Acute lymphoblastic leukemia (ALL) refers to a pediatric tumor that is associated with an 85% survival rate. ALL can be subdivided into two sub‐types (T‐ALL or B‐ALL) according to the origin of the cancer cells.1 T‐ALL, derived from T cells, accumulates genomic or epigenetic alterations that accelerate transformation.2 The recommended pediatric therapy for ALL includes a combination of vincristine, anthracyclines, and steroids.3 Once administered with suitable treatments, almost all patients with T‐ALL are likely to achieve complete remission, although the rates of survival and relapse within 5 years remain unsatisfactory.4 Consequently, T‐ALL is a challenging pediatric condition to manage; there is an urgent need to develop new forms of treatment.
Circular (Circ) RNAs have been suggested to participate in the regulation of cell progression in hematopoietic compartments5 and are known to interact with RNAs and proteins in malignant conditions.6 For example, Circ‐PVT1 promotes the activation of cell proliferation and apoptosis in ALL, while the silencing of Circ‐PVT1 can disrupt these processes.7 Circ‐PRKDC (Circ 0136666) has been associated with resistance to 5‐fluorouracil (5‐FU) in colorectal cancer and has been shown to facilitate cell invasion and migration.8 However, very few studies have investigated the specific mechanisms underlying the action of Circ‐PRKDC in ALL. Overall microRNA (miR) expression can be used as a prognostic indicator for patients with T‐ALL9 and targeting certain miRs, such as miR‐145, can mediate cell autophagy and apoptosis.10 When considering the entire subset of miRs, it is evident that miR‐653‐5p acts as a tumor suppressor in certain cancers, including cervical cancer and melanoma.11,12 Whether miR‐653‐5p could also suppress tumor growth in T‐ALL is unknown.
Reelin (RELN) has been shown to mutate in early T‐cell precursors, inherited disorders, and T‐ALL.13 The inhibition of RELN can block activation of the phosphoinositide 3‐kinase (PI3K)/AKT/mammalian target of rapamycin (mTOR) signaling pathway, and induce cell apoptosis and autophagy in prostate cancer.14 Alternations in the PI3K/AKT/mTOR signaling pathway are known to be involved in cellular proliferation, survival, and chemoresistance in T‐ALL and the suppression of the PI3K/AKT/mTOR signaling pathway activation has been shown to delay cell progression in T‐ALL.15 It is evident from the existing literature that the mechanisms underlying the actions of Circ‐PRKDC, miR‐653‐5p, RELN, and the PI3K/AKT/mTOR signaling pathway, have been partly decoded in certain forms of cancer. However, the mechanisms underlying the action of these factors and pathways in T‐ALL has not yet to be investigated. In the present study, we aimed to investigate the roles of the Circ‐PRKDC/miR‐653‐5p/RELN/PI3K/AKT/mTOR signaling pathway axis in T‐ALL.
This study was approved by the Ethics Committee of The Affiliated Hospital of Sun Yat‐sen University. All patients, or their families, provided signed and informed consent for the use of their samples in this study.
A total of 39 T‐ALL patients (27 males and 12 females; 9–44 years‐of‐age; median age: 23 years) were included in this study. All patients were diagnosed with T‐ALL in The Affiliated Hospital of Sun Yat‐sen University between April 2017 and July 2019. Another 30 healthy controls (19 males and 11 females; 19–68 years‐of‐age; median age: 29 years) were also included.
T‐ALL was diagnosed by morphology, cytogenetic analysis, and immunophenotyping, as described previously.16 None of the patients received preoperative chemotherapy or radiotherapy. The clinicopathological characteristics of all T‐ALL patients were recorded (Supplementary Table 1). Bone marrow samples provided by T‐ALL patients and normal healthy controls were treated with gradient centrifugation to isolate monocytes. Normal T cells were then isolated from the monocytes of normal healthy controls by MACS depletion (Miltenyi Biotec, Bergisch Gladbach, Germany).17
Human T‐ALL cell lines (TALL‐1 and Jurkat) and peripheral blood mononuclear cells (PBMC) were acquired from the American Type Culture Collection (MD, USA) and cultured in Roswell Park Memorial Institute‐1640 medium (Gibco, NY, USA) containing 10% fetal bovine serum (95% air and 5% CO2).18
Jurkat cells were grown to the logarithmic growth phase, plated and grown to 80% confluency. Next, we transfected the cells with a range of constructs using Lipofectamine 2000 (Invitrogen, CA, USA), including si‐Circ‐PRKDC#1, si‐Circ‐PRKDC#2, miR‐653‐5p mimic, si‐Circ‐PRKDC#1 and miR‐653‐5p inhibitor, si‐NC, mimic NC, or si‐Circ‐PRKDC#1 and inhibitor NC (GenePharma, Shanghai, China). The specific sequences of these constructs are not disclosed for commercial reasons.
We used a reverse transcription kit (Solarbio, Shanghai, China) to perform reverse transcription and a SYBR Green quantification kit (Solarbio) for real‐time fluorescence PCR. Three parallel wells were created for each sample. We then determined the expression levels of Circ‐PRKDC, miR‐653‐5p, and RELN. Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was used an internal control for Circ‐PRKDC and RELN while U6 was used as an internal control for miR‐653‐5p. The primers used for PCR (Sangon, Shanghai, China) were listed in Table 1. Gene expression was analyzed by the 2‐△△Ct method.19
TABLEPrimer sequences| Gene | Primer sequences (5′‐3′) |
| Circ‐PRKDC | F: CAGAGACGATTGGCTGGTGAG |
| R: TGATAAATTGCCCAACAAAGAGACT | |
| RELN | F: ACCAGTGGGCAGTCGATGACATCAT |
| R: CTTCATTAGCCAACATCAACCACAC | |
| GAPDH | F: CACCCACTCCTCCACCTTTG |
| R: CCACCACCCTGTTGCTGTAG | |
| miR‐653‐5p | F: TTGAAACATTCTCTACTGAAC |
| R: GAACATGTCTGCGTATCTC | |
| U6 | F: AGAGAAGATTAGCATGGCCCCTG |
| R: ATCCAGTGCAGGGTCCGAGG |
Note: F: forward; R, reverse; Circ‐PRKDC; Circular RNA‐PRKDC; RELN, Reelin; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; miR‐653‐5p, microRNA‐653‐5p.
Total protein was extracted from tissues and cells and the concentration of the total protein extract was then determined. Total protein (50 μg) from each sample was then separated by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS‐PAGE) and then electroblotted onto a polyvinylidene fluoride membrane and blocked. Membranes were then incubated with primary antibodies raised against RELN (1:5000, ab139691), PI3K (1:1000, ab151549), p‐PI3K (1: 1000, ab182651), AKT (1:500, ab8805), p‐AKT (1:1000, ab38449), mTOR (1: 2000, ab2732), p‐mTOR (1: 2000, ab137133), Beclin‐1 (1:2000, ab207612), GAPDH (1: 2500, ab9485) and LC3II/I (1:1000, ab48394) (all from Abcam, MA, USA). The following morning, the membranes were washed, incubated with a secondary antibody (1:2000, Abcam), developed, and photographed.
First, we predicted the binding sites of miR‐653‐5p in the Circ‐PRKDC or RELN 3′ untranslated region (UTR). Next, the wild type (WT)‐Circ‐PRKDC vector (containing the Circ‐PRKDC 3′UTR fragment) or mutant (MUT)‐Circ‐PRKDC (without the Circ‐PRKDC 3′UTR fragment) was co‐transfected with mimic NC or miR‐653‐5p mimic into cells via Lipofectamine™ 2000. The same method was applied to verify the targeting reaction between miR‐653‐5p and RELN.
After 48‐h of co‐transfection, we used a dual luciferase reporter gene kit (Promega, WI, USA) to monitor luciferase activity and calculate relative luciferase activity for each experimental model.
RIP assays were carried out with an RNA binding protein immunoprecipitation kit (Millipore, MA, USA) along with antibodies raised to Ago2 and immunoglobulin G (IgG) (Abcam). The levels of enrichment for Circ‐PRKDC and miR‐653‐5p were quantified by RT‐qPCR.
Forty‐eight hours after transfection, cells were transferred to 96‐well plates at a density of 5 × 103 cells/well and diluted to a volume of 100 μl/well. Three parallel wells were used for each group. At 24, 48, and 72 h of culture, we added 10 μl of CCK‐8 reagent to the cells (at the same time point). We then measured optical density values with a microplate reader at 450 nm. The CCK‐8 kit was purchased from Dojindo (Japan).
Forty‐eight hours after transfection, cells were transferred to glass slides and fixed. Subsequently, the cells were stained using a TUNEL apoptosis kit (Beyotime Institute of Biotechnology, Shanghai, China). The number of apoptotic cells and the total number of cells were quantified, thus allowing us to calculate the apoptosis index.
Cell apoptosis was detected by annexin V‐fluorescein isothiocyanate (FITC)/propidium iodide (PI) double staining and flow cytometry. Forty‐eight hours after transfection, the cells were detached, mixed with 100 μl of binding buffer, and reacted with 5 μl of FITC‐labeled Annexin‐V and 1 μl of PI. Finally, the cells were mixed with 400 μl of buffer and detected by flow cytometry (BD FACS Arial I cell sorter).20
MDC powder (Sigma‐Aldrich, CA, USA) was dissolved in dimethyl sulfoxide (DMSO) to a concentration of 5 mmol/L. Jurkat cells (1 × 106 cells/ml) were then transfected for 48 h, resuspended in 6‐well plates, and mixed with MDC solution (50 μmol/L). The cells were incubated for 30–45 min, centrifuged, and then resuspended in 60 μl of PBS. A small volume of cell suspension was then dropped onto a slide and excited by ultraviolet light. The cells were then observed and photographed in three fields of view.
All data were processed by SPSS version 22.0 statistical software (IBM, NY, USA). Measurement data were expressed as mean ± standard deviation. Differences between two groups were evaluated by the t test while differences between multiple groups were evaluated by one‐way analysis of variance (ANOVA) and Tukey's multiple comparisons test. (*) P < 0.05, (**) P < 0.01 and (***) P < 0.001 were considered as being statistically significant.
The expression levels of Circ‐PRKDC, miR‐653‐5p, and RELN, were detected in tissues from T‐ALL patients and healthy controls by RT‐qPCR and western blotting assay. The expression levels of Circ‐PRKDC and RELN were up‐regulated while those of miR‐653‐5p were down‐regulated in T‐ALL tissues (Figure 1(A),(B)). Furthermore, when compared to T cells, the expression levels of Circ‐PRKDC and RELN were upregulated in TALL‐1 and Jurkat cells while the expression levels of miR‐653‐5p were downregulated. (Figure 1(C),(D)).
To explore the cellular mechanisms associated with Circ‐PRKDC in T‐ALL, we interfered with the expression of Circ‐PRKDC by administering Jurkat cells with si‐RNA. RT‐qPCR confirmed that si‐Circ‐PRKDC#1 and si‐Circ‐PRKDC#2 successfully inhibited Circ‐PRKDC expression. RT‐qPCR and western blotting further showed that the knockdown of Circ‐PRKDC increased the expression of miR‐653‐5p but downregulated the expression of RELN (Figure 2(A),(B)).
CCK‐8 assays, flow cytometry, and TUNEL staining, showed that the knockdown of Circ‐PRKDC suppressed cell proliferation and induced apoptosis. Moreover, MDC staining showed that the depletion of Circ‐PRKDC increased the number of intracellular autophagic vesicles, increased the autophagy protein LC3II/I ratio and the expression of Beclin‐1. These data showed that the downregulation of Circ‐PRKDC induced autophagy and apoptosis in T‐ALL cells (Figure 2(C)‐(G)).
Activation of the PI3K/AKT/mTOR axis is one of the most important intracellular pathways in cancers, including acute myeloid leukemia (AML); pharmacological inhibition of the PI3K/AKT/mTOR pathway has been shown to prevent the growth of AML cells.21 In addition, RELN down‐regulation has been reported to suppress activation of the PI3K/AKT/mTOR signaling pathway.14 In this study, western blotting assays showed that Circ‐PRKDC silencing reduced the phosphorylation of PI3K/AKT/mTOR proteins and disrupted activation of the PI3K/AKT/mTOR signaling pathway (Figure 2(H)).
Next, we investigated the involvement of miR‐653‐5p in T‐ALL. We transfected a miR‐653‐5p mimic and an appropriate NC into Jurkat cells. RT‐qPCR and western blotting demonstrated that the miR‐653‐5p mimic successfully increased the expression levels of miR‐653‐5p but suppressed the levels of RELN in cells (Figure 3(A),(B)).
Functional assays further revealed that the restoration of miR‐653‐5p inhibited cell proliferation, stimulated apoptosis, promoted the formation of intracellular autophagic vesicles, and elevated the LC3II/I ratio and expression level of Beclin‐1 (Figure 3(C)‐(G)).
Western blotting further showed that the upregulation of miR‐653‐5p suppressed the phosphorylation of PI3K/AKT/mTOR proteins and activation of the PI3K/AKT/mTOR signaling pathway (Figure 3(H)).
Next, we applied simultaneous Circ‐PRKDC and miR‐653‐5p down‐regulation assays and demonstrated that the downregulation of miR‐653‐5p reversed the effect of Circ‐PRKDC downregulation on RELN expression. This indicated that miR‐653‐5p participated in the Circ‐PRKDC‐mediated expression of RELN (Figure 4(A),(B)).
Rescue experiments were then conducted to demonstrate that the knockdown of miR‐653‐5p antagonized the inhibitory effect of down‐regulated Circ‐PRKDC on T‐ALL cell proliferation and PI3K/AKT/mTOR phosphorylation, while also promoting autophagy and apoptosis (Figure 4(C)‐(H)). Data showed that the downregulation of Circ‐PRKDC impeded the proliferation of T‐ALL cells and the phosphorylation of PI3K/AKT/mTOR proteins, and reinforced autophagy and apoptosis in T‐ALL cells by up‐regulating the expression levels of miR‐653‐5p.
Next, we used the StarBase website to investigate the regulatory mechanisms associated with the Circ‐PRKDC/miR‐653‐5p/RELN axis. We found that Circ‐PRKDC could bind with miR‐653‐5p (Figure 5(A)). Dual luciferase reporter gene assays further showed that a miR‐653‐5p mimic destroyed the luciferase activity of WT‐Circ‐PRKDC and not MUT‐Circ‐PRKDC, thus implying that miR‐653‐5p binds specifically to Circ‐PRKDC (Figure 5(B)). Next, we used an RIP assay to determine the interplay between Circ‐PRKDC and miR‐653‐5p and found that the levels of Circ‐PRKDC and miR‐653‐5p were enhanced in Ago2 immunoprecipitates when compared to IgG control groups. These results demonstrate that Circ‐PRKDC acts as a sponge for miR‐653‐5p (Figure 5(C)).
The StarBase website also predicted that miR‐653‐5p and RELN had a targeted relationship (Figure 5(D)). Luciferase activity assays confirmed that the co‐transfection of RELN‐WT and miR‐653‐5p mimic reduced the relative luciferase activity of cells while the co‐transfection of RELN‐MUT and miR‐653‐5p mimic had no influence on the relative luciferase activity of cells (Figure 5(E)). These data show that RELN is directly targeted by miR‐653‐5p.
T‐ALL is a hematological tumor that shows high levels of heterogeneity.22 In this study, we identified the effects of Circ‐PRKDC in T‐ALL. First, we confirmed that the depletion of Circ‐PRKDC impeded proliferation, induced autophagy and apoptosis, and obstructed the activation of the PI3K/AKT/mTOR pathway. Subsequently, we showed that Circ‐PRKDC negatively interacted with miR‐653‐5p, and that the restoration of miR‐653‐5p prevented T‐ALL cell proliferation, while enhancing apoptosis and autophagy. Next, we demonstrated that the depletion of miR‐653‐5p mitigated the influences of Circ‐PRKDC knockdown on T‐ALL cells. Finally, we showed that Circ‐PRKDC sponged miR‐653‐5p to modify the expression of RELN.
The overexpression of Circ‐PRKDC has previously been demonstrated in colorectal cancer (CRC) cells that are resistant to 5‐FU and that the depletion of Circ‐PRKDC suppressed cell colony‐forming and invasive capacities.8 Further studies showed that the up‐regulation of hsa‐Circ‐PRKDC in osteosarcoma elicits cell proliferation, migration, and invasion, but inhibited cell apoptosis by mediating miR‐593‐3p/zinc finger E‐box binding homeobox 2 (ZEB2).23 In breast cancer, the expression of hsa‐Circ‐PRKDC is up‐regulated; the restoration of levels enabled malignant cells to proliferate and arrested cells in the G2/M phase by inhibiting the ability of miR‐1299 to regulate cyclin‐dependent kinase 6.24 Moreover, another study also examined the elevated expression of hsa‐Circ‐PRKDC expression in CRC and found that the suppression of this effect enhanced the aggressive nature of CRC cells and induced G0/G1 phase arrest by sponging miR‐136 to modulate src homology 2 B adaptor protein 1.25
miR‐653‐5p has been shown to act as a regulatory gene for deoxyguanosine kinase antisense RNA 1 and is down‐regulated in cervical cancer; the restoration of miR‐653‐5p was further shown to suppress cell proliferation.11,26 The restoration of miR‐653‐5p expression has also been shown to hamper cell proliferation, invasion, and migration, by targeting retinoic acid‐induced 14 in melanoma.12 At an experimental level, miR‐653‐5p, if sponged by circ‐RAD23B, was shown to give rise to cell invasion in non‐small cell lung cancer via T‐cell lymphoma invasion and metastasis‐inducing protein 1.27 In neuroblastoma, the downregulation of the SNHG7 lncRNA increased the expression levels of miR‐653‐5p to suppress the aggressive activities of malignant cells and arrest cells in the G0/G1 phase.28 Furthermore, the abnormal expression of miR‐653‐5p has been detected in Wilms' tumor; the elevated expression of miR‐653‐5p induced by the knockdown of LINC00858 prevented cells from proliferating and migrating.29 Similarly, the knockdown of hsa‐Circ‐0004771 has been shown to activate miR‐653 expression to negatively regulate ZEB2, thus disrupting proliferation and stimulating apoptosis in breast cancer cells.30
Previous research has shown that the expression of RELN undergoes alterations in T‐ALL31 and that this is likely to be associated with early T‐cell precursors in ALL.13 Due to hypomethylation in the promoter region, the expression of RELN is elevated in multiple myeloma.32 Moreover, previous research has shown that RELN expression is dramatically elevated in Wilms' tumor and encodes the secreted extracellular matrix protein to modulate cell interactions and migration.33 Mechanistically, the depletion of RELN functions to impede the aggressive actions of non‐Hodgkin lymphoma cells and induces G0/G1 phase arrest and apoptosis.34 The overexpression of RELN has also been detected in prostate cancer; miR‐381‐mediated RELN inhibition is capable of enhancing cell apoptosis and autophagy by inactivating the PI3K/AKT/mTOR signaling pathway.14
The PI3K/AKT/mTOR signaling pathway has been proven to regulate autophagy and apoptosis in many forms of cancer. For example, in colorectal cancer, beta‐lactamase‐like upregulation inactivates the PI3K/AKT/mTOR signaling pathway to reinforce cell autophagy via PI3K regulatory subunit 3.35 In gastric adenocarcinoma, the suppression of the PI3K/AKT/mTOR pathway activation is also considered to enhance apoptosis and autophagy in malignant cells.36 In addition, the suppression of pleckstrin homology like domain family A member 2 in colorectal cancer contributes to enhanced cell apoptosis and autophagy by inactivating the PI3K/AKT/mTOR signaling pathway.37 PKI‐402, an inhibitor of the PI3K/mTOR pathway, has also been proven to promote autophagy and result in an imbalance of Bcl‐2 family proteins in ovarian cancer.38
Collectively, our current data show that the silencing of Circ‐PRKDC up‐regulates miR‐653‐5p to depress the expression of RELN expression; this then inactivates the PI3K/AKT/mTOR signaling pathway to facilitate cell apoptosis and autophagy in T‐ALL. This research provides another perspective for the treatment of patients with T‐ALL. Our study focused predominantly on the Circ‐PRKDC/miR‐653‐5p/PI3K/AKT/mTOR axis in T‐AL. Whether this axis exerts functional roles in other cell lineages still needs to be investigated in future research.
We would like to acknowledge the reviewers for their helpful comments on this paper.
The authors declare that they have no conflicts of interest.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2021. This work is published under http://creativecommons.org/licenses/by-nc-nd/4.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
A range of circular (Circ) RNAs have been demonstrated to be of therapeutic significance for the treatment of acute lymphoblastic leukemia (ALL). Here, we investigated the mechanisms underlying the action of Circ‐PRKDC and the microRNA‐653‐5p/Reelin (miR‐653‐5p/RELN) axis in T‐cell ALL (T‐ALL).Clinical specimens were obtained from patients with T‐ALL (n = 39) and healthy controls (n = 30). In each specimen, we determined the expression levels of Circ‐PRKDC, miR‐653‐5p, and RELN. Human T‐ALL cells (Jurkat) were transfected with Circ‐PRKDC‐ or miR‐653‐5p‐related sequences to investigate cell proliferation, apoptosis, and autophagy. We also determined the levels of Circ‐PRKDC, miR‐653‐5p, RELN, and signaling proteins related to phosphoinositide 3‐kinase (PI3K), AKT, and mammalian target of rapamycin (mTOR). Finally, we decoded the interactions between Circ‐PRKDC, miR‐653‐5p, and RELN. The expression levels of Circ‐PRKDC and RELN were upregulated in T‐ALL tissues and cells while the levels of miR‐653‐5p were downregulated. Thereafter, then silencing of Circ‐PRKDC, or the enforced expression of miR‐653‐5p, repressed the expression of RELN and the activation of the PI3K/AKT/mTOR signaling pathway, thus enhancing cell autophagy and apoptosis, and disrupting cell proliferation. Circ‐PRKDC acted a sponge for miR‐653‐5p while miR‐653‐5p targeted RELN. The knockdown of miR‐653‐5p abrogated the silencing of Circ‐PRKDC‐induced effects in T‐ALL cells. The depletion of Circ‐PRKDC elevated miR‐653‐5p to silence RELN‐mediated PI3K/AKT/mTOR signaling activation, thereby enhancing autophagy and apoptosis in T‐ALL cells.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
1 Department of Hematology, The Third Affiliated Hospital of Sun Yat‐sen University, Guangzhou, Guangdong, China