1. Introduction
Fatty acid transport proteins (FATPs) are evolutionarily conserved transmembrane proteins in the fatty acid transport family. FATPs facilitate long-chain fatty acids (LCFA) importing into the cell by translocation at the plasma membrane [1]. In mammals, six different isoforms of FATPs (FATP1–FATP6) showing tissue-specific expression patterns have been identified as playing crucial roles in fatty acid metabolism [2]. FATP1, also known as Solute Carrier Family 27 Member 1 (SLC27A1), was the first reported family member, and is highly expressed in muscle, fat, heart, and liver [3,4], which are all characterized by high fatty acid uptake and rapid fatty acid metabolism. FATP1 may promote LCFA circulation flux. In addition, FATP1 may influence fatty acid metabolism and lipid accumulation by coordinating fatty acid esterification and oxidation [2].
The function and mechanism of action of FATP1 in fatty acid metabolism have been extensively researched in yeast and other cells. In S. cerevisiae, knockout of FATP1 decreased the activities of long chain acyl CoA synthetases [5]. In yeast, overexpression of FATP1 promoted an 8.2-fold increase in the fatty acid transport rate [6]. In 293 cells, FATP1 exerted overall control of triglyceride biosynthesis, and overexpression of FATP1 enhanced fatty acid uptake and increased triglyceride content [7]. In 3T3-L1 adipocytes, knockdown of FATP1 decreased triglyceride accumulation and reduced droplet size [8].
The role of FATP1 in fat deposition and adipocyte differentiation in livestock has also been widely researched. A positive correlation between FATP1 and intramuscular fat deposition has been reported in pig [9]. Moreover, overexpression of FATP1 induced intramuscular preadipocyte proliferation and fat accumulation in pig [10]. FATP1 overexpression also significantly upregulated the expression levels of PPARγ, CEBPα, LPL, PLIN1, and FASN, and downregulated the expression of β-catenin. It was subsequently hypothesized that FATP1 might repress the Wnt,/β-catenin signaling pathway and stimulate adipogenesis in porcine intramuscular preadipocytes [10]. This hypothesis is supported by the results of RNA interference experiments in chicken. Thus, silencing of FATP1 inhibited chicken preadipocyte differentiation and decreased the expression levels of FAS, C/EBPα, and PPARγ in chicken preadipocytes [11]. FATP1 expression levels were also positively correlated with intramuscular fat content in Korean cattle [12]. However, the corresponding mechanism of action has not been further explored in cattle using loss-of-function or gain-of-function experiments.
The bovine FATP1 gene is located on Chromosome 7, and comprised of 14 exons and 13 introns extending over more than 40 kb of genomic DNA [13]. In the present study, we analyzed FATP1 expression patterns in the tissues and adipocytes of Qinchuan cattle. In addition, we explored the effects of FATP1 on preadipocyte differentiation using overexpression and interference assays. DEGs and related signal pathways were identified using RNA-sequencing and data analysis. Our findings help further understanding of the role of FATP1 in adipocyte differentiation and lipid metabolism in bovine.
2. Materials and Methods
2.1. Sample Collection
All animal procedures were approved by the Animal Care and Use Committee of Northwest A&F University (Yangling, China). Three adult male Qinchuan cattle and three newborn male calves were obtained from the National Beef Cattle Improvement Center Farm (Yangling, China). The cattle were humanely euthanized and the following tissues were harvested: heart, spleen, liver, lung, rumen, kidney, reticulum, omasum, small intestine, abomasum, fat, and longissimus dorsi muscle. The harvested samples were rinsed in 1 × PBS, transferred to sterile, DNase and RNase free tubes, snap-frozen in liquid nitrogen, and finally stored at −80 °C for further analysis.
2.2. Chemical Synthesis and Transfection of siRNA
Three complementary pairs of siRNA (siRNA1, siRNA2, siRNA3) oligos (designed to inhibit the expression of the bovine FATP1 gene) and control siRNA (siNC) oligos were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). The specific siRNA sequences are shown in Table 1.
2.3. Construction of FATP1 Overexpression Adenovirus Vector
The CDS for bovine FATP1 was first cloned into a T vector. After digestion with NheI and HindIII, a fragment encoding the FATP1 CDS was then cloned into a pAd-Track shuttle vector. The shuttle vector encoding the FATP1 CDS was subsequently digested with Pme1 enzyme (NEB, Ipswich, MA, USA) to facilitate recombination with the pAdEasy-1 vector. After confirmation of recombination, the recombinant vector was digested with PacI. The linearized vector was then purified, packaged into adenovirus (designed as Ad-FATP1,/Ad-NC), and transfected into HEK 293A cells.
2.4. Bovine Preadipocyte Isolation and Culture
Preadipocytes were isolated from newborn Qinchuan calves as follows. Under sterile conditions, perirenal adipose tissues were collected and washed three times using 1 × PBS containing 1% penicillin/streptomycin. The adipose tissue samples were then sheared into pieces, and two volumes of 1 mg/mL collagenase type I was added (Sigma, Shanghai, China). The samples were then digested with constant shaking at 37 °C for 90 min. After digestion, the mixture was filtered, and cell lysate was added to the filtrate. After centrifugation, the cells were seeded into cell culture dishes containing DMEM/F12 (Gibco, Waltham, MA USA) with 10% FBS (Invitrogen, San Diego, GA, USA) and antibiotics. The cells were then incubated at 37 °C in a cell culture incubator using 5% CO2.
