1. Introduction
Strawberry fruit (Fragaria spp.) is highly appreciated by consumers around the world and represents one of the most profitable crops of the Rosaceae family, whether in a fresh or processed form [1,2] (
Among the most devastating pathogens in strawberry are fungi, with more than 50 different genera affecting this species [11,12]. Some of the major fungus-caused diseases include red stele disease (Phytophthora fragariae), Verticillium wilt (Verticillium spp.), gray mold (Botrytis cinerea), and anthracnose (Colletotrichum spp.). Under climate change, trends in the spread of crop pests and pathogens into new environments are increasing [13] and warmer temperatures have a dramatic effect on crop protection strategies, since it is affecting pathogen distribution and lifestyle and crop fitness and phenology [14]. At present, the global control of pathogens and pests of strawberry is mainly based on soil sterilization with fungicides, but their effectiveness for controlling diseases in fruiting fields is unclear [15]. Furthermore, plant protection products currently in use to protect strawberry and other crops are known to have potential undesirable side effects on human health and the environment and many of them will be phased out in the near future due to the increasing demand to reduce its application to crops [16,17,18,19,20]. Thus, it is of great interest to accelerate genetic resistance in this crop, since management of strawberry is expected to become more difficult under the influence of climate change and globalization.
Breeding for the improvement of strawberry is costly and time- and resource-intensive. Indeed, the genome of cultivated strawberry Fragaria × ananassa is octoploid, hampering traditional breeding, since many important traits, such as disease resistance, firmness, or taste, and aroma (among others), may be under the influence of multiple loci scattered over several subgenomes [21]. Over the past decade, a great effort has been made to unravel the genetic background of this species to help identify traits and associated genes of interest more quickly. The genome of F. vesca (diploid wild strawberry) has been completely sequenced and assembled, and subsequently, this genome information has been improved and reannotated [22,23,24,25,26,27]. Additionally, the genome of F. × ananassa (the octoploid cultivated species) cv. Camarosa has been completely sequenced and annotated, revealing its diploid progenitor species: F. vesca (subsp. Bracheata), F. iinumae, F. nipponica, and F. viridis [28]. This large contribution of strawberry genome data will greatly increase the efficiency of molecular marker-assisted breeding in this crop. However, strawberry genes controlling important traits remain unknown, and molecular marker technologies are limited [29]. Therefore, improvement of strawberry through traditional breeding is not expected to be so rapid.
Genetic modification strategies are faster at creating genetic variability than conventional breeding, adding “extra traits” that cannot be accessed by other traditional techniques [30,31]. In strawberry, targeted engineering of many traits, including some for resistance to diverse fungal pathogens, has been reported using these approaches. Successful enhanced resistance to Sphaerotheca humuli, V. dahliae, P. cactorum, B. cinerea, and C. acutatum has been described in transgenic strawberry, overexpressing genes from diverse origins, such as plant, fungal, or bacterial [32,33]. Genes include those encoding chitinase from rice [34,35], tomato (Solanum chilense) [36], and Phaseolus vulgaris [37], thaumatin II from Thaumatococcus daniellii [38], b-1,3-glucanase gene from Trichoderma [39], and RolC from Agrobacterium rhizogenes [40]. Even so, genetically modified organisms (GMOs) suffer from serious handicaps since they are not yet widely socially acceptable considering health and environmental concerns, due to scientifically unfounded misinformation and fearmongering campaigns [41]. However, using these molecular technologies over the past three decades, many crops have been successfully improved on beneficial agronomic and quality traits and many commercial GMOs have been rapidly adopted globally due to their contribution to food security, sustainability, reduction of agrochemical use, and climate change solutions, increasing ~112-fold from 1996, with an accumulated biotech area of 2.7 billion hectares [42,43,44,45]. Accordingly, at present, the introduction or modification of a single gene by directed gene transfer methods regains its value as a powerful tool to rapidly accelerate the improvement of superior varieties of strawberry and other woody fruit species.
In the past two decades, novelty and powerful biotechnology approaches have come to light to accurately, quickly, and efficiently address crop improvement, with fewer biosafety concerns. Therefore, new cisgenic and intragenic concepts have been introduced, these being much closer to traditional plant breeding methods, where only genes or DNA from the same or sexually compatible species can be incorporated in the plant [31,46,47,48]. Thus, in cisgenesis, genes containing their own native flanking regulatory regions, such a promoter and terminator in the normal-sense orientation, are added to the host organism [47]. Unlike cisgenic technology, intragenic technology allows the insertion and shuffling of different gene fragments. Thus, an intragenic plant can be originated by integrating into the plant genome a DNA cassette made of a combination of different gene fragments arranged in a sense or antisense orientation [47,49]. Intragenesis provides more recourses to modify gene expression and trait development than cisgenesis, since, by DNA shuffling, it is possible to create new genes (and therefore, proteins), including intragenes that target gene silencing (e.g., using RNAi cassettes). The European Food Safety Authority (EFSA) considers that hazards associated with cisgenic plants are similar to those associated with conventionally bred plants, whereas the putative unintended changes in intragenesis should be assessed on a case-by-case basis [50,51]. Additionally, modified crops through these approaches have much greater public acceptance than transgenesis, since they do not introduce foreign genes into the plant host genome, thus solving the current biosecurity problems related to this issue [52,53,54,55,56,57,58].
Although practical applications are still limited, following cisgenic and intragenic approaches, attempts to improve quality traits have been made in many crops, including barley, durum wheat, alfalfa, perennial ryegrass, poplar, potato, apple, grapevine, and strawberry [57,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79]. Moreover, currently, cisgenic Arctic™ “Golden Delicious” and “Granny Smith” apples (Okanagan Specialty Fruits Inc., Summerland, BC, Canada), a cisgenic alfalfa with altered lignin production (Bayer, Germany), and the intragenic potatoes of the Innate™ line (J.R. Simplot Co., Boise, ID, USA) are cultivated for commercial purposes [53]. In strawberry, the only intragenic attempt so far was reported by Schaart and colleagues, combining the FaPGIP (a polygalacturonase inhibiting protein) and the promoter of the strawberry expansive gene, FaEXP2, which showed flower and fruit ripening specific expression [62]. However, intragenic strawberry plants did not show the expected enhanced resistance to this pathogen, highlighting the value of considering and evaluating new intragenic combinations with different strawberry promoters and candidate genes to achieve enhanced resistance of this crop to pathogens [62].
Accordingly, for an intragenic approach in strawberry, isolating and characterizing new promoters and valuable defense-related genes in this species acquires great relevance. So far, in addition to the FaEXP2 promoter [62], few strawberry promoters have been isolated and characterized and include that of the root-specific FaRB7 [80], those of the fruit-specific genes, FanEG1 and FanEG3, which encode two endo-β-1,4-glucanases, respectively [81], FaGalUR, which encodes a D-galacturonate reductase [82], FaSTAG1, which encodes a MADS box protein [83], and those of the highly- and constitutively-expressed genes FaGAPC1 (a glyceraldehyde 3-phosphate dehydrogenase), FaUBCE2 (a ubiquitin conjugating enzyme), and FaAPA1 (an aspartic proteinase precursor) [84]. However, with the progress in strawberry genome sequencing and the genome information already available for this species, identifying the gene sequences of interest and their regulatory motifs has become fairly easy, making intragenesis a very attractive and powerful tool to rapidly achieve strawberry improvement, while the undesirable effects associated with classical breeding process (‘linkage drag’) are also eliminated.
Additionally, genome sequence data has become an important resource to expand the use of synthetic biology (SynBio) to genetically modify strawberry. Indeed, synthetic DNA approaches have been applied with notable success in bacteria and yeast [85,86,87,88], and there are an increasing number of examples in plants, which include synthetic promoters, synthetic metabolic pathways, and synthetic genomes to modify and improve desirable traits in crops [89,90,91]. Currently, it is routine to synthesize DNA as long as 20–100 kb, providing the opportunity to easily engineer the assembly of DNA sequences of interest by modern gene synthesis methods [92,93]. Furthermore, since regulatory elements are interchangeable in intragenesis, a selective developmental or tissue expression of the intragenic construction of interest can be achieved by pre-design of the intragene “cassette” using promoters carrying regulatory elements of known and desired spatio-temporal expression pattern. This is particularly attractive for preventing side effects and unintended changes on the host plant. In addition, the de novo synthesis of DNA is particularly advantageous for an intragenic approach, since combination of native sequences, excluding foreign DNA sequences, can be limiting and difficult to achieve by traditional genetic engineering techniques.
In this paper, we report on the design and use of synthetic biology for the construction of four RNAi silencing cassettes by assembling specific DNA sequences of new strawberry ripening-related gene promoters and pathogen defense-related genes using an intragenic approach. Additionally, using promoter-GUS fusion reporter assays, the usefulness of these two chemically synthetized strawberry natural promoters and their upstream regulatory sequences has been evaluated in strawberry fruit via Agrobacterium-mediated transient experiments. Binary Ti-plasmids carrying the intragenic RNAi silencing cassettes have been constructed to conduct the silencing of the endogenous strawberry target defense-related genes precisely in fruit during the ripening process in order to avoid unwanted effects on plant growth and development. Moreover, the recipient binary plasmid frame carries the Malus domestica MdMYB10 from a red-fleshed apple as a natural visual selectable marker [57,94], which will allow the production of stable red strawberry transformants (via Agrobacterium transformation), thus avoiding the integration into the strawberry genome of classical undesirable marker genes for selection. An increase in fruit resistance against different pathogens is expected in the strawberry lines carrying any of these RNAi silencing cassettes, which will benefit strawberry fruit yield and postharvest stages.
2. Results and Discussion
2.1. Creation of the Ti-Plasmid Constructs Carrying the Strawberry Intragenic dsRNA Silencing Cassette
Four Ti-plasmid constructs were created using synthetic biology and an intragenic strategy, schematized in Figure 1. Each of them carries all the strawberry DNA sequences needed for a fruit ripening-related expression of an intragenic dsRNAi-inducing unit aimed to silence either of two relevant specific pathogen defense-related endogenous genes, FaWRKY1 or FaNPR3.1.
