells was detected by dichlorofluorescein (DCF) fluorescence. The results demonstrated that H2O2 markedly enhanced the production of ROS; however, when BMP-4 was added, there was a significant reduction in the level of ROS (Figures 6(a) and 6(b)). Since caspases are important effector components of the cellular apoptotic pathway and activated via sequential processing of the caspase family members, we measured the expression of caspase-3 in HLECSs and observed changes in apoptosis (Figures 6(c) and 6(d)). Caspase-3 is a representative protease that plays an important role in the executive function of apoptosis. It is also the most important terminal shear enzyme in the process of cell apoptosis and one of the effectors of nuclear apoptosis. Our results demonstrated that the expression of caspase-3 in the H2O2 group was significantly higher than that in the normal control group (
[figures omitted; refer to PDF]
3.3.3. H2O2-Induced ER Stress Pathways Involve ATF-6 and KLF-6
ATF-6 is one of the vital regulators to activate ER stress transducers and their downstream signals [10]. And KLF-6 nuclear translocations were reported to be involved in oxidative stress [11]. Therefore, the changes in ATF-6 and KLF-6 expressions in HLECSs under H2O2-induced oxidative stress were detected. The results of RT-PCR showed a significant increase in ATF-6 and KLF-6 expression under oxidative stress with respect to the control group (
[figures omitted; refer to PDF]
4. Discussion
Previous lens-related studies on BMPs have focused on lens development, and there is abundant evidence that BMPs, especially BMP-4, play an important role in lens induction and involvement in lens epithelial development. We investigated the effect of BMP-4 on lens epithelial cells; the results showed that BMP-4 used at different concentrations acted on HLECSs, but no significant changes were observed in cell proliferation between the BMP-4 group and the control group. Previous studies have found that the function of the BMP receptor ACVR1 is completely different in cells at different stages of lens development (i.e., promotes proliferation in the early stage and inhibits proliferation in the late stage). During the continuous development of the lens, ACVR1 plays an opposite regulatory role in cell processes, which is a novel discovery [12]. The reason for this phenomenon is not clear. It may be related to the bidirectional effect of ACVR1 on cell proliferation caused by the change in the downstream signal cascade. We speculate that BMPs play a major role in maintaining homeostasis in lens epithelial cells under normal conditions, and the effect of BMP-4 on cells may be different, depending on the cell cycle.
Apoptosis is a kind of programmed cell death, which can be observed in various types of cataracts and cultured lens epithelia during oxidative stress injury, and is the common cellular basis for the formation of noncongenital cataracts in humans and animals [13]. Many studies have confirmed that oxidative stress can lead to the cessation of cell proliferation and apoptosis [14]. In this study, H2O2 was used to establish the oxidative stress model because cataracts caused by H2O2 acting on HLECSs have been confirmed by increasing evidence [15, 16]. It has also been extensively recognized that oxidative stress is an important mediator of HLECS apoptosis, which is identified as a common molecular basis for the initiation and progression of cataracts [17, 18]. Therefore, it is important to explore protective strategies to treat or delay the development of lens opacity.
BMPs play important roles in diverse cell types, but there may be significant differences in their function depending on the organs [19]. Existing studies show that in pulmonary arteries, BMP signalling exerts important vasoprotective effects by controlling the balance between proliferation and activation of apoptosis in endothelial and smooth muscle cells [20, 21]. In contrast, BMP-4 functions as a prooxidant and prohypertensive mediator in systemic arteries [22, 23]. However, the role of BMP-4 in lens epithelial cells is unclear. In our study, Annexin V/PI double staining for detection of apoptosis revealed that apoptosis of lens epithelial cells was significantly increased when the cells were stimulated by 300 μM/L H2O2, but it was significantly improved after BMP-4 treatment, indicating that treatment with BMP-4 alleviated H2O2-induced reduction of HLECS viability.