2.5. Preadipocyte Differentiation, Transfection and Infection
Preadipocyte differentiation was induced using induction medium containing DMEM/F12, 10% FBS, 1% antibiotics, 5 μg/mL insulin (Sigma, St. Louis, MO, USA), 1 μm DXMS (Sigma), and 0.5 mm IBMX. After 48 h, preadipocyte differentiation was continued using induction maintenance medium containing DMEM/F12, 10% FBS, 5 μg/mL insulin, and 1% antibiotics. For FATP1 knockdown, cells at 80% confluence were transfected by siRNAs or si-NC using a Lipofectin 3000 transfection kit (Invitrogen, San Diego, GA, USA) according to the manufacturer’s instructions. For overexpression of FATP1, Ad-FATP1 or Ad-NC were used to infect cells at a multiplicity of infection (MOI) of 25.
2.6. Oil Red O Staining
After experimental treatment, cells were washed three times in 1 × PBS, and then fixed for 30 min with 4% paraformaldehyde. The cells were then stained using Oil red O staining solution for 30 min and washed with 1 × PBS. Finally, representative images were obtained using an Olympus IX71 microscope.
2.7. Total RNA Extraction and qRT-PCR Analysis
Total RNA was isolated using TRIzolTM Reagent (Invitrogen, San Diego, GA, USA) according to the manufacturer’s instructions. RNA integrity and RNA concentration were analyzed by 1% agarose gel electrophoresis and UV spectrophotometry. cDNA was synthesized from total RNA using the Prime ScriptTM RT Kit (Takara, Dalian, China). qRT-PCR was performed using the SYBR Green PCR Master Mix Kit (Takara, Biotech, Dalian, China) on a 7500 Real-Time PCR System (Applied Biosystems, Forster City, CA, USA) according to the manufacturer’s recommendations. qRT-PCR primer information is listed in Table 2. Target gene expression levels were analyzed by the 2−ΔΔCt method using ACTB to normalize expression.
2.8. Total Protein Extraction and Western Blotting
Cells were lysed with RIPA (Beyotime, Haimen, China) containing protease inhibitor cocktail (Roche, Indianapolis, IN, USA). Total protein samples (20 µg per well) were resolved by a 12% SDS-PAGE gel. The resolved protein bands were then transferred to PVDF membranes. Next, the PVDF membranes were blocked with fat-free milk (5% w/v), and incubated with primary antibody overnight at 4 °C. The following primary antibodies were used: anti-FATP1 (ab 2759688 ABclonal, Woburn, MA, USA); anti-LPL (bs-2336R Bioss, Beijing, China); anti-FADS2 (bs-11516R Bioss, Beijing, China); and anti-SCD1 (ab236868 Abcam, Waltham, MA, USA). After washing three times with TBST, the membranes were incubated with secondary antibody for 2 h. Finally, the luminescence signals were detected using a ChemiDocTM XRS+ System (Bio-Rad, Hercules, CA, USA).
2.9. RNA Sequencing and Functional Enrichment Analysis of DEGs
Following pre-treatment with Ad-FATP1, Ad-NC, siRNA, and siNC, the preadipocytes (three replicates for each treatment) were induced to differentiate on the fourth day. In total, 12 cell samples (four treatments × three replicates) were harvested for subsequent analysis by RNA-Seq. RNA sequencing analysis was performed by Novogene. After processing of the RNA-Seq results, DEGs were identified using DESeq software. DEGs are defined as genes with |log2 (Fold Change)| ≥ 1.5 and adjusted p ≤ 0.05. Go enrichment analysis and KEGG enrichment analysis of DEGs were implemented by cluster Profiler (3.4.4) software. GO terms with a p value ≤ 0.05 were defined as significantly enriched.
2.10. Statistical Analysis
All data analysis was performed using SPSS 19.0. The data is presented as mean ± SD. The data were analyzed using a Dunnett’s multiple comparison test and one-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01 were used to define statistical significance. All experiments were performed (at least) in triplicate.
3. Results
3.1. FATP1 Expression Patterns in Qinchuan Cattle Tissues and Differentiated Preadipocytes
To explore the expression characteristics of FATP1, we first investigated FATP1 expression levels in the tissues of newborn and adult Qinchuan cattle. FATP1 was widely expressed in all the tissues tested (at both ages). Expression of FATP1 was especially high in heart, kidney, muscle, small intestine, large intestine, and perirenal fat tissues in newborn cattle. In most of the tissues investigated, including spleen, liver, reticulum, abomasum, small intestine, large intestine, muscle, kidney, and heart, FATP1 expression decreased with age (Figure 1A). However, FATP1 expression increased with age in omasum and perirenal fat tissues (Figure 1A). Next, we investigated FATP1 expression levels every two days during adipocyte differentiation. FATP1 expression was relatively stable during differentiation until the fourth day, at which time FATP1 expression increased sharply (Figure 1B).
3.2. Overexpression of FATP1 Promotes Preadipocyte Differentiation in Qinchuan Cattle
To further explore the role of FATP1 in preadipocyte differentiation, Ad-FATP1 was constructed and used to infect preadipocytes (MOI, 25). The infected cells were then induced to differentiate until the 8th day. qRT-PCR analysis revealed that Ad-FATP1 significantly promoted the expression of FATP1 during differentiation, inducing a greater than 1100-fold increase in FATP1 mRNA expression (in comparison with NC) by the 4th day (Figure 2A). Furthermore, Oil Red O staining provided evidence that FATP1 overexpression markedly and stably promoted lipid droplet formation (Figure 2B).
Preadipocyte differentiation into mature adipocytes is also known to involve additional marker genes. To further investigate preadipocyte differentiation, the expression levels of PPARG, a marker gene of adipogenic differentiation [9], and LPL, a marker gene of lipid metabolism [10,11], were analyzed by qRT-PCR. The results reveal that overexpression of FATP1 up-regulated the expression of these two genes at the 4th day of differentiation (Figure 2C). Thus, overexpression of FATP1 increased LPL and PPARG expression levels, promoted the differentiation of preadipocytes, and promoted lipid deposition in Qinchuan cattle.