2.1.1. Identification and Selection of the Strawberry Candidate Defense-Related Target Genes FaWRKY1 and FaNPR3.1 and Design of the Intragenic dsRNAi-Inducing Unit
FaWRKY1 was originally chosen as a target gene to silence, due to the fact that this strawberry gene has been described as an important element mediating defense responses to pathogens, and it is expressed in fruit after C. acutatum infection [95,96]. FaWRKY1 is the strawberry ortholog of the Arabidopsis AtWRKY75, which encodes a type IIc member of the plant WRKY transcription factor family. Plant WRKY TFs are involved in controlling a wide range of physiological and developmental processes, including plant immunity, in which they play major roles [97,98,99]. In fact, AtWRKY75 has been reported to show a positive regulatory role in defense when its overexpression enhanced Arabidopsis resistance to Sclerotinia sclerotiorum [100]. Interestingly, many WRKY TFs, including AtWRKY75-like factors, can exhibit a dual activity in plant defense according to the type of pathogen. For instance, the AtWRKY75 ortholog in cotton, GbWRKY1, acts as a negative regulator of the JA-mediated defense response against the necrotrophic B. cinerea and the hemibiotrophic V. dahliae [101], whereas the AtWRKY75 ortholog in grapevine, VvWRKY1, displays a positive regulatory function in defense against the biotrophic pathogen Plasmopara viticola [102]. Accordingly, in previous studies, it was demonstrated that FaWRKY1 can act similarly to AtWRKY75 as a positive regulator of defense in a heterologous system, such as Arabidopsis, either in compatible or incompatible interactions [95]. Very recently, it was also reported that the silencing of the FaWRKY1 in strawberry fruit by Agrobacterium-mediated transient transformation enhanced fruit resistance to controlled C. acutatum infection compared to non-silenced fruit [103]. As for other AtWRKY75-like genes, a potential dual role was described for the strawberry FaWRKY1, which might evidence differences according to the pathogen lifestyle, but more importantly, these results demonstrated a relevant regulatory role of this strawberry gene in the mechanism of defense against C. acutatum, a major strawberry pathogen.
Therefore, a FaWRKY1-intragenic-dsRNAi-inducing unit was designed based on the following considerations: (a) the inverted target sequences correspond to the same 272 bp DNA fragment from the FaWRKY1 described in Higuera-Sobrino et al. (2019), which was shown to successfully transiently silence the endogenous FaWRKY1 in strawberry fruit, increasing the resistance of this tissue to C. acutatum; (b) the length of this FaWRKY1 fragment is within the suitable size to maximize the efficiency of silencing [104] and its sequence does not drive cross-homology silencing, according to the criteria of Xu et al. (2006) (see next section below and Figure 2) [105]; (c) the sense and antisense FaWRKY1 fragments were linked with a 652 bp DNA sequence fragment, corresponding to the native unique FaWRKY1 intron sequence, aimed to act as an internal loop. The inclusion of this functional intron sequence in the sense orientation regarding the promoter is expected to have a consistently-enhancing silencing effect, as previously described [106,107,108].
The FaNPR3.1 was also selected as a good defense-related candidate target gene to silence, as this strawberry gene seems to behave functionally similar to AtNPR3/AtNPR4 factors, with those who share a high degree of identity (Figure S1), which are members of the Arabidopsis non-expressor of pathogenesis-related (NPR) family of proteins involved in plant immunity, mediated by salicylic acid against biotrophic and hemi-biotrophic pathogens [109]. Indeed, AtNPR3 and AtNPR4 are the Arabidopsis paralogues of AtNPR1, which acts as a positive master regulator of systemic acquired resistance, or SAR in this species [110,111], being also salicylic acid (SA) receptors but working redundantly as transcriptional corepressors of SA-mediated defense-related genes [112]. Recently, it has been reported that the strawberry FvNPRL-1, the F. vesca FaNPR3.1 ortholog, displays a negative regulatory function of defense in Arabidopsis in response to biotic stresses [113]. Furthermore, preliminary analysis in strawberry fruit, with the endogenous FaNPR3.1 transiently silenced via Agrobacterium transformation, has also revealed a significant decrease in the susceptibility of this tissue to the infection by C. acutatum [114].
Thus, a FaNPR3.1-intragenic-dsRNAi-inducing unit was built on the following criteria: (a) the sense and antisense gene sequences were created using the same 407 bp DNA fragment from the FaNPR3.1, which successfully transiently silenced the endogenous target gene in strawberry fruit, increasing the resistance of this tissue to C. acutatum [114]; (b) since the selected 407 bp DNA sequence encompasses nearly identical NPR3 gene alleles but no cross-homology with other members of the strawberry FaNPR gene family that has been detected, only silencing of all putative strawberry FaNPR3 allele-specific transcripts is expected (see next section below and Figure 3); (c) similarly to FaWRKY1, the length of the FaNPR3.1 DNA fragment is appropriate to maximize silencing efficiency [104] and enhance the silencing effect. The same original FaWRKY1 splicable intron sequence of 652 bp already mention above, was interposed between the FaNPR3.1-inverted flanking target sequences [106,107,108].
2.1.2. ‘‘Off-Target Effect” of the dsRNA Inducing Units
To understand unintended gene silencing of the intragenic dsRNA-inducing units on strawberry genes, the 272 bp and 407 bp DNA fragments of FaWRKY1 and FaNPR3.1, respectively, were used as queries to perform nucleotide BLAST searches against the Fragaria × ananassa Camarosa Genome v1.0.a1 Transcripts database. Only the homoeologous genes scored E-values, with very high significance (Figure 2A, Figure 3A, Figures S2 and S3). To further explore any off-target effect, putative siRNAs were predicted within each DNA fragment by using specific software programs, which mimic the dicer activity on the induced dsRNA, providing a set of reliable 21–24 bp siRNAs (Figure 2B and Figure 3B). Thus, 8 and 14 candidate siRNA sequences were predicted, respectively, by the InvivoGen siRNA Wizard (
2.1.3. Selection and Isolation of FvAAT2 and FvDOF2 Strawberry Promoter and Terminator Sequences
For specific dsRNAi production, the intragenic-dsRNAi-inducing-units were flanked with a promoter sequence from either of the two strawberry fruit ripening-related genes, FvDOF2 and FvAAT2 (F. vesca orthologs of F. × ananassa FaAAT2 and FaDOF2, respectively), and a native FaWRKY1 terminator region.
In F. × ananassa, the FaAAT2 encodes a fruit-related acyltransferase involved in aroma biogenesis in fruit receptacles [115]. Indeed, the expression of FaAAT2 is fruit-specific and increases during the strawberry fruit development and maturation stages, reaching high levels in red-mature and dark-red stages. Similarly, a higher expression was detected for the FaDOF2 in strawberry fruit and petals of the octoploid cultivar compared to other tissues [116], according to the key role that FaDOF2 transcription factor seems to play, together with FaEOBII, in the regulation of the phenylpropanoid volatile eugenol biosynthesis, which contributes to the aroma of fruit, as well as a floral attractant for pollinators. Moreover, the expression pattern of FaDOF2 in strawberry fruit was receptacle-specific and ripening-dependent, increasing continuously from the green stage to over-red and senescence fruit stages [116]. Consequently, the regulatory regions of these strawberries FaAAT2 and FaDOF2 were considered valuable tools to control the expression of the intragenic dsRNAi-inducing units in fruit in a ripening-related manner, when this strawberry complex organ is more susceptible to pathogens, thus avoiding severe pleiotropic effects in plant growth and development. However, the regulatory regions of their corresponding orthologous genes in F. vesca were finally considered to control the expression of the intragenic-dsRNAi inducing unit. The reason for this is that the latest diploid F. vesca genome information available by the time of this intragenic design was extraordinarily improved over previous versions, and gene models and genome annotations were fully updated and were highly reliable [22,23,24,25,26,27], whereas a trustable near-complete chromosome-scale assembly of the cultivated strawberry (F. × ananassa) genome was not available yet; it was released later and only recently improved [28,117]. Additionally, it is known that F. vesca is the dominant subgenome, for cultivated strawberry and transcriptomic analyses have revealed that metabolic pathways giving rise to strawberry flavor, color, and aroma, are largely controlled by the dominant subgenome [28,118,119]. Accordingly, not only both FaAAT2 and FaDOF2 F. × ananassa predicted homoeologous transcripts share high sequence identity between them and their corresponding F. vesca orthologs (see Figures S4 and S5), but a high sequence identity was also found between the regulatory regions of both F. vesca homoeologous FaAAT2 and FaDOF2 and the regulatory regions of their corresponding F. vesca ortholog genes (Figures S6 and S7, respectively). Most importantly, a similar fruit ripening-related gene expression pattern was previously detected for both FaAAT2 and FaDOF2 in F. × ananassa and their FvAAT2 and FvDOF2 orthologs in F. vesca [115] (Figure S8).
Consequently, the F. vesca genome was considered as the reference genome to select the regulatory sequence regions to control expression of the intragenic-dsRNAi inducing units. Therefore, DNA sequence fragments of 2998 bp and 3005 bp upstream of the predicted translation initiation codon (ATG) of genes FvAAT2 (FvH4_5g24240) and FvDOF2 (FvH4_2g14390), respectively, from F. vesca were selected as putative promoter sequences to drive the silencing cassettes in Fx. ananassa in a fruit ripening-related manner. The lengths of the selected regulatory regions are more in accordance with those described by Spolaore et al. (2003) than those described in Carvalho and Folta (2017), because larger strawberry promoter regions seem to display higher expression than shorter regions, which probably do not have the complete set of positive-acting elements and are under tight repression out of context [62,81,84,120]. We are aware that the expression pattern finally displayed by these F. vesca promoters in the octoploid strawberry fruit could be slightly modified, with respect to that expected, since it has already been reported that a large number of transcripts is altered between diploid and octoploid fruit during ripening [119].
Despite the importance that 3′ regulatory regions have for gene expression, they are still scarcely studied in plants compared to other regulatory sequences. The most widely used 3′ regulatory regions in plant expression vectors are NOS and OCS of A. tumefaciens and 35S of the cauliflower mosaic virus (CaMV); however, although still reduced, many plant 3′ regulatory sequences have already been described as good 3′ terminator regions, all having cis-elements involved in cleavage and polyadenylation [121]. So far, no 3′-end regulatory region has been validated for any strawberry gene, and only the terminator sequence of the ribulose biphosphate carboxylase small subunit gene (MdRbcS) of a crossable species, Malus × domestica, has been described [122]. However, for the intragenic approach considered here, the availability of suitable strawberry regulatory sequences is desirable. Therefore, the 352 bp DNA sequence downstream from the stop codon of the FaWRKY1, which carries all the necessary regulatory signals for RNA cleavage and polyadenylation, was considered as a good strawberry native 3′-UTR terminator region, and it was added to all constructs.