The caspase family is a group of cysteine proteases that specifically cleaves aspartic acid and plays an important role in the process of apoptosis. Studies have shown that apoptosis occurs through caspase cascade activation. In mammals, the caspase family is involved in apoptosis and contains important effector molecules of the apoptosis pathway [24]. Caspase-3 is one of the representative proteases of the caspase family, which plays an important role in the execution of apoptosis [25]. Many studies have confirmed that oxidative stress can activate caspase-3, and the antiapoptotic effect induced by the BMP signalling pathway on human pulmonary arterial endothelial cells (ECs) is in part due to the decrease in caspase-3 activity [26]. In our study, HLECSs were stimulated with BMP-4 for 2 h before and after oxidative stress, and the expression of caspase-3 decreased significantly. However, when we measured the expression of caspase-3 in cells that were only pretreated with BMP-4 under oxidative stress, there was no significant difference from that in the H2O2 group. It was speculated that the prestimulation with BMP-4 could not fully antagonize the increased reactivity of caspase-3 under oxidative stress, but continuous BMP-4 exposure could still recover some of the cell functions and reduce the expression of caspase-3. Existing research results also indicate that although the activity of caspase effectors is necessary for apoptosis, it is not enough to kill cells [27].
To examine whether the mitochondrial apoptosis pathway is involved in the inhibition of apoptosis by BMP-4, the changes in the mitochondrial membrane potential and mitochondrial apoptosis-related proteins were evaluated. The results of this study show that under oxidative stress, the changes in the mitochondrial membrane potential were markedly inhibited in HLECSs upon BMP-4 treatment. These results are consistent with those of a study reporting on antioxidant therapy against myocardial ischemia-reperfusion injury (MIRI), which also showed that antioxidants could repress the cleavage of caspase-3 [28]. Therefore, we speculate that the protective effect of BMP-4 is, to some extent, achieved by inhibiting the mitochondrial apoptosis pathway.
In addition, researchers have reported that an impaired mitochondrial electron transport chain (ETC) contributes to cardiac injury by decreasing ATP production and increasing the generation of ROS [29, 30]. In cataract-related research, ROS have long been associated with age-related nuclear cataracts and are known to adversely affect epithelial cells [31]. In this study, we found that after oxidative stress (H2O2) in human lens epithelia, intracellular ROS expression was significantly increased, indicating that under H2O2-induced oxidative stress, intracellular free radical production increased, leading to cell damage and apoptosis. Treatment with BMP-4 can significantly reduce ROS, thereby interfering with the intracellular oxidation-reduction (REDOX) balance and ER homeostasis, which leads to ER stress [32]. ER is closely connected with mitochondria through mitochondria-associated membranes (MAM) [33, 34]. ER stress can have a series of effects on cells, including damage, adaptation, and apoptosis, and can be involved in the occurrence of many diseases [35–38]. ATF-6 is an ER protein and an important transcriptional activator in ER stress. It can directly bind to the cis-acting original endoplasmic reticulum stress-response element (ERSE) to initiate the unfolded protein reaction (UPR) in mammals [39]. In our study, BMP-4 also significantly inhibited the H2O2-induced increase in the ATF-6 expression level. The inhibition of ER stress markers suggests that BMP-4 plays a pivotal role in ER stress and apoptosis of HLECSs. Previous studies have also shown that in myocardial ischemia-reperfusion, ATF-6 pathways play an important role in ROS-mediated ER stress. Increased ATF-6 expression in myocardial cells (in vivo and in vitro) plays a protective role against ischemia and reperfusion injuries. In transgenic mouse models, selective activation of ATF-6 can also be effective against ischemic injury in the heart [40–43].
The Krüppel-like family of zinc finger transcription factors regulates cell growth, proliferation, apoptosis, and angiogenesis [44]. KLF-6 is a ubiquitously expressed Krüppel-like transcription factor and a subfamily of DNA-binding zinc fingers involved in a diverse range of cellular processes [11]. Many studies have characterized the essential role of KLFs in maintaining homeostasis in epithelial and endothelial cells. It has been reported that KLF-6 is the first transcription factor critical to mitochondrial function under cell stress in the podocyte, and the restoration of KLF-6 attenuates mitochondrial injury and prevents cell apoptosis [45]. However, in diabetic cell damage caused by high glucose-induced oxidative stress, KLF-6 was significantly increased [46]. In our study on lens epithelial cells, incubation with prooxidants, such as H2O2, further enhanced KLF-6 expression, but it decreased upon treatment with BMP-4. Similar results have been obtained in previous studies on primary hepatocytes. KLF-6 expression increases with high levels of cytochrome P450 2E1 (CYP2E1); however, antioxidants and CYP2E1 inhibitors prevent this increased expression of KLF-6 [39]. Thus, KLF-6 has many diverse functions; the regulation of KLF-6 under cell stress and how KLF-6 senses ROS need to be further explored.