3.3. Interference of FATP1 Expression Inhibits Preadipocyte Differentiation in Qinchuan Cattle
Three FATP1 siRNAs were synthesized and transfected into preadipocytes, and the siRNA with the highest interference efficiency was selected for further FATP1 knockdown experiments. All three siRNAs dramatically decreased the expression of FATP1 (Figure S1). siRNA3 (interference efficiency, 90%) was selected for further FATP1 knockdown experiments (and is henceforth referred to as si-FATP1).
Preadipocytes were infected with si-FATP1 and the cells were then induced to differentiate. qRT-PCR analysis demonstrated that si-FATP1 significantly decreased the expression of FATP1 during adipocyte differentiation (Figure 3A). Oil red O staining revealed that knockdown of FATP1 significantly reduced the number of lipid droplets in preadipocytes (Figure 3B). The expression levels of several adipocyte differentiation marker genes were also analyzed following interference of FATP1. qRT-PCR analysis demonstrates that the expression levels of CEBPB (encoding C/EBP-β) and LPL were significantly decreased following interference of FATP1. Thus, interference of FATP1 inhibited the expression of LPL and CEBPB, suppressed adipocyte differentiation, and decreased lipid deposition in Qinchuan cattle.
3.4. Transcriptome Sequencing and Annotation of DEGs
To further explore the effects of FATP1 gene expression on preadipocyte differentiation and lipid deposition in Qinchuan cattle, preadipocyte cells were infected/transfected with Ad-FATP1, Ad-NC, siRNA, and si-NC. Two days after infection/transfection, the preadipocytes were induced to differentiate. The preadipocyte cells were then harvested on the 4th day of differentiation. Each of the four treatments (Ad-FATP1, Ad-NC, siRNA, and si-NC) was replicated three times, producing a total of 12 samples. All 12 samples were then analyzed by RNA-Seq.
Genes that were differentially expressed between treatments (Ad-FATP1, Ad-NC, siRNA, and si-NC) were identified using DESeq2. DEGs were screened using an adjusted p ≤ 0.05 and a |log2 (Fold Change)| ≥ 1.5. In total, 1496 genes were identified as DEGs. Three DEGs were up-regulated by si-FATP1 and down-regulated by Ad-FATP1 (PSAT1, TNFSF18, and ENSBTAG00000040427). In addition, twenty-five DEGs were up-regulated by Ad-FATP1 and down-regulated by si-FATP1 (Figure 4). Of these 28 DEGs, the functions of 14 genes were related to adipogenic differentiation and lipid deposition. To illustrate the expression patterns of DEGs in the different treatments, heatmaps were generated for individual samples (Figure 5A) and for groups of samples (Figure 5B). A comparison of Figure 5A,B reveals that the expression levels of the most dysregulated genes were consistent across all three replicates. These results also demonstrate that overexpression of FATP1 has a greater influence on DEGs (compared with FATP1 silencing).
To further explore the functions of DEGs, GO function enrichment analysis and KEGG pathway analysis were conducted. In the FATP1 overexpression group, DEGs were associated with various GO terms, including unsaturated fatty acid metabolic process, dense core granule, receptor regulator activity (Figure 6A), and with the PPAR signaling pathway (Figure 7A and Figure 8A). In the FATP1 silencing group, DEGs were associated with several different GO Terms, including carbohydrate metabolic process, extracellular structure organization, monosaccharide binding (Figure 6B), and with several pathways, including the AMPK signaling pathway and the Insulin signaling pathway (Figure 7B and Figure 8B,C).
3.5. Validation and Dynamic Expression of DEGs in the Adipocytes of Qinchuan Cattle
To validate the RNA-seq and functional analysis results for DEGs, several DEGs associated with adipocyte differentiation and fat deposition were selected for further analysis. The expression levels of these genes in adipocytes treated with Ad-FATP1, Ad-NC, siRNA, and siNC were analyzed by qRT-PCR using ACTB as an internal reference gene. qRT-PCR analysis revealed that the expression levels of SLPI, STC1, SEMA6A, TNFRSF19, SLN, PTGS2, ADCYP1, FADS2, and SCD were significant up-regulated by overexpression of FATP1 (Figure 9). In contrast, the expression levels of SLPI, STC1, SEMA6A, TNFRSF19, SLN, HOXA4, ADCYP1, FADS2, SCD, and CREM were significantly down-regulated by silencing of FATP1 (Figure 10). Together, these qRT-PCR results agree with and validate the results of our RNA-seq analysis.
In addition, the protein expression levels of four key DEGs were investigated by western analysis following FATP1 overexpression and FATP1 interference in adipocytes. While FATP1 overexpression promoted FADS2, LPL, and SCD protein levels, FATP1 interference reduced FADS2, LPL, and SCD protein levels (Figure 11). These results are consistent with our analyses of mRNA expression levels by RNA-seq and qRT-PCR. To further understanding of the effects of FATP1 expression levels on these proteins, we analyzed their dynamic expression during differentiation following infection,/transfection with Ad-FATP1 or si-FATP1. While overexpression of FATP1 promoted the expression of LPL, FADS2, and SCD during differentiation, silencing of FATP1 inhibited their expression (Figure 12).
4. Discussion
In the present study, our analyses of FATP1 expression patterns demonstrate that FATP1 was highly expressed in heart, kidney, muscle, and adipose tissues. These results are consistent with previous reports from human and mouse studies indicating that FATP1 is highly expressed in tissues exhibiting rapid fatty acid metabolism, including muscle, heart, and adipose tissue [3,4]. Our results also reveal that FATP1 was highly expressed in the perirenal fat tissue of adult and infant Qinchuan cattle. Moreover, FATP1 expression levels were demonstrated to increase during adipocyte differentiation (especially in the early stages of differentiation). The observed expression patterns of FATP1 in fat tissue and during adipocytic differentiation indicate that FATP1 may play a crucial role in fat formation in Qinchuan cattle.