2.1.4. Assembling the Intragenic dsRNA Silencing Cassettes
Each of the four intragenic-dsRNA_silencing-cassettes were assembled in silico according to the scheme shown in Figure 1A, and their entire sequences were chemically synthetized and cloned separately within the T-region of plasmid pMinMYB (Figure 1B). A complete genome sequence (including its promoter and terminator regions) of the apple MdMYB10, encoding a key transcription factor that regulates the expression of anthocyanin biosynthesis pathway genes, is also included within the RB-LB region of this plasmid. The MdMYB10 has been reported as a useful red natural selectable marker in producing cisgenic apple [57,94].
2.2. Strawberry Promoter Analysis by Agrobacterium Mediated Transient Transformation
To confirm promoter activity in strawberry fruit of the candidate regulatory sequences obtained by synthetic biology from genes FvAAT2 (FvH4_5g24240) and FvDOF2 (FvH4_2g14390), both synthetic DNA fragments of 2998 bp and 3005 bp, respectively, upstream of the predicted translation initiation codon (ATG), were cloned into the promoter probe plasmid pKGWFS7.0 to drive the expression of the GUS reporter gene. Agrobacterium derivative strains harboring these constructs were then used in strawberry fruit transient experiment assays, using the agroinfiltration protocol described in Higuera et al. (2019) [103]. Histochemical assay of GUS activity revealed blue staining in fruit containing either pFvAAT2::GUS, pFvDOF2::GUS, or pCaMV35S::GUS (positive control) promoter constructs (Figure 4). No GUS staining was observed in strawberry fruit tissue infiltrated with the empty vector pKGWFS7.0. In all cases, blue staining was clearly visible and confined only within the half of fruit agroinfiltrated with the query promoter constructs but not within the opposite half agroinfiltrated with the empty vector. An uneven and patchy distribution of blue staining has been previously described by others and may be explained by the facility to diffuse by Agrobacterium according to the stage of fruit ripeness and the inherent variability in the assays [80,103]. Although the GUS staining technique is not accurate enough to report relative promoter strength, it was possible to distinguish a noticeable increase in blue intensity in the strawberry samples agroinfiltrated with the pFvAAT2::GUS construct, with respect to those with the pFvDOF2::GUS construct, the intensity being much higher in the pCaMV35S::GUS (positive control) samples.
Quantification of the corresponding GUS mRNA transcript levels by real-time RT-qPCR in strawberry fruit halves transiently expressing the corresponding F. vesca promoter constructs revealed that GUS transcripts are indeed significantly expressed in all the fruit samples agroinfiltrated with the query synthetic promoter constructs and confirmed that, although variable, under these conditions, the strength of the pFvAAT2 promoter seems to be higher than the pFvDOF2 promoter (Figure 5).
All in all, these results validate the use of these two synthetic promoters to drive the expression of the intragenic-dsRNAi-inducing units described in this paper in strawberry fruit. Additionally, these results demonstrate that FvAAT2 and FvDOF2 regulatory sequences from F. vesca are recognised in F. × ananassa fruit tissues and, most importantly, highlight synthetic biology as a powerful tool that can have a tremendous positive contribution to accelerate strawberry improvement.
3. Materials and Methods
3.1. Origin of DNA Sequence Fragments for the Intragenic dsRNAi Silencing Strategy
Strawberry intragenic silencing cassettes were designed based on a DNA blocks fusion scheme. Strawberry promoter sequences and their cis-acting regulatory signals were identified using the last version of the F. vesca Genome v4.0.a.1 of Rosacea Genome Database (
3.2. siRNA Predictions and “Off-Target” Effect
Candidate siRNA sequences were predicted using the InvivoGen_siRNA_Wizard (
3.3. Plasmid Constructs
The final entire assembled DNA sequence for each of the four strawberry intragenic silencing cassettes was chemically synthetized by GenScript Biotech company (Netherland) and cloned into the unique PacI site of the pMinMYB binary vector [57,126]. pMinMYB plasmid carries the complete genomic sequence of the Malus domestica MdMYB10, including its regulatory regions as a potential visible selectable marker in strawberry [94].
Two promoter probe vectors were constructed using the 3005 bp and 2989 bp DNA fragments, corresponding to the regulatory regions of FvDOF2 and FvAAT2 genes, respectively. Thus, these DNA fragments were PCR amplified using specific primers attB-FvDOF2full (attB1FvDOfII_Fw: GGGGACAAGTTTGTACAAAAAAGCAGGCTTGAACGTCATCGTAGCTTGC; attB2FvpDofII_Rv: GGGGACCACTTTGTACAAGAAAGCTGGGTTTTTGCAGAGAGGGTTTGGGT), for FvDOF2 and attB-FvAAT2full (attB1FvAAT2_Fw GGGGACAAGTTTGTACAAAAAAGCAGGCTTTATTATGGAAAAGAATTGGTGAAGATGT; attB2-FvAAT2_Rv GGGGACCACTTTGTACAAGAAAGCTGGGTATCGATCACTAACACACAAGTACTCTC, for FvAAT2) from their corresponding synthetic DNA sequences obtained from Genscript and cloned independently into the Gateway® entry vector pDONR221 by gateway technology using standard protocols (Thermo Fischer scientific, (Waltham, MA, USA). Later, each of both promoter sequences were transferred to pKGWFS7.0 as a final destination vector carrying the GUS reporter gene [127]. pKGWFS7.0 was obtained from VIB Plant Systems Biology (Gent, Belgium).
E. coli XL10gold (Agilent Technologies Inc., Santa Clara, CA, USA) was used as a recipient for all these plasmids constructs, including their corresponding empty vectors. A. tumefaciens AGL0 [128] was used for strawberry transformation.
3.4. Promoter Probe Analysis and Strawberry Fruit Transient Experiments
The expression capacity of FaAAT2 and FaDOF2 synthetic promoters was analyzed in strawberry fruit by transient-agroinfiltration methodology and GUS reporter assays. The plasmid pCaMV35s::GUS previously described in Higuera et al. (2019) and the pKGWFS7.0 empty vector were used as positive and negative controls, respectively, in these experiments. Transient agroinfiltration was performed in strawberry fruit of the octoploid F. × ananassa (cv. M04502) at the pink/turning stage, following the protocol described in Higuera et al. (2019). Thus, turning strawberry fruits attached to the plant were agroinfiltrated in one half with 1 mL (slightly adjusted according to the size of the fruit) of a suspension of the Agrobacterium cells bearing either the query promoter construct or the pCaMV35s::GUS construct (positive control), whereas the opposite half of the same fruit received the Agrobacterium, bearing the corresponding empty vector, as a control. In this way, variability between fruit is reduced, so we are able to compare the results between halves of the same fruit in fruit with different ripening stages. All fruits were kept attached to the plant under natural growing conditions of light and temperature until harvesting. Fruit samples were collected 4–5 days after agroinfiltration, and samples from each of the two halves of the collected fruits were immediately used for histochemical GUS analysis or frozen in liquid nitrogen and transferred to −80 °C until use for the promoter expression analysis by RT-qPCR. A minimum of 6–9 fruits was sampled for each independent promoter analysis.
3.5. Histochemical Assay of GUS Activity
Strawberry transiently transformed fruit halves were used for the histochemical assay. GUS activity in strawberry fruit sections was performed, as described by Jefferson et al. (1987), using a modified staining solution, following the manufacturer (Gold Biotechnology, Saint Louis, MO, USA) instructions, containing: 2 mM X-gluc in 100 mM sodium phosphate buffer (pH 7.5), 10 mM EDTA, 0.1% (v/v) Triton X-100, and 1.0 mM potassium ferricyanide.
3.6. qRT-PCR Gene Expression Analyses and Statistical Analyses
Total RNA from frozen independent halves of the strawberry fruits agroinfiltrated was extracted with the Maxwell® 16 LEV Plant RNA Kit (Promega, Madison, WI, USA), according to the instructions provided by the manufacturer. Total RNA was quantified by NanoDrop 1000 Spectrophotometer (Thermo Fischer scientific, Waltham, MA, USA), and RNA integrity (RIN) was checked using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Reverse transcription (RT) was carried out using 250 ng of purified total RNA as a template from samples with a RIN value ≥ 8, for a 20 µL reaction [iScript cDNA Synthesis kit (Biorad, Hercules, CA, USA)]. RT-qPCR was performed using specific primers (Table S1) and SsoAdvancedTM SYBR® Green Supermix in a CFX real-time PCR system (Bio-Rad, Hercules, CA, USA). All RT-qPCR primers used in this study had similar PCR efficiencies. The expression of the Kanamycin resistance gene was selected as an internal reference gene for GUS expression to normalize the level of transiently agroinfiltrated strawberry cells in every fruit. For each promoter probe analysis, six biological replicates, each with two RT technical replicates, were performed.
Fruit halves agroinfiltrated with Agrobacterium bearing the empty vector were used as control for statistical purposes. Thus, RT-qPCR GUS expression values were calculated and the mean was normalized as the relative expression value between the agroinfiltrated fruit half with the query promoter construct and the corresponding agroinfiltrated opposite fruit half with the empty control vector. Data were transformed into box-whisker plot graphics using the GraphPad Prism 8.0.2 program. The statistical value (p-value 0.001) was calculated using the Wilcoxon-Mann–Whitney U-test on data of two groups with a non-parametric statistical analysis. Additionally, a Student t-test was performed for pairwise comparisons between means of different groups. GUS values above 1 clearly indicate significant differences between both halves of the same fruit.
The expression analysis of the strawberry FaDOF2 in green and red fruit receptacles of F. vesca and F. × ananassa cv. Camarosa was performed by qRT-PCR using specific primers for FaDOF2 (Molina-Hidalgo et al., 2017).
4. Conclusions and Future Perspective
Intragenesis associated with the synthetic biology has emerged as a powerful approach to overcome the limitations and barriers of the traditional methods and speed up the improvement of strawberry. Using these strategies, four intragenic dsRNA silencing cassettes were designed, aimed to obtain stable strawberry lines with increased resistance/tolerance to different pathogens. Novel strawberry promoter sequences and candidate genes for silencing were considered. Synthetic FvAAT2 and FvDOF2 promoter sequences were validated as tools to drive the expression of FaWRKY1 and FaNPR3.1 dsRNAi-inducing units, mostly in strawberry fruit in a ripening related manner, featuring the relevance of synthetic biology to accelerate genetic improvement. Stable strawberry lines harboring each of these intragenic dsRNAi-silencing cassettes are expected to increase fruit resistance/tolerance to pathogens, and no serious interference in plant growth or any other tissues development stages is anticipated. We aimed to reduce the use of pesticides and unwanted compounds in agriculture. This approach could open the opportunity to increase fruit quality in strawberries by adding new traits in a faster way than conventional breeding methods.