5. Conclusions
The functions of BMP-4 in lens epithelial cells under oxidative stress have not been previously elucidated. Herein, we provide the first evidence that BMP-4 alleviated H2O2-induced oxidative stress and apoptosis in HLECSs, which is associated with the ER stress/mitochondria-mediated caspase-dependent apoptosis pathway. The causes of cataracts are multifactorial, and the pathogenesis is complex. Many studies have shown that the abnormal metabolism and injury of lens epithelial cells caused by thermal radiation, ultraviolet radiation, H2O2, and other stress conditions are closely related to the occurrence of cataracts. BMP-4 can effectively inhibit the apoptosis of lens epithelial cells under oxidative stress. These findings might be important for understanding the role of BMPs in cataracts and may provide novel insight into the early prevention and control of cataracts.
Acknowledgments
This work was supported by a grant from the National Natural Science Foundation of China (NSFC: 81570872), Clinical Research Fund of Tianjin Medical University Eye Institute (16YKYJS003), Tianjin Clinical Key Discipline Project (TJLCZDXKQ012), Science and Technology Project of Health Commission of Tianjin Binhai New Area (2019BWKY019), Tianjin Municipal Science and Technology Commission (15JCYBJC24900), Young Medical Talents Program of Tianjin Health and Family Planning Commission, and Tianjin Medical University Youth Innovative Talents Project (YDYYRCXM-C2018-02).
[1] F. Tian, L. Dong, Y. Zhou, Y. Shao, W. Li, H. Zhang, F. Wang, "Rapamycin-induced apoptosis in HGF-stimulated lens epithelial cells by AKT/mTOR, ERK and JAK2/STAT3 pathways," International Journal of Molecular Sciences, vol. 15 no. 8, pp. 13833-13848, DOI: 10.3390/ijms150813833, 2014.
[2] T. Raman, M. Ramar, M. Arumugam, S. M. Nabavi, M. K. N. S. Varsha, "Cytoprotective mechanism of action of curcumin against cataract," Pharmacological Reports, vol. 68 no. 3, pp. 561-569, DOI: 10.1016/j.pharep.2015.12.012, 2016.
[3] L. Dong, Z. Zhang, X. Liu, Q. Wang, Y. Hong, X. Li, J. Liu, "RNA sequencing reveals BMP4 as a basis for the dual-target treatment of diabetic retinopathy," Journal of Molecular Medicine, vol. 99 no. 2, pp. 225-240, DOI: 10.1007/s00109-020-01995-8, 2021.
[4] D. Beebe, C. Garcia, X. Wang, R. Rajagopal, M. Feldmeier, J. Y. Kim, A. Chytil, H. Moses, R. Ashery-Padan, M. Rauchman, "Contributions by members of the TGFbeta superfamily to lens development," The International Journal of Developmental Biology, vol. 48 no. 8-9, pp. 845-856, DOI: 10.1387/ijdb.041869db, 2004.
[5] B. A. Boswell, L. S. Musil, "Synergistic interaction between the fibroblast growth factor and bone morphogenetic protein signaling pathways in lens cells," Molecular Biology of the Cell, vol. 26 no. 13, pp. 2561-2572, DOI: 10.1091/mbc.E15-02-0117, 2015.
[6] R. U. de Iongh, Y. Chen, M. I. Kokkinos, J. W. McAvoy, "Bmp and activin receptor expression in lens development," Molecular Vision, vol. 10, pp. 566-576, 2004.
[7] M. F. Mehler, P. C. Mabie, G. Zhu, S. Gokhan, J. A. Kessler, "Developmental changes in progenitor cell responsiveness to bone morphogenetic proteins differentially modulate progressive CNS lineage fate," Developmental Neuroscience, vol. 22 no. 1-2, pp. 74-85, DOI: 10.1159/000017429, 2000.