To further elucidate the function of FATP1 during adipogenesis in Qinchuan cattle, overexpression and interference assays were employed. Although FATP1 gain,/loss of function could be demonstrated following FATP1 overexpression,/interference, FATP1 was observed to play a role in adipocyte differentiation under both assay conditions. FATP1 overexpression was demonstrated to increase deposition of lipid droplets and to up-regulate the expression of lipid metabolism-related genes, including LPL and PPARG. In contrast, FATP1 interference was demonstrated to decrease deposition of lipid droplets and to down-regulate expression of lipid metabolism-related genes. Together, these results provide evidence that the FATP1 gene plays a regulatory role in adipogenic differentiation and lipid deposition in Qinchuan cattle. This conclusion is consistent with previous research on porcine intramuscular preadipocytes and chicken preadipocytes [10,11].
To unravel the role of FATP1 in adipocyte differentiation, RNA-Seq analysis was conducted on FATP1 overexpression,/interference cell models. Using a |log2 (Fold Change)| ≥ 1.5 and a p ≤ 0.05 as screening conditions, DEGs in the overexpression and interference groups were identified. These DEGs were then sorted into an up-regulated gene set and a down-regulated gene set. In addition, we identified the gene set up-regulated by Ad-FATP1 and down-regulated by si-FATP1, and the gene set up-regulated by si-FATP1 and down-regulated by Ad-FATP1. In total, 28 genes in these two gene sets were identified. Finally, we identified all the genes within these two gene sets whose functions are related to adipogenic differentiation and fat deposition. These were observed to include SLPI, STC1, EMA6A, TNFRSF19, SLN, PTGS2, ADCYP1, FADS2, SCD, HOXA4, and CREM.
SLPI (secretory leukocyte protease inhibitor) is known to suppress proinflammatory responses through inhibition of NF-κB signaling, and also to demonstrate immuno-modulatory activities on inflammatory diseases [14]. In addition, SLPI has been demonstrated to play a role in obesity, with one study reporting that SLPI constrained obesity by increasing browning—SLPI levels were positively correlated with browning and negatively correlated with obesity [15].
Tumor necrosis factor receptor superfamily (TNFRSF) members are glycoproteins with a single transmembrane region, a cysteine-rich extracellular ligand binding domain, and a diverse cytoplasmic tail. TNFRSF19 is up-regulated by the Wnt signaling pathway and down-regulated by C/EBP. TNFRSF19 is known to inhibit adipogenic differentiation and thus function as a negative regulator of adipocyte differentiation. TNFRSF19 overexpression,/knockdown was also observed to significantly decrease,/increase adipogenesis [16].
ADCYAP1 is known to play roles in glucose and energy homeostasis [17], and in the regulation of lipid metabolism [18]. In an ADCYAP1 knockout mouse model, white adipose tissue (e.g., epididymal, retroperitoneal, and abdominal subcutaneous adipose tissues) was significantly reduced in size and mass. In addition, the expression levels of AP2 (encoding the fatty acid binding protein aP2), an important marker gene for adipocyte differentiation, were decreased after ADCYAP1 knockout. The results obtained with the ADCYAP1 knockout mouse model demonstrate the important role played by ADCYAP1 in lipid metabolism and regulation of body weight [19].
Fatty acid desaturase 2 (FADS2) is a member of the fatty acid desaturase protein family. FADS2 catalyzes the desaturation reaction during long chain (≥C20) polyunsaturated fatty acid (LC-PUFA) synthesis, and is pivotal in LC-PUFA biosynthesis and maintaining LC-PUFA homeostasis [20]. Genetic studies have revealed that a polymorphism in the FADS2 gene affects the fatty acid composition of bovine milk by modifying mir-744 binding [21,22]. In addition, PUFAs were found to have a direct effect on FADS2 expression in differentiated 3T3-L1 adipocytes [23]. Research on the mechanism of action of FADS2 in human and mouse found that FADS2 was the target of mTOR and SREBP signaling. While activation of the mTORC1 signaling pathway increased FADS2 expression, inhibition reduced FADS2 expression. Likewise, overexpression of SREBP-1/2 increased FADS2 expression [24]. SREBP-1 and PPARα were both demonstrated to up-regulate FADS2 promoter activity in a Luciferase reporter assay [25].
Stearoyl-CoA Desaturase 1 (SCD1) is a key regulator of de novo lipogenesis, acting as a rate-limiting enzyme. SCD1 catalyzes the synthesis of MUFAs. Loss of SCD1 potentiates beige adipocyte formation in mice and SCD1 deficiency can induce adipose-derived mesenchymal stem cells to differentiate into beige adipocytes [26]. Overexpression of SCD1 in the subcutaneous adipose tissues of mouse revealed that SCD1 can upregulate lipases and induce lipolysis, further promoting energy expenditure and fat mobilization. Furthermore, SCD1 knockdown inhibited lipolysis in adipocytes by down-regulating lipases and reducing lipophagy. BMP4 was also demonstrated to be a crucial factor regulating SCD1 expression, up-regulating SCD1 expression through the Smad pathway [27].
Lipoprotein lipase (LPL) is a multifunctional enzyme that plays a pivotal role in lipid transport and metabolism [28], especially in the hydrolysis of triglycerides [29]. LPL expression is known to be regulated in a tissue-specific manner. Moreover, nutrient levels and hormonal states also have a profound effect on LPL expression. LPL is also an important marker gene for adipocyte differentiation, and LPL expression levels increase with triglyceride accumulation during preadipocyte differentiation [30]. In addition, LPL is essential for fatty acid storage and uptake during 3T3-L1 preadipocyte differentiation [31]. When LPL expression is inhibited, the absorption of exogenous lipids is hindered, thus affecting the deposition of fat [32].