V.S., J.J.H. and J.L.C. conceived and designed the experiments; J.L.C. contributed to reagents, materials, and analysis tools; F.J.M.-H., R.B-P., E.M. and J.M.-B. made experimental suggestions; V.S., J.J.H. and F.J.M.-H. carried out experiments; V.S., J.J.H., F.J.M.-H., R.B.-P., E.M., J.M.-B. and J.L.C. analyzed and interpreted the data; J.J.H. and A.R.-F. worked with databases; J.L.C. wrote the original draft preparation; J.J.H. and J.L.C. contributed to drafting the manuscript; V.S., J.J.H., F.J.M.-H., R.B.-P., E.M., A.R.-F., J.M.-B. and J.L.C. provided a critical review; J.L.C. and J.M.-B., project administration. All authors have read and agreed to the published version of the manuscript.
This research is part of a multidisciplinary Med-Berry Project funded by EU PRIMA foundation and Spanish AEI entitled “Developing New Strategies to Protect Strawberry Crops in Mediterranean Countries (Med-Berry PCI2019-103396), aimed to develop a range of alternative and competitive solutions to reduce drastically the use of pesticides in strawberry farming and to manage phytosanitary emergencies and diffusion of new diseases caused by temperature in the Mediterranean area”. Additionally, this project was suppo rted by the Programa Operativo FEDER Andalucía (Grant A1123060E00004-UCO-1256148).
Not applicable.
Not applicable.
Data supporting this study are available within the paper and within its
The authors are grateful to PRIMA foundation (Med-Berry project) and AEI (Spain); also to Viveros California, Spain, for providing strawberry fruit and plants.
The authors declare that the research conducted has no type of conflict of interest.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Figure 1. Creation of the Ti-plasmid constructs carrying the strawberry intragenic dsRNA silencing cassettes. (A) Design of the four intragenic-dsRNA-silencing cassettes. Promoter: promoter and regulatory sequences upstream from the ATG codon from genes FvAAT2 and FvDOF2; Gene fragment: DNA fragment from genes FaWRKY1 (272 bp) and FaNPR3.1 (407 bp) used for their corresponding inverted target sequences; Intron: the unique intron sequence of FaWRKY1 (652 bp); PAS: a 352 bp DNA fragment downstream from the stop codon of the FaWRKY1, containing the predicted regulatory signals for the cleavage and polyadenylation signal; AscI and PacI, restriction site sequences flanking the entire intragenic-dsRNA-silencing cassettes. (B) The T-region of plasmid pMinMYB carrying the complete genomic sequence of the apple MdMYB10 gene (adapted from Krens et al. 2015). The position of the unique PacI restriction site used for cloning each of the four intragenic-dsRNA-silencing cassettes is shown. LB and RB, left and right border.
Figure 2. The FaWRKY1 DNA fragment selected for dsRNAi silencing (FaWRKYRNAi). (A) BLAST of the 272 bp DNA fragment of FaWRKY1 against Fragaria × ananassa Camarosa Genome v1.0.a1 Transcripts database, adjusting the setting for the search to E-value 0.001 and Match/Mismatch Scores 1/−2. (B) Partial local alignment of the sequence, corresponding to three homeologs of FaWRKY1 and the selected FaWRKY1 DNA fragment. FaWRKY1RNAi corresponds to the 272 bp DNA fragment used in the intragenic dsRNAi-inducing unit; F. niponica WRKY1, maker-Fvb4-2-augustus-gene-73.40-mRNA-1; F. vesca WRKY1, maker-Fvb4-3-augustus-gene-105.32-mRNA-1; and F. viridis WRKY1, maker-Fvb4-4-augustus-gene-72.68-mRNA-1. Red and purple lines indicate the position of each predicted siRNA obtained by invivoGen software and Whitehead, respectively. Predicted siRNA are mostly grouped into “hot spot” RNAi candidate regions (boxes).
Figure 3. The FaNPR3.1 DNA fragment selected for dsRNAi silencing (FaNPR31RNAi). (A) BLAST of the 407 bp antisense DNA fragment of FaNPR3.1 against Fragaria × ananassa Camarosa Genome v1.0.a1 Transcripts database, adjusting the setting for the search to E-value 0.001 and Match/Mismatch Scores 1/−2. (B) Partial local alignment of the sequence corresponding to three homeologs of FaNPR3.1 and the selected DNA fragment. NPR31RNAi corresponds to the 407 bp DNA fragment used in the intragenic dsRNAi-inducing unit; F. niponica NPR31, maker-Fvb3-3-augustus-gene-47.46-mRNA-1; F. iinumae NPR31, maker-Fvb3-2-augustus-gene-63.42-mRNA-1; and F. viridis NPR31, maker-Fvb3-1-augustus-gene-256.35-mRNA-1. The corresponding homeologs to FaNPR3.2 and FaNPR3.3 are named as F. viridis NPR32, maker-Fvb6-4-augustus-gene-288.39-mRNA-1; F. iinumae NPR32, maker-Fvb6-3-augustus-gene-80.33-mRNA-1; F. vesca NPR32, maker-Fvb6-1-augustus-gene-87.19-mRNA-1; F. niponica NPR32, maker-Fvb6-2-snap-gene-357.51-mRNA-1; F. viridis NPR33, maker-Fvb6-4-augustus-gene-288.38-mRNA-1; F. iinumae NPR33, maker-Fvb6-3-augustus-gene-80.34-mRNA-1; F. vesca NPR33, maker-Fvb6-1-augustus-gene-87.20-mRNA-1; and F. niponica NPR33, snap_masked-Fvb6-2-processed-gene-357.26-mRNA-1. Red and purple lines indicate the predicted siRNA obtained by invivoGen software and Whitehead, respectively. Predicted siRNA are mostly grouped into “hot spot” RNAi candidate regions (boxes).
Figure 4. Transient promoter probe analysis of the synthetic FvDOF2 and FvAAT2 DNA fragments, respectively, in F. × ananassa fruit. Numbers 1 and 2 represent two different fruit samples. Histochemical GUS staining was performed after 5 days of fruit infiltration with agrobacterium carrying different query promoter constructs (pFvDOF2::GUS, pFvAAT2::GUS, and pCaMV35s::GUS) or the pKGWFS7.0 empty vector as a negative control (Ø). Query promoter constructs were injected in one half of the fruit, whereas the empty vector (Ø) was injected in the opposite half. For each construct, images represent tissues slices from two different fruit samples.
Figure 5. Quantitative real-time RT-qPCR expression analysis of GUS transcript levels in strawberry fruit transiently agroinfiltrated with the different promoter probe constructs. Box-plot graphs represent the distribution of gene expression values as relative GUS expression to the pKGWFS7 empty vector (negative control). Horizontal lines in the box indicate the median (Q2) and box the inter quartile range (Q3 Q1). Letters “a”, “b”, “c”, and “d” indicate statistically significant differences among samples, (p < 0.01, Wilcoxon–Mann–Whitney U-test).
Supplementary Materials
The following are available online at
References
1. Hilmarsson, H.S.; Hytönen, T.; Isobe, S.; Göransson, M.; Toivainen, T.; Hallsson, J.H. Population genetic analysis of a global collection of Fragaria vesca using microsatellite markers. PLoS ONE; 2017; 12, e0183384. [DOI: https://dx.doi.org/10.1371/journal.pone.0183384] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28854285]
2. Mezzetti, B.; Giampieri, F.; Zhang, Y.T.; Zhong, C.F. Status of strawberry breeding programs and cultivation systems in Europe and the rest of the world. J. Berry Res.; 2018; 8, pp. 205-221. [DOI: https://dx.doi.org/10.3233/JBR-180314]
3. Giampieri, F.; Tulipani, S.; Alvarez-Suarez, J.M.; Quiles, J.L.; Mezzetti, B.; Battino, M. The strawberry: Composition, nutritional quality, and impact on human health. Nutrition; 2012; 28, pp. 9-19. [DOI: https://dx.doi.org/10.1016/j.nut.2011.08.009]
4. Chen, T.; Shi, N.; Afzali, A. Chemopreventive effects of strawberry and black raspberry on colorectal cancer in inflammatory bowel disease. Nutrients; 2019; 11, 1261. [DOI: https://dx.doi.org/10.3390/nu11061261] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31163684]
5. Battino, M.; Beekwilder, J.; Denoyes-Rothan, B.; Laimer, M.; McDougall, G.J.; Mezzetti, B. Bioactive compounds in berries relevant to human health. Nutr. Rev.; 2009; 67, (Suppl. S1), pp. S145-S150. [DOI: https://dx.doi.org/10.1111/j.1753-4887.2009.00178.x]
6. Mazzoni, L.; Perez-Lopez, P.; Giampieri, F.; Alvarez-Suarez, J.M.; Gasparrini, M.; Forbes-Hernandez, T.Y.; Quiles, J.L.; Mezzetti, B.; Battino, M. The genetic aspects of berries: From field to health. J. Sci. Food Agric.; 2016; 96, pp. 365-371. [DOI: https://dx.doi.org/10.1002/jsfa.7216]
7. Petrasch, S.; Mesquida-Pesci, S.D.; Pincot, D.D.A.; Feldmann, M.J.; López, C.M.; Famula, R.; Hardigan, M.A.; Cole, G.S.; Knapp, S.J.; Blanco-Ulate, B. Genomic prediction of strawberry resistance to postharvest fruit decay caused by the fungal pathogen Botrytis cinerea. G3 Genes Genomes Genet.; 2021; jkab378. [DOI: https://dx.doi.org/10.1093/g3journal/jkab378] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34791166]
8. Nagpala, E.G.; Guidarelli, M.; Gasperotti, M.; Masuero, D.; Bertolini, P.; Vrhovsek, U.; Baraldi, E. Polyphenols Variation in Fruits of the Susceptible Strawberry Cultivar Alba during Ripening and upon Fungal Pathogen Interaction and Possible Involvement in Unripe Fruit Tolerance. J. Agric. Food Chem.; 2016; 64, pp. 1869-1878. [DOI: https://dx.doi.org/10.1021/acs.jafc.5b06005] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26895094]
9. Amil-Ruiz, F.; Blanco-Portales, R.; Muñoz-Blanco, J.; Caballero, J.L. The Strawberry Plant Defense Mechanism: A Molecular Review. Plant Cell Physiol.; 2011; 52, pp. 1873-1903. [DOI: https://dx.doi.org/10.1093/pcp/pcr136]
10. Paniagua, C.; Ric-Varas, P.; García-Gago, J.A.; López-Casado, G.; Blanco-Portales, R.; Muñoz-Blanco, J.; Schückel, J.; Knox, J.P.; Matas, A.J.; Quesada, M.A. et al. Elucidating the role of polygalacturonase genes in strawberry fruit softening. J. Exp. Bot.; 2020; 71, pp. 7103-7117. [DOI: https://dx.doi.org/10.1093/jxb/eraa398]
11. Garrido, C.; Carbú, M.; Fernández-Acero, F.; Gonzalez Rodriguez, V.E.; Cantoral, J. New insight in the study of strawberry fungal pathogens. G3 Genes Genomes Genet.; 2011; 5, pp. 24-39.