[8] M. Ciumas, M. Eyries, O. Poirier, S. Maugenre, F. Dierick, N. Gambaryan, K. Montagne, S. Nadaud, F. Soubrier, "Bone morphogenetic proteins protect pulmonary microvascular endothelial cells from apoptosis by upregulating α -B-crystallin," Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 33 no. 11, pp. 2577-2584, DOI: 10.1161/ATVBAHA.113.301976, 2013.
[9] T. Ji, H. Takabayashi, M. Mao, X. Han, X. Xue, J. C. Brazil, K. A. Eaton, Y. M. Shah, A. Todisco, "Regulation and function of bone morphogenetic protein signaling in colonic injury and inflammation," American Journal of Physiology- Gastrointestinal and Liver Physiology, vol. 312 no. 1, pp. G24-G33, DOI: 10.1152/ajpgi.00169.2016, 2017.
[10] A. Banerjee, S. J. Czinn, R. J. Reiter, T. G. Blanchard, "Crosstalk between endoplasmic reticulum stress and anti-viral activities: a novel therapeutic target for COVID-19," Life Sciences, vol. 255,DOI: 10.1016/j.lfs.2020.117842, 2020.
[11] F. Tian, J. Zhao, S. Bu, H. Teng, J. Yang, X. Zhang, X. Li, L. Dong, "KLF6 induces apoptosis in human lens epithelial cells through the ATF4-ATF3-CHOP axis," Drug Design, Development and Therapy, vol. Volume 14, pp. 1041-1055, DOI: 10.2147/DDDT.S218467, 2020.
[12] R. Rajagopal, L. K. Dattilo, V. Kaartinen, C. X. Deng, L. Umans, A. Zwijsen, A. B. Roberts, E. P. Bottinger, D. C. Beebe, "Functions of the type 1 BMP receptor Acvr1 (Alk2) in lens development: cell proliferation, terminal differentiation, and survival," Investigative Ophthalmology & Visual Science, vol. 49 no. 11, pp. 4953-4960, DOI: 10.1167/iovs.08-2217, 2008.
[13] F. Tian, J. Z. Zhao, L. Y. Huang, M. H. Xu, Z. Zhang, H. Teng, X. M. Zhang, X. R. Li, L. J. Dong, H. Zhang, "Effect of overexpression of Krüppel-like factor 6 on apoptosis of human lens epithelial cells induced by ultraviolet B," Chinese Journal of Experimental Ophthalmology, vol. 37 no. 4, pp. 257-262, 2019.
[14] I. G. Obrosova, S. S. Chung, P. F. Kador, "Diabetic cataracts: mechanisms and management," Diabetes/Metabolism Research and Reviews, vol. 26 no. 3, pp. 172-180, DOI: 10.1002/dmrr.1075, 2010.
[15] J. Bai, F. Yang, L. Dong, Y. Zheng, "Ghrelin protects human lens epithelial cells against oxidative stress-induced damage," Oxidative Medicine and Cellular Longevity, vol. 2017,DOI: 10.1155/2017/1910450, 2017.
[16] X. Hu, Y. Liang, B. Zhao, Y. Wang, "Oxyresveratrol protects human lens epithelial cells against hydrogen peroxide- induced oxidative stress and apoptosis by activation of Akt/HO-1 pathway," Journal of Pharmacological Sciences, vol. 139 no. 3, pp. 166-173, DOI: 10.1016/j.jphs.2019.01.003, 2019.
[17] F. Tian, J. Zhao, H. Teng, L. Huang, X. Liu, R. Su, M. Gao, X. Zhang, X. Li, L. Dong, H. Zhang, "Regulation of Krüppel-like factor 6 via activating transcription factor 4 pathway to apoptosis of human lens epithelial cells," Chinese Journal Experimental Ophthalmology, vol. 36 no. 3, pp. 181-186, DOI: 10.3760/cma.j.issn.2095-0160.2018.03.005, 2018.