Taken together, the research described above provides evidence that the aforementioned genes are involved in fat deposition and fatty acid metabolism directly or indirectly. In the present study, we used qRT-PCR to validate the effects of FATP1 on the expression of these genes through FATP1 overexpression and FATP1 silencing. These results are also consistent with our RNA-seq results, providing further support for the view that FATP1 influences the expression of key genes and regulates adipocyte differentiation and fatty acid metabolism. Additional research is required to explore the mechanism of action by which FATP1 regulates these adipogenic genes.
5. Conclusions
In summary, we demonstrate that FATP1 is extensively expressed in the tissues and differentiating adipocytes of Qinchuan cattle. While FATP1 overexpression promoted preadipocyte differentiation in Qinchuan cattle, FATP1 interference demonstrated the opposite effect. Through RNA-seq analysis of adipocytes in which FATP1 was overexpressed,/silenced, we were able to identify DEGs related to fat metabolism. The genes in this set included SLPI, STC1, SEMA6A, TNFRSF19, SLN, PTGS2, ADCYP1, FADS2, and SCD. Functional annotation revealed that these DEGs were enriched in the PPAR signaling pathway, AMPK signal pathway, and Insulin signaling pathway. These findings provide evidence that FATP1 is a candidate gene for the regulation of fat deposition and fatty acid metabolism in cattle and might devote to beef cattle breeding.
X.L., S.L., L.W., W.Z., Y.W., L.G.: Methodology, Data analysis, Writing—original draft. L.Z., C.Z.: Conceptualization, Design, Funding acquisition, Resources, Supervision, Writing—review and editing. All authors have read and agreed to the published version of the manuscript.
This research was funded by Sci & Tech Innovation Project Shaanxi Academy of Forestry (SXLK2020-0102), China Postdoctoral Science Foundation (2016M590977), Shaanxi Key Research and Development Program (2018ZDXM-NY-046), National Key Research and Development Program of China (2018YFD0501700), National Modern Agricultural Industry Technology System (CARS-37), Technology Innovation and Achievement Transformation for the Demonstration Station of Northwest A&F University (TGZX2019-22).
All the animal handling experimental procedures were carried out according to the guidelines laid by the China Council on Animal Care, and this research was approved and reviewed by the Experimental Animal Management Committee (EAMC) of Northwest A&F University.
The authors declare no conflict of interest.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Enlarge this image.Figure 1. Expression of FATP1 in tissues and during preadipocyte differentiation in Qinchuan cattle. (A) FATP1 mRNA levels in tissues (n = 3). (B) FATP1 mRNA levels at day 0 (D0), day 2 (D2), day 4 (D4), day (D6), day 8 (D8) and day 10 (D10) after preadipocyte differentiation. * p ≤ 0.05, ** p ≤ 0.01 adult versus newborn (A) and D2 (D4, D6, D8, D10) versus D0 (B).
Enlarge this image.Figure 2. Overexpression of FATP1 promotes preadipocyte differentiation in Qinchuan cattle. (A) FATP1 mRNA levels in adipocytes infected with Ad-FATP1, Ad-NC at day 4 (D4), day (D6) and day 8 (D8) after differentiation (n = 3). (B) Adipocytes infected with Ad-FATP1,/Ad-NC at the 4th day of differentiation. (C) LPL and PPARG mRNA levels in adipocytes infected with Ad-FATP1,/Ad-NC at the 4th day after differentiation (n = 3). * p ≤ 0.05.
Enlarge this image.Figure 3. Interference of FATP1 inhibits preadipocyte differentiation in Qinchuan cattle. (A) mRNA levels in adipocytes infected with si-FATP1, si-NC at day 4 (D4), day (D6) and day 8 (D8) after differentiation (n = 3). (B) Adipocytes infected with si-FATP1, si-NC at the 4th day of differentiation. (C) LPL and CEBPB mRNA levels in adipocytes infected with si-FATP1, si-NC at the 4th day of differentiation (n = 3). * p ≤ 0.05, ** p ≤ 0.01.
Enlarge this image.Figure 4. DEGs identified by RNA-seq analysis and DESeq2 following FATP1 overexpression, silencing with Ad-FATP1, Ad-NC or si-FATP1, si-NC, respectively. DEGs were selected using an adjusted p ≤ 0.05 and a |log2 (Fold Change)| ≥ 1.5. The numbers in the Venn diagram illustrate overlapping DEGs between groups. Genes related to adipocyte differentiation or lipid metabolism are shown in yellow.
Enlarge this image.Figure 5. Heat maps of DEGs following FATP1 overexpression, silencing with Ad-FATP1, Ad-NC or si-FATP1, si-NC, respectively. Abscissa, sample name. Ordinate, normalized value of the differential gene (FPKM). The redder the color, the higher the expression level. The greener the color, the lower the expression level. (A) Clustered by individual sample. (B) Clustered by grouped sample.
Enlarge this image.Figure 6. The most significant GO terms enriched within the DEGs following FATP1 overexpression, silencing with Ad-FATP1, Ad-NC or si-FATP1, si-NC, respectively. (A) GO terms of DEGs identified following FATP1 overexpression. (B) GO terms of DEGs identified following FATP1 interference. BP (biological processes), CC (cell components), MF (molecular functions).