12. Maas, J.L.; Society, A.P. Compendium of Strawberry Diseases; Compendium of Plant Disease Series; APS Press: St. Paul, MN, USA, 1998; ISBN 9780890541944
13. FAO. The Future of Food and Agriculture: Trends and Challenges. 2017; Available online: http://www.fao.org/3/a-i6583e.pdf (accessed on 8 January 2018).
14. Burdon, J.J.; Zhan, J. Climate change and disease in plant communities. PLoS Biol.; 2020; 18, e3000949. [DOI: https://dx.doi.org/10.1371/journal.pbio.3000949]
15. Hahn, M. The rising threat of fungicide resistance in plant pathogenic fungi: Botrytis as a case study. J. Chem. Biol.; 2014; 7, pp. 133-141. [DOI: https://dx.doi.org/10.1007/s12154-014-0113-1]
16. Fernandes, V.C.; Domingues, V.F.; Mateus, N.; Delerue-Matos, C. Organochlorine Pesticide Residues in Strawberries from Integrated Pest Management and Organic Farming. J. Agric. Food Chem.; 2011; 59, pp. 7582-7591. [DOI: https://dx.doi.org/10.1021/jf103899r]
17. Lamichhane, J.R.; Dachbrodt-Saaydeh, S.; Kudsk, P.; Messéan, A. Toward a Reduced Reliance on Conventional Pesticides in European Agriculture. Plant Dis.; 2015; 100, pp. 10-24. [DOI: https://dx.doi.org/10.1094/PDIS-05-15-0574-FE]
18. Pétriacq, P.; López, A.; Luna, E. Fruit Decay to Diseases: Can Induced Resistance and Priming Help?. Plants; 2018; 7, 77. [DOI: https://dx.doi.org/10.3390/plants7040077] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30248893]
19. Troncoso-Rojas, R.; Tiznado-Hernández, M.E.; González-Leόn, A. Recent Advances in Alternative Postharvest Technologies to Control Fungal Diseases in Fruits & Vegetables; Transworld Research Network: Trivandrum, Kerala, India, 2007; ISBN 8178952440
20. Sarkar, S.; Dias, J.; Gil, B.; Keeley, J.; Möhring, N.; Jansen, K. The use of pesticides in developing countries and their impact on health and the right to food. Available online: https://op.europa.eu/en/publication-detail/-/publication/652ce244-6b53-11eb-aeb5-01aa75ed71a1/language-en (accessed on 14 December 2021).
21. Zorrilla-Fontanesi, Y.; Cabeza, A.; Domínguez, P.; Medina, J.J.; Valpuesta, V.; Denoyes-Rothan, B.; Sánchez-Sevilla, J.F.; Amaya, I. Quantitative trait loci and underlying candidate genes controlling agronomical and fruit quality traits in octoploid strawberry (Fragaria × ananassa). Theor. Appl. Genet.; 2011; 123, pp. 755-778. [DOI: https://dx.doi.org/10.1007/s00122-011-1624-6] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21667037]
22. Shulaev, V.; Sargent, D.J.; Crowhurst, R.N.; Mockler, T.C.; Folkerts, O.; Delcher, A.L.; Jaiswal, P.; Mockaitis, K.; Liston, A.; Mane, S.P. et al. The genome of woodland strawberry (Fragaria vesca). Nat. Genet.; 2011; 43, pp. 109-116. [DOI: https://dx.doi.org/10.1038/ng.740]
23. Tennessen, J.A.; Govindarajulu, R.; Ashman, T.L.; Liston, A. Evolutionary origins and dynamics of octoploid strawberry subgenomes revealed by dense targeted capture linkage maps. Genome Biol. Evol.; 2014; 6, pp. 3295-3313. [DOI: https://dx.doi.org/10.1093/gbe/evu261]
24. Darwish, O.; Shahan, R.; Liu, Z.; Slovin, J.P.; Alkharouf, N.W. Re-annotation of the woodland strawberry (Fragaria vesca) genome. BMC Genom.; 2015; 16, 29. [DOI: https://dx.doi.org/10.1186/s12864-015-1221-1]
25. Li, Y.; Wei, W.; Feng, J.; Luo, H.; Pi, M.; Liu, Z.; Kang, C. Genome re-annotation of the wild strawberry Fragaria vesca using extensive Illumina-and SMRT-based RNA-seq datasets. DNA Res.; 2018; 25, pp. 61-70. [DOI: https://dx.doi.org/10.1093/dnares/dsx038] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29036429]
26. Edger, P.P.; VanBuren, R.; Colle, M.; Poorten, T.J.; Wai, C.M.; Niederhuth, C.E.; Alger, E.I.; Ou, S.; Acharya, C.B.; Wang, J. et al. Single-molecule sequencing and optical mapping yields an improved genome of woodland strawberry (Fragaria vesca) with chromosome-scale contiguity. Gigascience; 2018; 7, gix124. [DOI: https://dx.doi.org/10.1093/gigascience/gix124]
27. Li, Y.; Pi, M.; Gao, Q.; Liu, Z.; Kang, C. Updated annotation of the wild strawberry Fragaria vesca V4 genome. Hortic. Res.; 2019; 6, 61. [DOI: https://dx.doi.org/10.1038/s41438-019-0142-6] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31069085]
28. Edger, P.P.; Poorten, T.J.; VanBuren, R.; Hardigan, M.A.; Colle, M.; McKain, M.R.; Smith, R.D.; Teresi, S.J.; Nelson, A.D.L.; Wai, C.M. et al. Origin and evolution of the octoploid strawberry genome. Nat. Genet.; 2019; 51, pp. 541-547. [DOI: https://dx.doi.org/10.1038/s41588-019-0356-4]
29. Whitaker, V.M. Applications of molecular markers in strawberry. J. Berry Res.; 2011; 1, pp. 115-127. [DOI: https://dx.doi.org/10.3233/BR-2011-013]
30. Limera, C.; Sabbadini, S.; Sweet, J.B.; Mezzetti, B. New biotechnological tools for the genetic improvement of major woody fruit species. Front. Plant Sci.; 2017; 8, 1418. [DOI: https://dx.doi.org/10.3389/fpls.2017.01418] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28861099]
31. Rommens, C.M.; Haring, M.A.; Swords, K.; Davies, H.V.; Belknap, W.R. The intragenic approach as a new extension to traditional plant breeding. Trends Plant Sci.; 2007; 12, pp. 397-403. [DOI: https://dx.doi.org/10.1016/j.tplants.2007.08.001]
32. Palomo-Ríos, E.; Quesada, M.A.; Matas, A.J.; Pliego-Alfaro, F.; Mercado, J.A. The History and Current Status of Genetic Transformation in Berry Crops; Springer: Cham, Switzerland, 2018; pp. 139-160.
33. Qin, Y.; Teixeira da Silva, J.A.; Zhang, L.; Zhang, S. Transgenic strawberry: State of the art for improved traits. Biotechnol. Adv.; 2008; 26, pp. 219-232. [DOI: https://dx.doi.org/10.1016/j.biotechadv.2007.12.004] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18280082]
34. Asao, H.; Nishizawa, Y.; Arai, S.; Sato, T.; Hirai, M.; Yoshida, K.; Shinmyo, A.; Hibi, T. Enhanced Resistance against a Fungal Pathogen Sphaerotheca humuli in Transgenic Strawberry Expressing a Rice Chitinase Gene. Plant Biotechnol.; 1997; 14, pp. 145-149. [DOI: https://dx.doi.org/10.5511/plantbiotechnology.14.145]
35. Asao, H.; Arai, S.; Nishizawa, Y. Environmental risk evaluation of transgenic strawberry expressing a rice chitinase gene. J. Biosci. Bioeng.; 2003; 95, 206. [DOI: https://dx.doi.org/10.1016/S1389-1723(03)80134-2]
36. Chalavi, V.; Tabaeizadeh, Z.; Thibodeau, P. Enhanced Resistance to Verticillium dahliae in Transgenic Strawberry Plants Expressing a Lycopersicon chilense Chitinase Gene. J. Am. Soc. Hortic. Sci. jashs; 2003; 128, pp. 747-753. [DOI: https://dx.doi.org/10.21273/JASHS.128.5.0747]
37. Vellicce, G.R.; Ricci, J.C.D.; Hernández, L.; Castagnaro, A.P. Enhanced resistance to Botrytis cinerea mediated by the transgenic expression of the chitinase gene ch5B in strawberry. Transgenic Res.; 2006; 15, pp. 57-68. [DOI: https://dx.doi.org/10.1007/s11248-005-2543-6]
38. Schestibratov, K.A.; Dolgov, S.V. Transgenic strawberry plants expressing a thaumatin II gene demonstrate enhanced resistance to Botrytis cinerea. Sci. Hortic.; 2005; 106, pp. 177-189. [DOI: https://dx.doi.org/10.1016/j.scienta.2005.03.016]
39. Mercado, J.A.; Barceló, M.; Pliego, C.; Rey, M.; Caballero, J.L.; Muñoz-Blanco, J.; Ruano-Rosa, D.; López-Herrera, C.; de los Santos, B.; Romero-Muñoz, F. et al. Expression of the β-1,3-glucanase gene bgn13.1 from Trichoderma harzianum in strawberry increases tolerance to crown rot diseases but interferes with plant growth. Transgenic Res.; 2015; 24, pp. 979-989. [DOI: https://dx.doi.org/10.1007/s11248-015-9895-3] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26178245]
40. Landi, L.; Capocasa, F.; Costantini, E.; Mezzetti, B. ROLC strawberry plant adaptability, productivity, and tolerance to soil-borne disease and mycorrhizal interactions. Transgenic Res.; 2009; 18, pp. 933-942. [DOI: https://dx.doi.org/10.1007/s11248-009-9279-7] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19466576]
41. Conner, A.J.; Jacobs, J.M. Genetic engineering of crops as potential source of genetic hazard in the human diet. Mutat. Res.; 1999; 443, pp. 223-234. [DOI: https://dx.doi.org/10.1016/S1383-5742(99)00020-4]
42. Datta, A. Genetic engineering for improving quality and productivity of crops. Agric. Food Secur.; 2013; 2, 15. [DOI: https://dx.doi.org/10.1186/2048-7010-2-15]
43. Qaim, M.; Kouser, S. Genetically Modified Crops and Food Security. PLoS ONE; 2013; 8, e64879. [DOI: https://dx.doi.org/10.1371/journal.pone.0064879]
44. Parisi, C.; Tillie, P.; Rodríguez-Cerezo, E. The global pipeline of GM crops out to 2020. Nat. Biotechnol.; 2016; 34, pp. 31-36. [DOI: https://dx.doi.org/10.1038/nbt.3449]
45. ISAAA. Brief 55: Global Status of Commercialized Biotech/GM Crops: 2019; Publications ISAAA Cornell University: Ithaca, NY, USA, 2021.