[18] H. Teng, L. Y. Huang, F. Tian, L. J. Dong, H. Zhang, "Effects of SMP-30 overexpression on apoptosis of human lens epithelial cells induced by ultraviolet B irradiation," Chinese Journal of Ophthalmology, vol. 53 no. 11, pp. 835-841, 2017.
[19] A. Csiszar, S. Lehoux, Z. Ungvari, "Hemodynamic forces, vascular oxidative stress, and regulation of BMP-2/4 expression," Antioxidants & Redox Signaling, vol. 11 no. 7, pp. 1683-1697, DOI: 10.1089/ars.2008.2401, 2009.
[20] G. P. Sorescu, H. Song, S. L. Tressel, J. Hwang, S. Dikalov, D. A. Smith, N. L. Boyd, M. O. Platt, B. Lassegue, K. K. Griendling, H. Jo, "Bone morphogenic protein 4 produced in endothelial cells by oscillatory shear stress induces monocyte adhesion by stimulating reactive oxygen species production from a nox1-based NADPH oxidase," Circulation Research, vol. 95 no. 8, pp. 773-779, DOI: 10.1161/01.RES.0000145728.22878.45, 2004.
[21] G. P. Sorescu, M. Sykes, D. Weiss, M. O. Platt, A. Saha, J. Hwang, N. Boyd, Y. C. Boo, J. D. Vega, W. R. Taylor, H. Jo, "Bone morphogenic protein 4 produced in endothelial cells by oscillatory shear stress stimulates an inflammatory response," Journal of Biological Chemistry, vol. 278 no. 33, pp. 31128-31135, DOI: 10.1074/jbc.M300703200, 2003.
[22] H. Jo, H. Song, A. Mowbray, "Role of NADPH oxidases in disturbed flow- and BMP4-induced inflammation and atherosclerosis," Antioxidants & Redox Signaling, vol. 8 no. 9-10, pp. 1609-1619, DOI: 10.1089/ars.2006.8.1609, 2006.
[23] S. Miriyala, M. C. Gongora Nieto, C. Mingone, D. Smith, S. Dikalov, D. G. Harrison, H. Jo, "Bone morphogenic protein-4 induces hypertension in Mice," Circulation, vol. 113 no. 24, pp. 2818-2825, DOI: 10.1161/CIRCULATIONAHA.106.611822, 2006.
[24] N. Mendelev, S. Witherspoon, P. A. Li, "Overexpression of human selenoprotein H in neuronal cells ameliorates ultraviolet irradiation-induced damage by modulating cell signaling pathways," Experimental Neurology, vol. 220 no. 2, pp. 328-334, DOI: 10.1016/j.expneurol.2009.09.008, 2009.
[25] J. E. Ricci, R. A. Gottlieb, D. R. Green, "Caspase-mediated loss of mitochondrial function and generation of reactive oxygen species during apoptosis," Journal of Cell Biology, vol. 160 no. 1, pp. 65-75, DOI: 10.1083/jcb.200208089, 2003.
[26] K. Teichert-Kuliszewska, M. J. Kutryk, M. A. Kuliszewski, G. Karoubi, D. W. Courtman, L. Zucco, J. Granton, D. J. Stewart, "Bone morphogenetic protein receptor-2 signaling promotes pulmonary arterial endothelial cell survival: implications for loss-of-function mutations in the pathogenesis of pulmonary hypertension," Circulation Research, vol. 98 no. 2, pp. 209-217, DOI: 10.1161/01.RES.0000200180.01710.e6, 2006.
[27] D. Lukovic, A. Komoriya, B. Z. Packard, D. S. Ucker, "Caspase activity is not sufficient to execute cell death," Experimental Cell Research, vol. 289 no. 2, pp. 384-395, DOI: 10.1016/S0014-4827(03)00289-1, 2003.
[28] X. Shi, G. Tao, L. Ji, G. Tian, "Sappanone A alleviates hypoxia/reoxygenation-induced cardiomyocytes injury through inhibition of mitochondrial apoptosis and activation of PI3K–Akt–Gsk-3 β pathway," Bioscience Reports, vol. 40 no. 2, article BSR20192442,DOI: 10.1042/BSR20192442, 2020.
[29] Y. Shao, L. J. Dong, Y. Takahashi, J. L. Chen, X. Liu, Q. Chen, J. X. Ma, X. R. Li, "miRNA-451a regulates RPE function through promoting mitochondrial function in proliferative diabetic retinopathy," American Journal of Physiology-Endocrinology and Metabolism, vol. 316 no. 3, pp. E443-E452, DOI: 10.1152/ajpendo.00360.2018, 2019.
[30] E. J. Lesnefsky, Q. Chen, B. Tandler, C. L. Hoppel, "Mitochondrial dysfunction and myocardial ischemia-reperfusion: implications for novel therapies," Annual Review of Pharmacology and Toxicology, vol. 57 no. 1, pp. 535-565, DOI: 10.1146/annurev-pharmtox-010715-103335, 2017.
[31] T. J. Ma, D. H. Lan, S. Z. He, Z. Ye, P. Li, W. Zhai, W. Q. Chen, Y. Huang, Y. Fu, A. Sun, Y. B. Wang, Z. Ye, J. L. Li, Y. Gao, X. L. Yan, Z. H. Li, "Nrf2 protects human lens epithelial cells against H 2 O 2 -induced oxidative and ER stress: the ATF4 may be involved," Experimental Eye Research, vol. 169, pp. 28-37, DOI: 10.1016/j.exer.2018.01.018, 2018.
[32] I. Hwang, M. J. Uddin, E. S. Pak, H. Kang, E. J. Jin, S. Jo, D. Kang, H. Lee, H. Ha, "The impaired redox balance in peroxisomes of catalase knockout mice accelerates nonalcoholic fatty liver disease through endoplasmic reticulum stress," Free Radical Biology and Medicine, vol. 148, pp. 22-32, DOI: 10.1016/j.freeradbiomed.2019.12.025, 2020.
[33] M. R. Wieckowski, C. Giorgi, M. Lebiedzinska, J. Duszynski, P. Pinton, "Isolation of mitochondria-associated membranes and mitochondria from animal tissues and cells," Nature Protocols, vol. 4 no. 11, pp. 1582-1590, DOI: 10.1038/nprot.2009.151, 2009.
[34] A. A. Mohsin, J. Thompson, Y. Hu, J. Hollander, E. J. Lesnefsky, Q. Chen, "Endoplasmic reticulum stress-induced complex I defect: central role of calcium overload," Archives of Biochemistry and Biophysics, vol. 683,DOI: 10.1016/j.abb.2020.108299, 2020.
[35] J. Groenendyk, P. K. Sreenivasaiah, D. H. Kim, L. B. Agellon, M. Michalak, "Biology of endoplasmic reticulum stress in the heart," Circulation Research, vol. 107 no. 10, pp. 1185-1197, DOI: 10.1161/CIRCRESAHA.110.227033, 2010.
[36] M. J. Kwon, H. S. Chung, C. S. Yoon, E. J. Lee, T. K. Kim, S. H. Lee, K. S. Ko, B. D. Rhee, M. K. Kim, J. H. Park, "Low glibenclamide concentrations affect endoplasmic reticulum stress in INS-1 cells under glucotoxic or glucolipotoxic conditions," Korean Journal of Internal Medicine, vol. 28 no. 3, pp. 339-346, DOI: 10.3904/kjim.2013.28.3.339, 2013.
[37] X. Xing, L. Huang, Y. Lv, X. Liu, R. Su, X. Li, L. Dong, "DL-3-n-Butylphthalide protected retinal Müller cells dysfunction from oxidative stress," Current Eye Research, vol. 44 no. 10, pp. 1112-1120, DOI: 10.1080/02713683.2019.1624777, 2019.
[38] M. L. Liu, M. L. Wang, J. J. Lv, J. Wei, J. Wan, "Glibenclamide exacerbates adriamycin-induced cardiotoxicity by activating oxidative stress-induced endoplasmic reticulum stress in rats," Experimental and Therapeutic Medicine, vol. 15, pp. 3425-3431, 2018.
[39] B. Roy, A. S. Lee, "The mammalian endoplasmic reticulum stress response element consists of an evolutionarily conserved tripartite structure and interacts with a novel stress-inducible complex," Nucleic Acids Research, vol. 27 no. 6, pp. 1437-1443, DOI: 10.1093/nar/27.6.1437, 1999.
[40] X. Niu, J. Zhang, C. Ling, M. Bai, Y. Peng, S. Sun, Y. Li, Z. Zhang, "Polysaccharide from Angelica sinensis protects H9c2 cells against oxidative injury and endoplasmic reticulum stress by activating the ATF6 pathway," Journal of International Medical Research, vol. 46 no. 5, pp. 1717-1733, DOI: 10.1177/0300060518758863, 2018.
[41] P. L. Zhang, M. Lun, J. Teng, J. Huang, T. M. Blasick, L. Yin, G. A. Herrera, J. Y. Cheung, "Preinduced molecular chaperones in the endoplasmic reticulum protect cardiomyocytes from lethal injury," Annals of Clinical & Laboratory Science, vol. 34 no. 4, pp. 449-457, 2004.
[42] M. Vitadello, D. Penzo, V. Petronilli, G. Michieli, S. Gomirato, R. Menabò, F. Di Lisa, L. Gorza, "Overexpression of the stress protein Grp94 reduces cardiomyocyte necrosis due to calcium overload and simulated ischemia," FASEB Journal, vol. 17 no. 8, pp. 923-925, DOI: 10.1096/fj.02-0644fje, 2003.
[43] J. A. Vekich, P. J. Belmont, D. J. Thuerauf, C. C. Glembotski, "Protein disulfide isomerase-associated 6 is an ATF6-inducible ER stress response protein that protects cardiac myocytes from ischemia/reperfusion- mediated cell death," Journal of Molecular & Cellular Cardiology, vol. 53 no. 2, pp. 259-267, DOI: 10.1016/j.yjmcc.2012.05.005, 2012.
[44] J. Kaczynski, T. Cook, R. Urrutia, "Sp1- and Krüppel-like transcription factors," Genome Biology, vol. 4 no. 2,DOI: 10.1186/gb-2003-4-2-206, 2003.
[45] S. K. Mallipattu, J. C. He, "Klf 6: a mitochondrial regulator in the kidney," Oncotarget, vol. 6 no. 18, pp. 15720-15721, DOI: 10.18632/oncotarget.4647, 2015.
[46] L. La Sala, G. Pujadas, V. De Nigris, S. Canivell, A. Novials, S. Genovese, A. Ceriello, "Oscillating glucose and constant high glucose induce endoglin expression in endothelial cells: the role of oxidative stress," Acta Diabetologica, vol. 52 no. 3, pp. 505-512, DOI: 10.1007/s00592-014-0670-3, 2015.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright © 2021 Bei Du et al. This is an open access article distributed under the Creative Commons Attribution License (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License. https://creativecommons.org/licenses/by/4.0/
Abstract
Bone morphogenetic proteins (BMPs), a member of the transforming growth factor β (TGF-β) superfamily, are abundant in human ocular tissues and play an important role in lens development. Targeted deletion of BMP-4 in mice results in failure of lens placode formation. Following lens maturation, the formation of senile cataracts is demonstrably associated with free radical-related oxidative stress. Previous studies reported that BMPs play an antiapoptotic role in cells under oxidative stress, and the BMP-4 signal is important in inflammation regulation and homeostasis. BMP-4 evidently suppressed the apoptosis of human lens epithelial cells (HLECS) under oxidative stress induced by H2O2. This protective antiapoptotic effect is partly due to a decrease in caspase-3 activity and reactive oxygen species (ROS) level. Furthermore, the expression of activating transcription factor- (ATF-) 6 and Krüppel-like factor- (KLF-) 6 increased under oxidative stress and decreased after BMP-4 treatment.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details


1 Tianjin Key Laboratory of Retinal Functions and Diseases, Eye Institute and School of Optometry, Tianjin Medical University Eye Hospital, Tianjin 300384, China
2 Eye Hospital, Nanjing Medical University, Nanjing, China
3 First Teaching Hospital of Tianjin University of Traditional Chinese Medicine, Tianjin, China