Enlarge this image.Figure 7. The KEGG pathways database was used to analyze pathways significantly enriched in DEGs following FATP1 overexpression/silencing with Ad-FATP1/Ad-NC or si-FATP1/si-NC, respectively. The top 20 pathways are shown. The size of each dot represents the number of genes annotated to the KEGG pathway. The color (ranging from red to purple) represents the significance of the enrichment. (A) The KEGG pathways of DEGs identified following FATP1 overexpression. (B) The KEGG pathways of DEGs identified following FATP1 interference.
Enlarge this image.Figure 8. KEGG pathways enriched in DEGs following FATP1 overexpression, silencing with Ad-FATP1, Ad-NC or si-FATP1, si-NC, respectively. Red, up-regulation; Green, down-regulation. (A) PPAR signaling pathway DEGs in the FATP1 overexpression group. (B) AMPK signal pathway DEGs in the FATP1 interference group. (C) Insulin signaling pathway DEGs in the FATP1 interference group.
Enlarge this image.Figure 9. Validation of DEGs by qRT-PCR at the 4th day of differentiation in the FATP1 overexpression group infected with Ad-FATP1, Ad-NC (n = 3). (A) SLPI; (B) STC1; (C) SEMA6A; (D) TNFRSF19; (E) SLN; (F) PTGS2; (G) ADCYP1; (H) FADS2; (I) SCD. * p ≤ 0.05, ** p ≤ 0.01.
Enlarge this image.Figure 10. Validation of DEGs by qRT-PCR at the 4th day of differentiation in interference group infected with si-FATP1/si-NC (n = 3). (A) SLPI; (B) STC1; (C) SEMA6A; (D) TNFRSF19; (E) SLN; (F) HOXA4; (G) ADCYP1; (H) FADS2; (I) SCD; (J) CREM. * p ≤ 0.05, ** p ≤ 0.01.
Enlarge this image.Figure 11. Western blotting of β-actin, FATP1, FADS2, LPL, and SCD at the 4th day of differentiation after FATP1 overexpression and FATP1 interference with Ad-FATP1/Ad-NC or si-FATP1/si-NC, respectively.
Enlarge this image.Figure 12. FADS2, LPL, and SCD expression levels during adipocyte differentiation following FATP1 overexpression and FATP1 interference. (A–C) FATP1 overexpression with Ad-FATP1/Ad-NC; (D–F) FATP1 interference with si-FATP1/si-NC. * p ≤ 0.05, ** p ≤ 0.01.
The sequences of siRNAs for interference of bovine FATP1.
| siRNA Name | Sequence |
|---|---|
| siRNA1 |
5′-3′ CCAACGCUGUGGCCAACUUTT |
The primer sequences for qRT-PCR.
| Primer | Sequence (5′-3′) | Fragment Size (bp) |
|---|---|---|
| FATP1-F | AAGAGCCTGGTCAACTG | 186 |
| FATP1-R | TAGGAGTAGTGCCCTGC | |
| β-actin-F | CATCAATGAGCGTCGGTTCC | 147 |
| β-actin-R | CCGTGGCGTAGCAGAGGTC | |
| PPAR-γ-F | GAGATGAGTACACACGCCAAG | 216 |
| PPAR-γ-R | GGGCTAAAGTCCATCACCAA | |
| LPL-F | GATGATGCGGATTTTGTAGACG | 156 |
| LPL-R | GTTGGAAAGTGCCTCCGTTAG | |
| C/EBP-β-F | TTCCTCTCCGACCTCTTCTC | 173 |
| C/EBP-β-R | CCAGACTCACGTAGCCGTACT | |
| SLPI-F | AGACGACCAGTGCGTAGGTA | 143 |
| SLPI-R | TCCCAAACGGCAGGAATCAG | |
| STC1-F | AGTGATTCGCTGCCTCAACA | 107 |
| STC1-R | CTCCTGGACTTCGGCAATCA | |
| AKR1C1-F | TCGATGGCCTCAACAGCAAT | 186 |
| AKR1C1-R | TGGGGAAGACAAGAATCAATGC | |
| SEMA6A-F | GGGCTGCTTTCCCAGAAGAT | 209 |
| SEMA6A-R | TATGGTCCCTGGCAGCAATG | |
| HOXA4-F | AGAAGATCCATGTCAGCGCC | 194 |
| HOXA4-R | CGGGTCAGGTAGCGGTTAAA | |
| TNFRSF19-F | GCTAGTGAGGAGCCGACCC | 174 |
| TNFRSF19-R | TCTGTTGCCTGAGTAGCACG | |
| SLN-F | CAGCCCAGTGTGTCCTTGAC | 216 |
| SLN-R | AGGCAAACTTCTGAGGGCAC | |
| PTGS2-F | TTGGCTACGGGAACACAACA | 159 |
| PTGS2-R | AAGGGGATGCCAGTGGTAGA |
Supplementary Materials
The following are available online at
References
1. Arif, A.; Terenzi, F.; Potdar, A.A.; Jia, J.; Sacks, J.; China, A.; Halawani, D.; Vasu, K.; Li, X.; Brown, J.M. et al. Eprs is a critical mtorc1-S6k1 effector that influences adiposity in mice. Nature; 2017; 542, pp. 357-361. [DOI: https://dx.doi.org/10.1038/nature21380] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28178239]
2. Huang, J.; Zhu, R.; Shi, D. The Role of Fatp1 in Lipid Accumulation: A Review. Mol. Cell Biochem.; 2021; 476, pp. 1897-1903. [DOI: https://dx.doi.org/10.1007/s11010-021-04057-w] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33486652]
3. Martin, G.; Nemoto, M.; Gelman, L.; Geffroy, S.; Najib, J.; Fruchart, J.C.; Roevens, P.; de Martinville, B.; Deeb, S.; Auwerx, J. The Human fatty acid transport protein-1 (SLC27A1; FATP-1) Cdna and gene: Organization, chromosomal localization, and expression. Genomics; 2000; 66, pp. 296-304. [DOI: https://dx.doi.org/10.1006/geno.2000.6191] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/10873384]
4. Schaffer, J.E.; Lodish, H.F. Expression cloning and characterization of a novel adipocyte long chain fatty acid transport protein. Cell; 1994; 79, pp. 427-436. [DOI: https://dx.doi.org/10.1016/0092-8674(94)90252-6]
5. Watkins, P.A.; Lu, J.F.; Steinberg, S.J.; Gould, S.J.; Smith, K.D.; Braiterman, L.T. Disruption of the saccharomyces cerevisiae fat1 gene decreases very long-chain fatty acyl-coa synthetase activity and elevates intracellular very long-chain fatty acid concentrations. J. Biol. Chem.; 1998; 273, pp. 18210-18219. [DOI: https://dx.doi.org/10.1074/jbc.273.29.18210] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/9660783]
6. DiRusso, C.C.; Li, H.; Darwis, D.; Watkins, P.A.; Berger, J.; Black, P.N. Comparative biochemical studies of the murine fatty acid transport proteins (fatp) expressed in yeast. J. Biol. Chem.; 2005; 280, pp. 16829-16837. [DOI: https://dx.doi.org/10.1074/jbc.M409598200]
7. Hatch, G.M.; Smith, A.J.; Xu, F.Y.; Hall, A.M.; Bernlohr, D.A. Fatp1 channels exogenous Fa into 1,2,3-Triacyl-Sn-Glycerol and down-regulates sphingomyelin and cholesterol metabolism in growing 293 cells. J. Lipid Res.; 2002; 43, pp. 1380-1389. [DOI: https://dx.doi.org/10.1194/jlr.M200130-JLR200] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/12235169]
8. Lobo, S.; Wiczer, B.M.; Smith, A.J.; Hall, A.M.; Bernlohr, D.A. Fatty acid metabolism in adipocytes: Functional analysis of fatty acid transport proteins 1 and 4. J. Lipid Res.; 2007; 48, pp. 609-620. [DOI: https://dx.doi.org/10.1194/jlr.M600441-JLR200] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17164224]
9. Qi, R.; Chen, Y.; Peng, H.; Liu, Y.; Huang, J.; Yang, F. Fatty acid transport protein 1: Expression pattern in different tissues of rongchang pigs and correlation with intramuscular fat deposition. Chin. J. Anim. Nutr.; 2014; 26, pp. 2730-2735.
10. Chen, X.; Luo, Y.; Wang, R.; Zhou, B.; Huang, Z.; Jia, G.; Zhao, H.; Liu, G. Effects of fatty acid transport protein 1 on proliferation and differentiation of porcine intramuscular preadipocytes. Anim. Sci. J.; 2017; 88, pp. 731-738. [DOI: https://dx.doi.org/10.1111/asj.12701] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27616431]
11. Qi, R.; Feng, M.; Tan, X.; Gan, L.; Yan, G.; Sun, C. Fatp1 silence inhibits the differentiation and induces the apoptosis in chicken preadipocytes. Mol. Biol. Rep.; 2013; 40, pp. 2907-2914. [DOI: https://dx.doi.org/10.1007/s11033-012-2306-4]
12. Jeong, J.; Kwon, E.G.; Im, S.K.; Seo, K.S.; Baik, M. Expression of fat deposition and fat removal genes is associated with intramuscular fat content in longissimus dorsi muscle of korean cattle steers1. J. Anim. Sci.; 2012; 90, pp. 2044-2053. [DOI: https://dx.doi.org/10.2527/jas.2011-4753]
13. Ordovás, L.; Roy, R.; Zaragoza, P.; Rodellar, C. Structural and functional characterization of the bovine solute carrier family 27 member 1 (SLC27A1) gene. Cytogenet. Genome Res.; 2006; 115, pp. 115-122. [DOI: https://dx.doi.org/10.1159/000095230] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17065791]
14. Majchrzak-Gorecka, M.; Majewski, P.; Grygier, B.; Murzyn, K.; Cichy, J. Secretory Leukocyte Protease Inhibitor (Slpi), a Multifunctional Protein in the Host Defense Response. Cytokine Growth Factor Rev.; 2016; 28, pp. 79-93. [DOI: https://dx.doi.org/10.1016/j.cytogfr.2015.12.001] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26718149]
15. Liu, C.; Wang, J.; Wei, Y.; Zhang, W.; Geng, M.; Yuan, Y.; Chen, Y.; Sun, Y.; Chen, H.; Zhang, Y. et al. Fat-specific knockout of mecp2 upregulates slpi to reduce obesity by enhancing browning. Diabetes; 2020; 69, pp. 35-47. [DOI: https://dx.doi.org/10.2337/db19-0502] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31597640]
16. Qiu, W.; Hu, Y.; Andersen, T.E.; Jafari, A.; Li, N.; Chen, W.; Kassem, M. Tumor necrosis factor receptor superfamily member 19 (tnfrsf19) regulates differentiation fate of human mesenchymal (stromal) stem cells through canonical wnt signaling and C/Ebp. J. Biol. Chem.; 2010; 285, pp. 14438-14449. [DOI: https://dx.doi.org/10.1074/jbc.M109.052001] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20223822]
17. Yada, T.; Sakurada, M.; Ihida, K.; Nakata, M.; Murata, F.; Arimura, A.; Kikuchi, M. Pituitary adenylate cyclase activating polypeptide is an extraordinarily potent intra-pancreatic regulator of insulin secretion from islet beta-cells. J. Biol. Chem.; 1994; 269, pp. 1290-1293. [DOI: https://dx.doi.org/10.1016/S0021-9258(17)42256-3]
18. Gray, S.L.; Cummings, K.J.; Jirik, F.R.; Sherwood, N.M. Targeted disruption of the pituitary adenylate cyclase-activating polypeptide gene results in early postnatal death associated with dysfunction of lipid and carbohydrate metabolism. Mol. Endocrinol.; 2001; 15, pp. 1739-1747. [DOI: https://dx.doi.org/10.1210/mend.15.10.0705]
19. Tomimoto, S.; Ojika, T.; Shintani, N.; Hashimoto, H.; Hamagami, K.; Ikeda, K.; Nakata, M.; Yada, T.; Sakurai, Y.; Shimada, T. et al. Markedly reduced white adipose tissue and increased insulin sensitivity in adcyap1-deficient mice. J. Pharmacol. Sci.; 2008; 107, pp. 41-48. [DOI: https://dx.doi.org/10.1254/jphs.FP0072173] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18446003]
20. Zhao, Y.; Yang, G.; Wu, N.; Cao, X.; Gao, J. Integrated transcriptome and phosphoproteome analyses reveal that fads2 is critical for maintaining body lc-pufa homeostasis. J. Proteom.; 2020; 229, 103967. [DOI: https://dx.doi.org/10.1016/j.jprot.2020.103967]
21. Proskura, W.S.; Liput, M.; Zaborski, D.; Sobek, Z.; Yu, Y.H.; Cheng, Y.H.; Dybus, A. The effect of polymorphism in the fads2 gene on the fatty acid composition of bovine milk. Arch. Anim. Breed; 2019; 62, pp. 547-555. [DOI: https://dx.doi.org/10.5194/aab-62-547-2019]
22. Li, M.; Lu, X.; Gao, Q.; Wang, M.; Arbab, A.A.I.; Sun, Y.; Chen, Z.; Zhang, H.; Karrow, N.A.; Yang, Z. et al. A functional 3′ utr polymorphism of fads2 affects cow milk composition through modifying mir-744 binding. Animals; 2019; 9, 1090. [DOI: https://dx.doi.org/10.3390/ani9121090]
23. Ralston, J.C.; Matravadia, S.; Gaudio, N.; Holloway, G.P.; Mutch, D.M. Polyunsaturated fatty acid regulation of adipocyte fads1 and fads2 expression and function. Obesity; 2015; 23, pp. 725-728. [DOI: https://dx.doi.org/10.1002/oby.21035] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25755223]
24. Triki, M.; Rinaldi, G.; Planque, M.; Broekaert, D.; Winkelkotte, A.M.; Maier, C.R.; Raman, S.J.; Vandekeere, A.; van Elsen, J.; Orth, M.F. et al. Mtor signaling and srebp activity increase fads2 expression and can activate sapienate biosynthesis. Cell Rep.; 2020; 31, 107806. [DOI: https://dx.doi.org/10.1016/j.celrep.2020.107806] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32579932]
25. Dong, X.; Tan, P.; Cai, Z.; Xu, H.; Li, J.; Ren, W.; Xu, H.; Zuo, R.; Zhou, J.; Mai, K. et al. Regulation of fads2 transcription by srebp-1 and ppar-α influences lc-pufa biosynthesis in fish. Sci. Rep.; 2017; 7, 40024. [DOI: https://dx.doi.org/10.1038/srep40024] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28067297]
26. Liu, K.; Lin, L.; Li, Q.; Xue, Y.; Zheng, F.; Wang, G.; Zheng, C.; Du, L.; Hu, M.; Huang, Y. et al. Scd1 controls de novo beige fat biogenesis through succinate-dependent regulation of mitochondrial complex Ii. Proc. Natl. Acad. Sci. USA; 2020; 117, pp. 2462-2472. [DOI: https://dx.doi.org/10.1073/pnas.1914553117] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31953260]
27. Zou, Y.; Wang, Y.N.; Ma, H.; He, Z.H.; Tang, Y.; Guo, L.; Liu, Y.; Ding, M.; Qian, S.W.; Tang, Q.Q. Scd1 promotes lipid mobilization in subcutaneous white adipose tissue. J. Lipid Res.; 2020; 61, pp. 1589-1604. [DOI: https://dx.doi.org/10.1194/jlr.RA120000869]
28. Eckel, R.H. Lipoprotein lipase. A multifunctional enzyme relevant to common metabolic diseases. N. Engl. J. Med.; 1989; 320, pp. 1060-1068.
29. Goldberg, I.J.; Merkel, M. Lipoprotein lipase: Physiology, biochemistry, and molecular biology. Front. Biosci.; 2001; 6, pp. D388-D405.
30. Semenkovich, C.F.; Wims, M.; Noe, L.; Etienne, J.; Chan, L. Insulin regulation of lipoprotein lipase activity in 3t3-L1 Adipocytes is mediated at posttranscriptional and posttranslational levels. J. Biol. Chem.; 1989; 264, pp. 9030-9038. [DOI: https://dx.doi.org/10.1016/S0021-9258(18)81898-1]
31. Gonzales, A.M.; Orlando, R.A. Role of adipocyte-derived lipoprotein lipase in adipocyte hypertrophy. Nutr. Metab.; 2007; 4, 22. [DOI: https://dx.doi.org/10.1186/1743-7075-4-22] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17971230]
32. Wu, Z.; Ma, H.; Wang, L.; Song, X.; Zhang, J.; Liu, W.; Ge, Y.; Sun, Y.; Yu, X.; Wang, Z. et al. Tumor suppressor Zhx2 inhibits nafld-hcc progression via blocking lpl-mediated lipid uptake. Cell Death Differ.; 2020; 27, pp. 1693-1708. [DOI: https://dx.doi.org/10.1038/s41418-019-0453-z] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31740790]
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.