46. Schouten, H.J.; Krens, F.A.; Jacobsen, E. Cisgenic plants are similar to traditionally bred plants: International regulations for genetically modified organisms should be altered to exempt cisgenesis. EMBO Rep.; 2006; 7, pp. 750-753. [DOI: https://dx.doi.org/10.1038/sj.embor.7400769]
47. Sticklen, M. Transgenic, Cisgenic, Intragenic and Subgenic Crops. Adv. Crop Sci. Technol.; 2015; 3, e123. [DOI: https://dx.doi.org/10.4172/2329-8863.1000e123]
48. Thapa, B.; Joshi, T.; Jangid, K.; Basnet, P. Cisgenesis: Genetic engineering introduced spark to traditional breeding methods. Res. Environ. Life Sci.; 2015; 8, pp. 757-760.
49. Rommens, C.M. Intragenic Crop Improvement: Combining the Benefits of Traditional Breeding and Genetic Engineering. J. Agric. Food Chem.; 2007; 55, pp. 4281-4288. [DOI: https://dx.doi.org/10.1021/jf0706631] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17488120]
50. EFSA Paraskevopoulos, K.; Federici, S. Overview of EFSA and European national authorities’ scientific opinions on the risk assessment of plants developed through New Genomic Techniques. EFSA J.; 2021; 19, e06314. [DOI: https://dx.doi.org/10.2903/j.efsa.2021.6314]
51. EFSA Panel on Genetically Modified Organisms (GMO). Scientific opinion addressing the safety assessment of plants developed through cisgenesis and intragenesis. EFSA J.; 2012; 10, 2561. [DOI: https://dx.doi.org/10.2903/j.efsa.2012.2561]
52. Lusser, M.; Davies, H.V. Comparative regulatory approaches for groups of new plant breeding techniques. N. Biotechnol.; 2013; 30, pp. 437-446. [DOI: https://dx.doi.org/10.1016/j.nbt.2013.02.004] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23474021]
53. Lombardo, L.; Zelasco, S. Biotech Approaches to Overcome the Limitations of Using Transgenic Plants in Organic Farming. Sustainability; 2016; 8, 497. [DOI: https://dx.doi.org/10.3390/su8050497]
54. Lassoued, R.; Hesseln, H.; Smyth, S.; Phillips, P. Top plant breeding techniques for improving food security: An expert Delphi survey of the opportunities and challenges. Int. J. Agric. Resour. Gov. Ecol.; 2018; 14, 321. [DOI: https://dx.doi.org/10.1504/IJARGE.2018.10019321]
55. Capriotti, L.; Baraldi, E.; Mezzetti, B.; Limera, C.; Sabbadini, S. Biotechnological Approaches: Gene Overexpression, Gene Silencing, and Genome Editing to Control Fungal and Oomycete Diseases in Grapevine. Int. J. Mol. Sci.; 2020; 21, 5701. [DOI: https://dx.doi.org/10.3390/ijms21165701]
56. Gaskell, G.; Allansdottir, A.; Allum, N.; Castro, P.; Esmer, Y.; Fischler, C.; Jackson, J.; Kronberger, N.; Hampel, J.; Mejlgaard, N. et al. The 2010 Eurobarometer on the life sciences. Nat. Biotechnol.; 2011; 29, pp. 113-114. [DOI: https://dx.doi.org/10.1038/nbt.1771]
57. Krens, F.A.; Schaart, J.G.; van der Burgh, A.M.; Tinnenbroek-Capel, I.E.M.; Groenwold, R.; Kodde, L.P.; Broggini, G.A.L.; Gessler, C.; Schouten, H.J. Cisgenic apple trees; development, characterization, and performance. Front. Plant Sci.; 2015; 6, 286. [DOI: https://dx.doi.org/10.3389/fpls.2015.00286]
58. Lusk, J.L.; Sullivan, P. Consumer acceptance of genetically modified foods. Food Technol.; 2002; 56, pp. 32-37.
59. Rommens, C.M. All-native DNA transformation: A new approach to plant genetic engineering. Trends Plant Sci.; 2004; 9, pp. 457-464. [DOI: https://dx.doi.org/10.1016/j.tplants.2004.07.001] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/15337496]
60. Joshi, S.G.; Schaart, J.G.; Groenwold, R.; Jacobsen, E.; Schouten, H.J.; Krens, F.A. Functional analysis and expression profiling of HcrVf1 and HcrVf2 for development of scab resistant cisgenic and intragenic apples. Plant Mol. Biol.; 2011; 75, pp. 579-591. [DOI: https://dx.doi.org/10.1007/s11103-011-9749-1] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21293908]
61. Schaart, J.G. Towards Consumer-Friendly Cisgenic Strawberries Which Are Less Susceptible to Botrytis Cinérea; Wageningen University: Wageningen, The Netherlands, 2004.
62. Schaart, J.G.; Kjellsen, T.D.; Mehli, L.; Heggem, R.; Iversen, T.H.; Schouten, H.J.; Krens, F.A. Towards the Production of Genetically Modified Strawberries which are Acceptable to Consumers. Genes Genomes Genom.; 2011; 5, pp. 102-107.
63. Holme, I.B.; Dionisio, G.; Brinch-Pedersen, H.; Wendt, T.; Madsen, C.K.; Vincze, E.; Holm, P.B. Cisgenic barley with improved phytase activity. Plant Biotechnol. J.; 2012; 10, pp. 237-247. [DOI: https://dx.doi.org/10.1111/j.1467-7652.2011.00660.x]
64. de Vetten, N.; Wolters, A.-M.; Raemakers, K.; van der Meer, I.; ter Stege, R.; Heeres, E.; Heeres, P.; Visser, R. A transformation method for obtaining marker-free plants of a cross-pollinating and vegetatively propagated crop. Nat. Biotechnol.; 2003; 21, pp. 439-442. [DOI: https://dx.doi.org/10.1038/nbt801]
65. Holme, I.B.; Wendt, T.; Holm, P.B. Intragenesis and cisgenesis as alternatives to transgenic crop development. Plant Biotechnol. J.; 2013; 11, pp. 395-407. [DOI: https://dx.doi.org/10.1111/pbi.12055]
66. Haverkort, A.J.; Struik, P.C.; Visser, R.G.F.; Jacobsen, E. Applied Biotechnology to Combat Late Blight in Potato Caused by Phytophthora Infestans. Potato Res.; 2009; 52, pp. 249-264. [DOI: https://dx.doi.org/10.1007/s11540-009-9136-3]
67. Gessler, C.; Vanblaere, T.; Parravicini, G.; Broggini, G.A.L. Cisgenic “Gala” Containing the Scab Resistance Gene from Malus floribunda 821 and the Fire Blight Resistance Genes from M. “Evereste”. Acta Hortic.; 2014; 1048, pp. 43-49. [DOI: https://dx.doi.org/10.17660/ActaHortic.2014.1048.4]
68. Jo, K.-R.; Kim, C.-J.; Kim, S.-J.; Kim, T.-Y.; Bergervoet, M.; Jongsma, M.A.; Visser, R.G.F.; Jacobsen, E.; Vossen, J.H. Development of late blight resistant potatoes by cisgene stacking. BMC Biotechnol.; 2014; 14, 50. [DOI: https://dx.doi.org/10.1186/1472-6750-14-50]
69. Vanblaere, T.; Flachowsky, H.; Gessler, C.; Broggini, G.A.L. Molecular characterization of cisgenic lines of apple ‘Gala’ carrying the Rvi6 scab resistance gene. Plant Biotechnol. J.; 2014; 12, pp. 2-9. [DOI: https://dx.doi.org/10.1111/pbi.12110]
70. Rommens, C.M.; Humara, J.M.; Ye, J.; Yan, H.; Richael, C.; Zhang, L.; Perry, R.; Swords, K. Crop Improvement through Modification of the Plant’s Own Genome. Plant Physiol.; 2004; 135, pp. 421-431. [DOI: https://dx.doi.org/10.1104/pp.104.040949]
71. Kost, T.D.; Gessler, C.; Jänsch, M.; Flachowsky, H.; Patocchi, A.; Broggini, G.A.L. Development of the First Cisgenic Apple with Increased Resistance to Fire Blight. PLoS ONE; 2015; 10, e0143980. [DOI: https://dx.doi.org/10.1371/journal.pone.0143980]
72. Würdig, J.; Flachowsky, H.; Saß, A.; Peil, A.; Hanke, M.-V. Improving resistance of different apple cultivars using the Rvi6 scab resistance gene in a cisgenic approach based on the Flp/FRT recombinase system. Mol. Breed.; 2015; 35, 95. [DOI: https://dx.doi.org/10.1007/s11032-015-0291-8]
73. Rommens, C.M.; Ye, J.; Richael, C.; Swords, K. Improving Potato Storage and Processing Characteristics through All-Native DNA Transformation. J. Agric. Food Chem.; 2006; 54, pp. 9882-9887. [DOI: https://dx.doi.org/10.1021/jf062477l]
74. Rommens, C.M.; Yan, H.; Swords, K.; Richael, C.; Ye, J. Low-acrylamide French fries and potato chips. Plant Biotechnol. J.; 2008; 6, pp. 843-853. [DOI: https://dx.doi.org/10.1111/j.1467-7652.2008.00363.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18662372]
75. Bajaj, S.; Puthigae, S.; Templeton, K.; Bryant, C.; Gill, G.; Lomba, P.; Zhang, H.; Altpeter, F.; Hanley, Z. Towards engineering drought tolerance in perennial ryegrass using its own genome. Presented at the 6th Canadian Plant Genomics Workshop; Toronto, ON, USA, 23–26 June 2008; 62.
76. Gadaleta, A.; Giancaspro, A.; Blechl, A.E.; Blanco, A. A transgenic durum wheat line that is free of marker genes and expresses 1Dy10. J. Cereal Sci.; 2008; 48, pp. 439-445. [DOI: https://dx.doi.org/10.1016/j.jcs.2007.11.005]
77. Weeks, J.T.; Ye, J.; Rommens, C.M. Development of an in planta method for transformation of alfalfa (Medicago sativa). Transgenic Res.; 2008; 17, pp. 587-597. [DOI: https://dx.doi.org/10.1007/s11248-007-9132-9] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17851774]
78. Han, K.M.; Dharmawardhana, P.; Arias, R.S.; Ma, C.; Busov, V.; Strauss, S.H. Gibberellin-associated cisgenes modify growth, stature and wood properties in Populus. Plant Biotechnol. J.; 2011; 9, pp. 162-178. [DOI: https://dx.doi.org/10.1111/j.1467-7652.2010.00537.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20573046]
79. Dhekney, S.A.; Li, Z.T.; Gray, D.J. Grapevines engineered to express cisgenic Vitis vinifera thaumatin-like protein exhibit fungal disease resistance. In Vitro Cell. Dev. Biol.-Plant; 2011; 47, pp. 458-466. [DOI: https://dx.doi.org/10.1007/s11627-011-9358-3]
80. Vaughan, S.P.; James, D.J.; Lindsey, K.; Massiah, A.J. Characterization of FaRB7, a near root-specific gene from strawberry (Fragaria × ananassa Duch.) and promoter activity analysis in homologous and heterologous hosts. J. Exp. Bot.; 2006; 57, pp. 3901-3910. [DOI: https://dx.doi.org/10.1093/jxb/erl185] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17032728]
81. Spolaore, S.; Trainotti, L.; Pavanello, A.; Casadoro, G. Isolation and promoter analysis of two genes encoding different endo-beta-1,4-glucanases in the non-climacteric strawberry. J. Exp. Bot.; 2003; 54 381, pp. 271-277. [DOI: https://dx.doi.org/10.1093/jxb/erg025]
82. Agius, F.; Amaya, I.; Botella, M.A.; Valpuesta, V. Functional analysis of homologous and heterologous promoters in strawberry fruits using transient expression. J. Exp. Bot.; 2005; 56, pp. 37-46. [DOI: https://dx.doi.org/10.1093/jxb/eri004]
83. Rosin, F.; Aharoni, A.; Salentijn, E.; Schaart, J.; Boone, M.; Hannapel, D. Expression patterns of a putative homolog of AGAMOUS, STAG1, from strawberry. Plant Sci.; 2003; 165, pp. 959-968. [DOI: https://dx.doi.org/10.1016/S0168-9452(03)00233-4]
84. Carvalho, R.F.; Folta, K.M. Assessment of promoters and a selectable marker for development of strawberry intragenic vectors. Plant Cell Tissue Organ Cult.; 2017; 128, pp. 259-271. [DOI: https://dx.doi.org/10.1007/s11240-016-1105-3]
85. Li, J.; Zhao, H.; Zheng, L.; An, W. Advances in Synthetic Biology and Biosafety Governance. Front. Bioeng. Biotechnol.; 2021; 9, 598087. [DOI: https://dx.doi.org/10.3389/fbioe.2021.598087]
86. Gibson, D.G.; Glass, J.I.; Lartigue, C.; Noskov, V.N.; Chuang, R.-Y.; Algire, M.A.; Benders, G.A.; Montague, M.G.; Ma, L.; Moodie, M.M. et al. Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome. Science; 2010; 329, pp. 52-56. [DOI: https://dx.doi.org/10.1126/science.1190719]
87. Hutchison, C.A., 3rd; Chuang, R.-Y.; Noskov, V.N.; Assad-Garcia, N.; Deerinck, T.J.; Ellisman, M.H.; Gill, J.; Kannan, K.; Karas, B.J.; Ma, L. et al. Design and synthesis of a minimal bacterial genome. Science; 2016; 351, aad6253. [DOI: https://dx.doi.org/10.1126/science.aad6253]
88. Richardson, S.M.; Mitchell, L.A.; Stracquadanio, G.; Yang, K.; Dymond, J.S.; DiCarlo, J.E.; Lee, D.; Huang, C.L.V.; Chandrasegaran, S.; Cai, Y. et al. Design of a synthetic yeast genome. Science; 2017; 355, pp. 1040-1044. [DOI: https://dx.doi.org/10.1126/science.aaf4557]
89. Fesenko, E.; Edwards, R. Plant synthetic biology: A new platform for industrial biotechnology. J. Exp. Bot.; 2014; 65, pp. 1927-1937. [DOI: https://dx.doi.org/10.1093/jxb/eru070] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24638901]
90. Liu, W.; Stewart, C.N.J. Plant synthetic biology. Trends Plant Sci.; 2015; 20, pp. 309-317. [DOI: https://dx.doi.org/10.1016/j.tplants.2015.02.004] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25825364]
91. Ali, S.; Kim, W.-C. A Fruitful Decade Using Synthetic Promoters in the Improvement of Transgenic Plants. Front. Plant Sci.; 2019; 10, 1433. [DOI: https://dx.doi.org/10.3389/fpls.2019.01433]
92. Hughes, R.A.; Ellington, A.D. Synthetic DNA Synthesis and Assembly: Putting the Synthetic in Synthetic Biology. Cold Spring Harb. Perspect. Biol.; 2017; 9, a023812. [DOI: https://dx.doi.org/10.1101/cshperspect.a023812]
93. Kosuri, S.; Church, G.M. Large-scale de novo DNA synthesis: Technologies and applications. Nat. Methods; 2014; 11, pp. 499-507. [DOI: https://dx.doi.org/10.1038/nmeth.2918]
94. Kortstee, A.J.; Khan, S.A.; Helderman, C.; Trindade, L.M.; Wu, Y.; Visser, R.G.F.; Brendolise, C.; Allan, A.; Schouten, H.J.; Jacobsen, E. Anthocyanin production as a potential visual selection marker during plant transformation. Transgenic Res.; 2011; 20, pp. 1253-1264. [DOI: https://dx.doi.org/10.1007/s11248-011-9490-1]
95. Encinas-Villarejo, S.; Maldonado, A.M.; Amil-Ruiz, F.; de los Santos, B.; Romero, F.; Pliego-Alfaro, F.; Muñoz-Blanco, J.; Caballero, J.L. Evidence for a positive regulatory role of strawberry (Fragaria × ananassa) Fa WRKY1 and Arabidopsis At WRKY75 proteins in resistance. J. Exp. Bot.; 2009; 60, pp. 3043-3065. [DOI: https://dx.doi.org/10.1093/jxb/erp152]
96. Amil-Ruiz, F.; Garrido-Gala, J.; Gadea, J.; Blanco-Portales, R.; Muñoz-Mérida, A.; Trelles, O.; de los Santos, B.; Arroyo, F.T.; Aguado-Puig, A.; Romero, F. et al. Partial Activation of SA- and JA-Defensive Pathways in Strawberry upon Colletotrichum acutatum Interaction. Front. Plant Sci.; 2016; 7, 1036. [DOI: https://dx.doi.org/10.3389/fpls.2016.01036]
97. Rushton, P.J.; Somssich, I.E.; Ringler, P.; Shen, Q.J. WRKY transcription factors. Trends Plant Sci.; 2010; 15, pp. 247-258. [DOI: https://dx.doi.org/10.1016/j.tplants.2010.02.006]
98. Alves, M.; Dadalto, S.; Gonçalves, A.; de Souza, G.; Barros, V.; Fietto, L. Transcription Factor Functional Protein-Protein Interactions in Plant Defense Responses. Proteomes; 2014; 2, pp. 85-106. [DOI: https://dx.doi.org/10.3390/proteomes2010085]
99. Tsuda, K.; Somssich, I.E. Transcriptional networks in plant immunity. New Phytol.; 2015; 206, pp. 932-947. [DOI: https://dx.doi.org/10.1111/nph.13286] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25623163]
100. Chen, X.; Liu, J.; Lin, G.; Wang, A.; Wang, Z.; Lu, G. Overexpression of AtWRKY28 and AtWRKY75 in Arabidopsis enhances resistance to oxalic acid and Sclerotinia sclerotiorum. Plant Cell Rep.; 2013; 32, pp. 1589-1599. [DOI: https://dx.doi.org/10.1007/s00299-013-1469-3] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23749099]
101. Li, C.; He, X.; Luo, X.; Xu, L.; Liu, L.; Min, L.; Jin, L.; Zhu, L.; Zhang, X. Cotton WRKY1 Mediates the Plant Defense-to-Development Transition during Infection of Cotton by Verticillium dahliae by Activating JASMONATE ZIM-DOMAIN1 Expression. Plant Physiol.; 2014; 166, pp. 2179-2194. [DOI: https://dx.doi.org/10.1104/pp.114.246694]
102. Marchive, C.; Léon, C.; Kappel, C.; Coutos-Thévenot, P.; Corio-Costet, M.-F.; Delrot, S.; Lauvergeat, V. Over-Expression of VvWRKY1 in Grapevines Induces Expression of Jasmonic Acid Pathway-Related Genes and Confers Higher Tolerance to the Downy Mildew. PLoS ONE; 2013; 8, e54185. [DOI: https://dx.doi.org/10.1371/journal.pone.0054185]
103. Higuera, J.J.; Garrido-Gala, J.; Lekhbou, A.; Arjona-Girona, I.; Amil-Ruiz, F.; Mercado, J.A.; Pliego-Alfaro, F.; Muñoz-Blanco, J.; López-Herrera, C.J.; Caballero, J.L. The Strawberry FaWRKY1 Transcription Factor Negatively Regulates Resistance to Colletotrichum acutatum in Fruit Upon Infection. Front. Plant Sci.; 2019; 10, 480. [DOI: https://dx.doi.org/10.3389/fpls.2019.00480]
104. Helliwell, C.; Waterhouse, P. Constructs and methods for high-throughput gene silencing in plants. Methods; 2003; 30, pp. 289-295. [DOI: https://dx.doi.org/10.1016/S1046-2023(03)00036-7]
105. Xu, P.; Zhang, Y.; Kang, L.; Roossinck, M.J.; Mysore, K.S. Computational Estimation and Experimental Verification of Off-Target Silencing during Posttranscriptional Gene Silencing in Plants. Plant Physiol.; 2006; 142, pp. 429-440. [DOI: https://dx.doi.org/10.1104/pp.106.083295]
106. Smith, N.A.; Singh, S.P.; Wang, M.-B.; Stoutjesdijk, P.A.; Green, A.G.; Waterhouse, P.M. Total silencing by intron-spliced hairpin RNAs. Nature; 2000; 407, pp. 319-320. [DOI: https://dx.doi.org/10.1038/35030305]
107. Wesley, S.V.; Helliwell, C.A.; Smith, N.A.; Wang, M.; Rouse, D.T.; Liu, Q.; Gooding, P.S.; Singh, S.P.; Abbott, D.; Stoutjesdijk, P.A. et al. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J.; 2001; 27, pp. 581-590. [DOI: https://dx.doi.org/10.1046/j.1365-313X.2001.01105.x]
108. Jadhav, P.; Chandrakant, E.; Sahebrao, W. RNAi Induced Gene Silencing Journey from Simple dsRNA to High-Throughput Intron Hairpin RNA Construct in Crop Improvement. Genetic Transformation in Crops; IntechOpen Limited: London, UK, 2020; [DOI: https://dx.doi.org/10.5772/intechopen.93012]
109. Glazebrook, J. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol.; 2005; 43, pp. 205-227. [DOI: https://dx.doi.org/10.1146/annurev.phyto.43.040204.135923]
110. Fu, Z.Q.; Dong, X. Systemic Acquired Resistance: Turning Local Infection into Global Defense. Annu. Rev. Plant Biol.; 2013; 64, pp. 839-863. [DOI: https://dx.doi.org/10.1146/annurev-arplant-042811-105606]
111. Zhang, Y.; Li, X. Salicylic acid: Biosynthesis, perception, and contributions to plant immunity. Curr. Opin. Plant Biol.; 2019; 50, pp. 29-36. [DOI: https://dx.doi.org/10.1016/j.pbi.2019.02.004]
112. Ding, Y.; Sun, T.; Ao, K.; Peng, Y.; Zhang, Y.; Li, X.; Zhang, Y. Opposite Roles of Salicylic Acid Receptors NPR1 and NPR3/NPR4 in Transcriptional Regulation of Plant Immunity. Cell; 2018; 173, pp. 1454-1467.e15. [DOI: https://dx.doi.org/10.1016/j.cell.2018.03.044]
113. Shu, L.-J.; Liao, J.-Y.; Lin, N.-C.; Chung, C.-L. Identification of a strawberry NPR-like gene involved in negative regulation of the salicylic acid-mediated defense pathway. PLoS ONE; 2018; 13, e0205790. [DOI: https://dx.doi.org/10.1371/journal.pone.0205790]
114. Higuera-Sobrino, J.-J.; Amil-Ruiz, F.; Garrido-Gala, J.; Lekhbou, A.; Moyano, E.; Arjona-Girona, I.; Arjona-López, J.-M.; Mercado, J.-A.; Pliego-Alfaro, F.; Muñoz-Blanco, J. et al. El silenciamiento del gen Fanpr3.1 de fresa (Fragaria × ananassa) genera resistencia a la infección por Colletotrichum acutatum y sugiere una función en defensa semejante a la de lo genes Atnpr3/Atnpr4 en Arabidopsis. Proceedings of the XXXIX Congreso de la Sociedad Española de Bioquímica y Biología Molecular (XXXIX Congreso SEBBM); Salamanca, Spain, 1 September 2016; Sociedad Española de Bioquímica y Biología Molecular (SEBBM). Rubes Editorial, S.L. SEBBM: Salamanca, Spain, 2016; 74.Available online: https://studylib.es/doc/5567030/libro-de-resumenes---congreso-sebbm-salamanca-2016:Salamanca (accessed on 14 December 2021).
115. Cumplido-Laso, G.; Medina-Puche, L.; Moyano, E.; Hoffmann, T.; Sinz, Q.; Ring, L.; Studart-Wittkowski, C.; Caballero, J.L.; Schwab, W.; Muñoz-Blanco, J. et al. The fruit ripening-related gene FaAAT2 encodes an acyl transferase involved in strawberry aroma biogenesis. J. Exp. Bot.; 2012; 63, pp. 4275-4290. [DOI: https://dx.doi.org/10.1093/jxb/ers120]
116. Molina-Hidalgo, F.J.; Medina-Puche, L.; Cañete-Gómez, C.; Franco-Zorrilla, J.M.; López-Vidriero, I.; Solano, R.; Caballero, J.L.; Rodríguez-Franco, A.; Blanco-Portales, R.; Muñoz-Blanco, J. et al. The fruit-specific transcription factor FaDOF2 regulates the production of eugenol in ripe fruit receptacles. J. Exp. Bot.; 2017; 68, pp. 4529-4543. [DOI: https://dx.doi.org/10.1093/jxb/erx257]
117. Liu, T.; Li, M.; Liu, Z.; Ai, X.; Li, Y. Reannotation of the cultivated strawberry genome and establishment of a strawberry genome database. Hortic. Res.; 2021; 8, 41. [DOI: https://dx.doi.org/10.1038/s41438-021-00476-4]
118. Labadie, M.; Vallin, G.; Petit, A.; Ring, L.; Hoffmann, T.; Gaston, A.; Potier, A.; Munoz-Blanco, J.; Caballero, J.L.; Schwab, W. et al. The genetic architecture of fruit colour in strawberry (Fragaria × ananassa) uncovers the predominant contribution of the F. vesca subgenome to anthocyanins and reveals underlying genetic variations. bioRxiv; 2020; [DOI: https://dx.doi.org/10.1101/2020.06.25.171496]
119. LI, Y.; LIU, T.; LUO, H.; LIU, S. The transcriptional landscape of cultivated strawberry (Fragaria × ananassa) and its diploid ancestor (Fragaria vesca) during fruit development. J. Integr. Agric.; 2021; 20, pp. 1540-1553. [DOI: https://dx.doi.org/10.1016/S2095-3119(20)63376-7]
120. Han, Y.; Dang, R.; Li, J.; Jinzhu, J.; Zhang, N.; Jia, M.; Wei, L.; Li, Z.; Li, B.; Jia, W. FaSnRK2.6, an ortholog of Open Stomata 1, is a Negative Regulator of Strawberry Fruit Development and Ripening. Plant Physiol.; 2015; 167, [DOI: https://dx.doi.org/10.1104/pp.114.251314]
121. Bernardes, W.S.; Menossi, M. Plant 3′ Regulatory Regions From mRNA-Encoding Genes and Their Uses to Modulate Expression. Front. Plant Sci.; 2020; 11, 1252. [DOI: https://dx.doi.org/10.3389/fpls.2020.01252]
122. Schaart, J.G.; Tinnenbroek-Capel, I.E.M.; Krens, F.A. Isolation and characterization of strong gene regulatory sequences from apple, Malus × domestica. Tree Genet. Genomes; 2011; 7, pp. 135-142. [DOI: https://dx.doi.org/10.1007/s11295-010-0320-z]
123. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res.; 2002; 30, pp. 325-327. [DOI: https://dx.doi.org/10.1093/nar/30.1.325]
124. Shahmuradov, I.; Umarov, R.; Solovyev, V. TSSPlant: A new tool for prediction of plant Pol II promoters. Nucleic Acids Res.; 2017; 45, e65. [DOI: https://dx.doi.org/10.1093/nar/gkw1353]
125. Salamov, A.A.; Solovyev, V.V. Recognition of 3-processing sites of human mRNA precursors. CABIOS; 1997; 13, pp. 23-28. [DOI: https://dx.doi.org/10.1093/bioinformatics/13.1.23]
126. Schaart, J.G.; Krens, F.A.; Wolters, A.M.A.; Visser, R.G.F. Plant Transformation Technologies; John Wiley & Sons: Hoboken, NJ, USA, 2010.
127. Karimi, M.; Inzé, D.; Depicker, A. GATEWAYTM vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci.; 2002; 7, pp. 193-195. [DOI: https://dx.doi.org/10.1016/S1360-1385(02)02251-3]
128. Lazo, G.R.; Stein, P.A.; Ludwig, R.A. A DNA transformation-competent Arabidopsis genomic library in Agrobacterium. Bio/Technology; 1991; 9, pp. 963-967. [DOI: https://dx.doi.org/10.1038/nbt1091-963]
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Under climate change, the spread of pests and pathogens into new environments has a dramatic effect on crop protection control. Strawberry (Fragaria spp.) is one the most profitable crops of the Rosaceae family worldwide, but more than 50 different genera of pathogens affect this species. Therefore, accelerating the improvement of fruit quality and pathogen resistance in strawberry represents an important objective for breeding and reducing the usage of pesticides. New genome sequencing data and bioinformatics tools has provided important resources to expand the use of synthetic biology-assisted intragenesis strategies as a powerful tool to accelerate genetic gains in strawberry. In this paper, we took advantage of these innovative approaches to create four RNAi intragenic silencing cassettes by combining specific strawberry new promoters and pathogen defense-related candidate DNA sequences to increase strawberry fruit quality and resistance by silencing their corresponding endogenous genes, mainly during fruit ripening stages, thus avoiding any unwanted effect on plant growth and development. Using a fruit transient assay, GUS expression was detected by the two synthetic FvAAT2 and FvDOF2 promoters, both by histochemical assay and qPCR analysis of GUS transcript levels, thus ensuring the ability of the same to drive the expression of the silencing cassettes in this strawberry tissue. The approaches described here represent valuable new tools for the rapid development of improved strawberry lines.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer





