Controlled Hemorrhage Sensitizes Angiotensin II-Elicited Hypertension through Activation of the Brain Renin-Angiotensin System Independently of Endoplasmic Reticulum Stress

Abstract

Hemorrhagic shock is associated with activation of renin-angiotensin system (RAS) and endoplasmic reticulum stress (ERS). Previous studies demonstrated that central RAS activation produced by various challenges sensitizes angiotensin (Ang) II-elicited hypertension and that ERS contributes to the development of neurogenic hypertension. The present study investigated whether controlled hemorrhage could sensitize Ang II-elicited hypertension and whether the brain RAS and ERS mediate this sensitization. Results showed that hemorrhaged (HEM) rats had a significantly enhanced hypertensive response to a slow-pressor infusion of Ang II when compared to sham HEM rats. Treatment with either angiotensin-converting enzyme (ACE) 1 inhibitor, captopril, or ACE2 activator, diminazene, abolished the HEM-induced sensitization of hypertension. Treatment with the ERS agonist, tunicamycin, in sham HEM rats also sensitized Ang II-elicited hypertension. However, blockade of ERS with 4-phenylbutyric acid in HEM rats did not alter HEM-elicited sensitization of hypertension. Either HEM or ERS activation produced a greater reduction in BP after ganglionic blockade, upregulated mRNA and protein expression of ACE1 in the hypothalamic paraventricular nucleus (PVN), and elevated plasma levels of Ang II but reduced mRNA expression of the Ang-(1-7) receptor, Mas-R, and did not alter plasma levels of Ang-(1-7). Treatment with captopril or diminazene, but not phenylbutyric acid, reversed these changes. No treatments had effects on PVN protein expression of the ERS marker glucose-regulated protein 78. The results indicate that controlled hemorrhage sensitizes Ang II-elicited hypertension by augmenting RAS prohypertensive actions and reducing RAS antihypertensive effects in the brain, which is independent of ERS mechanism.

This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

1. Introduction

Hemorrhagic shock (HS) is characterized by a rapid and significant loss of blood that leads to hemodynamic instability, decreased tissue perfusion, organ injury, and even death [1]. The current treatments for HS include timely hemostasis, volume replacement, and whole blood or blood component therapy [2–4]. There have been progress in understanding hemorrhage pathophysiology and improvement in the treatment to increase survival [5]. However, the long-term consequences of HS and the development of chronic disorders, such as cardiovascular diseases including hypertension, and interventions to reduce such pathologies in survivors of HS have not been reported.

HS is associated with activation of the sympathetic nervous system (SNS), renin-angiotensin system (RAS), and arginine vasopressin (AVP). These three systems are mobilized to restore homeostasis following acute HS, and elimination of any of these pressor systems attenuates the compensatory response to acute hypovolemic hypotension [6–10]. For example, central blockade of angiotensin II type 1 receptor (AT1-R) produced a markedly greater fall in blood pressure (BP), a reduced tachycardia, and impaired vasopressin release during and after hemorrhage, suggesting that brain angiotensin (Ang) II acting through AT1-R plays an important physiological role in mediating rapid cardiovascular regulation in response to hemorrhage [7, 11].

Recent studies have demonstrated that hemorrhage leads to endoplasmic reticulum stress (ERS) that is initiated by the elevated inflammation and overactivation of the RAS following hemorrhage [12–14]. All these responses to hemorrhage depend on the integrity of several brain regions controlling SNS tone and BP regulation including periventricular tissue surrounding the anteroventral third ventricle (AV3V) region and the hypothalamic paraventricular nucleus (PVN) [15–19].

It is well established that interactions between the RAS and proinflammatory cytokines (PICs, e.g., tumor necrosis factor alpha (TNF-α), interleukin- (IL-) 1β, and IL-6) play a critical role in the development of neurogenic hypertension via their actions in various brain cardiovascular nuclei such as the subfornical organ (SFO), PVN, and rostral ventrolateral medulla (RVLM) [20–23]. Many types of hypertension increase brain Ang II formation and upregulate expression of brain AT1-R and angiotensin-converting enzyme (ACE) 1 [24, 25]. Another form of ACE, ACE2, is a component of the antihypertensive arm of the RAS that has properties opposite to those of the classic prohypertensive arm of the RAS. ACE2 acts to convert Ang II into Ang-(1–7) [26]. Reduced ACE2 expression and/or enzyme activity have been found in various brain regions in hypertension models [27, 28]. Overexpression of ACE2 in the brain blunts the development of hypertension in several animal models, including Ang II-induced and DOCA/salt-induced hypertension [27, 29, 30]. Recently, ERS has been implicated in the development and maintenance of neurogenic hypertension. Activation of ERS in the SFO and the RVLM mediates Ang II-induced hypertension and increased BP in spontaneously hypertensive rats (SHRs) [31, 32]. Therefore, both hemorrhage and hypertension can activate common mediators and act on the same cardiovascular nuclei in the physiological and pathophysiological process.

Many physiological stressors have been shown to induce hypertensive response sensitization (HTRS). Physiological stressors also induce upregulation of several prohypertensive components of the brain RAS and PICs. Such changes in the central nervous system (CNS) have been found in key components of the central neural network controlling sympathetic drive. These areas include the PVN and components of the lamina terminalis (LT), namely, the SFO, the median preoptic nucleus (MnPO), and the organum vasculosum (OVLT). In earlier preliminary studies, we found that hypotensive hemorrhage induced HTRS [33]. Given that hemorrhage activates the brain RAS, inflammation, and ERS [12–14] and activation of the prohypertensive arm of the RAS and inflammation in the brain are involved in the sensitization of hypertension [21, 22], we hypothesized that controlled hypotensive hemorrhage inducing HTRS is mediated by the RAS and ERS. To test the hypothesis, we first investigated the sensitizing effect of controlled hemorrhage or activation of ERS on HTRS elicited by a slow-pressor Ang II challenge. Because blockade of ACE1 or ERS improves the hemodynamic and metabolic status and attenuates acute organ injury in HS animals [34–36], we also determined whether systemic treatment with captopril (Cap, ACE1 inhibitor), diminazene aceturate (DIZE, ACE2 activator), or 4-phenylbutyric acid (4-PBA, ERS antagonist) would have long-term beneficial effects by blocking hemorrhage-induced sensitization. We also tested whether either activation or inhibition of activity in components of the brain RAS, PICs, and ERS altered the effect of hemorrhage on the induction of HTRS.

2. Materials and Methods

2.1. Animals

All procedures were reviewed and approved by the Hebei Medical University and Hebei North University Institutional Animal Care and Use Committee conforming to US National Institutes of Health guidelines. All experiments were performed in the Hebei North University.

Ten-week-old male Wistar rats were purchased from Sibeifu Biotechnology Co., Ltd (Beijing, China), housed in standard plastic microisolator cages, and maintained in a temperature- ($23\pm 2$°C) and light- (12-h light/dark cycle) controlled animal facility. The rats had unlimited access to standard rat chow and water. A total of ninety-seven male rats were used for the experiments.

2.2. Controlled Hemorrhage Paradigm

Rat transmitters (HD-S10, DSI®, St. Paul, MN) were used to directly measure BP and heart rate (HR). After baseline BP and HR recordings were made, rats were hemorrhaged (HEM) via the jugular vein on two occasions separated by 1 day. The blood was collected in heparin. Then, the blood was centrifuged, and the cells were resuspended in saline for reinfusion. Hemorrhage proceeded at the rate of 1.5 ml/min (a total volume usually 5 ml/rat) until BP was lowered to ~40 mmHg, and then, BP was maintained at that level for 30 min after which time the rats were reinfused. Rats in the sham HEM (S-HEM) group underwent the same surgery and procedure, but there was no blood withdrawal. After one week, the rats were administrated a slow-pressor dose of Ang II (120 ng/kg/min, sc) for 2 weeks to test for HTRS.

Experiment 1. BP and HR were recorded by telemetry for 5 days at baseline and then for the subsequent 24 consecutive days. Over this time, rats were first subjected to the two S-HEM or HEM procedures and then 8 days later by implantation of an osmotic minipump (model 2002, ALZET) that delivered Ang II (120 ng/kg/min, sc) for the next two weeks. Some groups of S-HEM and HEM rats were treated with RAS or ERS agonists or antagonists beginning immediately after the first S-HEM/HEM procedures and continuing until immediately before beginning testing for HTRS elicited by the Ang II infusion. Therefore, the experiments involved 6 groups ($n=5$-7 rats/group): (1) S-HEM+Ang II; (2) HEM+Ang II; (3) HEM/Cap+Ang II (ACE1 inhibitor, 40 mg/kg/day, ip); (4) HEM/DIZE+Ang II (ACE2 activator, 7.5 mg/kg/day, ip); (5) HEM/4-PBA+Ang II (ERS antagonist, 100 mg/kg, ip); or (6) S-HEM/tunicamycin+Ang II (TM, ERS agonist, 10 μg/kg, ip). The doses of Cap, DIZE, 4-PBA, and TM were chosen based on published studies, and they were injected ip daily [37–40].

Experiment 2. Additional studies were performed to assess the effects of the S-HEM and HEM on plasma levels of Ang II and Ang-(1-7) as well as gene and protein expression of RAS and PIC components and ERS marker in the PVN. Trunk blood and brains of S-HEM rats, HEM rats, and HEM rats treated with Cap, DIZE, 4-PBS, or TM ($n=10$ per group) were collected on day 8 after the last HEM, corresponding to the time at which Ang II infusion was initiated in Experiment 1.

2.3. Telemetry Transmitter and Osmotic Pump Implantation

The rats were anesthetized with a ketamine-xylazine mixture (90% ketamine and 10% xylazine), and the femoral artery was accessed with a ventral incision. The right femoral artery was isolated, and the catheter of a telemetry probe was inserted into the vessel. Through the same ventral incision, a pocket along the right flank was formed. The body of the telemetry transmitter (HD-S10, DSI®, St. Paul, MN) was slipped into the pocket and secured with tissue adhesive. The ventral incision was then closed with suture. Beginning seven days after surgery, BP and HR data collection was initiated.

In a separate procedure under isoflurane anesthesia (0.5-5% inhalation), osmotic pumps (model 2002, ALZET®) containing Ang II (120 ng/kg/min, Sigma) were implanted subcutaneously in the back of rats.

2.4. Evaluation of BP Responses to Autonomic Blockade

BP was also measured in the presence of the ganglionic blocker hexamethonium (Hex, 30 mg/kg, ip). Ganglionic blockade was repeated two times in each animal once during baseline and once after 14 days of Ang II infusion. On the day of ganglionic blockade experiments, rats were allowed to stabilize for at least 60 min, after which time BP was recorded for 20 min before and after Hex injection.

2.5. Real-Time PCR Analysis

In Experiment 2, all rats were decapitated, and the brains were quickly removed and put in iced saline for 1 minute. Then, the brains were cut into coronal sections of approximately 200 μm thickness, and PVN tissues were punched with a 15-gauge needle stub (inner diameter: 1.5 mm). Some immediately surrounding tissue was usually included in the punch biopsies. Both sides of PVN were analyzed for mRNA expression as a whole. Total RNA was isolated from the PVN using the Trizol method (Invitrogen) and treated with DNase I (Invitrogen, Carlsbad, CA, USA) to remove any genomic DNA contamination. RNA integrity was checked by gel electrophoresis. Total RNA was reverse transcribed following the manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA). Real-time PCR was conducted using 200-300 ng of cDNA and 500 nM of each primer in a 20 μl reaction with iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). Amplification cycles were conducted at 95°C for 3 min, followed by 40 cycles of 95°C for 15 s and annealing/extension at 60°C for 30 s. Reactions were performed in duplicate and analyzed using a C1000 thermocycler system (Bio-Rad). Messenger RNA levels for RAS components (renin, ACE1, AT1-R, ACE2, Ang-(1-7) receptor Mas-R), PICs (TNF-α, IL-1β, and IL-6), ERS marker (glucose-regulated protein 78 (GRP 78)), and GAPDH were analyzed with SYBR Green real-time RT-PCR. The sequences for the primers are summarized in Table 1. Real-time RT-PCR was performed with the ABI prism 7300 Sequence Detection System (Applied Biosystems, Carlsbad, CA). The values were corrected by GAPDH, and the final concentration of mRNA was calculated using the formula $x=2^{-\Delta \Delta \text{Ct}}$, where $x$ is the fold difference relative to control.

Table 1

Primer sequences for real-time PCR.

Gene	Forward primer	Reverse primer	Product size (bp)
GAPDH	TGACTCTACCCACGGCAAGTTCAA	ACGACATACTCAGCACCAGCATCA	141
Renin	CTGCCACCTTGTTGTGTGAG	ACCTGGCTACAGTTCACAACG	154
ACE1	GTGTTGTGGAACGAATACGC	CCTTCTTTATGATCCGCTTGA	187
AT1-R	CTCAAGCCTGTCTACGAAAATGAG	GTGAATGGTCCTTTGGTCGT	188
ACE2	TTAAGCCACCTTACGAGCCTC	GCCAATGTCCATGGAGTCAT	170
Mas-R	TGTGGGTGGCTTTCGATT	CCCGTCACATATGGAAGCAT	159
TNF-α	GCCGATTTGCCACTTCATAC	AAGTAGACCTGCCCGGACTC	209
IL-6	GCCTATTGAAAATCTGCTCTGG	GGAAGTTGGGGTAGGAAGGA	160
IL-1β	AGCAACGACAAAATCCCT GT	GAAGACAAACCGCTTTTCCA	209
GRP 78	TTCCGAGGAACACTGTGGTG	GTCAGGGGTCGTTCACCTTC	109

ACE: angiotensin-converting enzyme; AT1-R: angiotensin II type 1 receptor; Mas-R: angiotensin-(1–7) receptor; TNF-α: tumor necrosis factor-α; IL-1β: interleukin-1β; IL-6: interleukin-6; GRP 78: the glucose-regulated protein 78.

2.6. Western Blot Analysis

PVN tissues were homogenized in lysis buffer, and the protein concentration in the supernatant was measured with the BCA protein assay Kit (Pierce, Rockford, IL, USA). Equivalent amounts of protein were separated on 4-15% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes (Millipore Corporation, Bedford, MA, USA). The membranes were blocked in 5% nonfat dry milk for 1 h and then incubated with primary antibodies to ACE1 (1 : 100, ab11734, Abcam, Cambridge, MA, USA), ACE2 receptor (1 : 500, ab108252, Abcam), GRP78 (1 : 400, ab21685, Abcam), and β-actin (1 : 5000, 66009-1-1 g, Proteintech, Rosemont, IL, USA) overnight at 4°C. After three washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Applygen, Beijing, China) for 1 h at room temperature. The signal was visualized using an enhanced chemiluminescence (ECL) detection system (ImageQuant LAS 4000, GE Co., Boston, MA, USA), and densities of the immunobands were quantitated using Quantity One software (V4.6.2, Bio-Rad Co., Boston, MA, USA). All data were corrected by β-actin.

2.7. Blood Plasma Analysis

In Experiment 2, when the rats were decapitated, trunk blood was collected in a sodium heparin tube (BD vacutainer) and centrifuged. The plasma was used for biochemical assays. Plasma levels of Ang II (Cat#, E-EL-R1430c, Elabscience Biotechnology, Wuhan, China) and Ang-(1-7) (Cat#, E-EL-R1138c, Elabscience Biotechnology, Wuhan, China) were measured with commercial ELISA kits according to the manufacturers’ instructions.

2.8. Statistical Analysis

Mean arterial pressure (MAP) and HR obtained from the telemetry recordings are presented as mean daily values averaged from daytime and nighttime measurements. Differences for MAP and HR were calculated for each animal based on the mean of a 5-day baseline subtracted from the mean of the final 5 days of Ang II treatment. For experiments on the effect of acute Hex injection, differences for BP were calculated for each animal based on the baseline subtracted from the BP after ip injection of Hex. Two-way ANOVAs for the experimental groups were then conducted on the means of the calculated differences for MAP and HR. After establishing a significant ANOVA, post hoc analyses were performed with Tukey multiple comparison tests between pairs of mean changes (GraphPad Prism 8.0). One-way ANOVAs and post hoc Tukey analyses were used to test for the differences in plasma levels and mRNA and protein expression of the RAS and PIC components and ERS marker in the blood and PVN, respectively. All data are expressed as $\text{means}\pm \text{SEM}$. Statistical significance was set at $p<0.05$.

3. Results

3.1. HEM Sensitizes Systemic Ang II-Induced Hypertension and the Effects of Treatment with Cap or DIZE on HEM-Induced Sensitization of Hypertension

During infusion with the slow-pressor dose of ANG II, the HEM rats showed a significantly enhanced hypertensive response ($\Delta 49.2\pm 3.3$ mmHg) compared with S-HEM rats ($\Delta 26.9\pm 1.9$ mmHg, $p<0.05$, Figures 1(a) and 1(b)).

[figures omitted; refer to PDF]

Treatment with Cap beginning at the end of the first HEM procedure and continuing until starting the infusion of the slow-pressor dose of Ang II produced a slight decrease in MAP ($104.3\pm 1.2$ mmHg, $p<0.05$) and increase in HR ($366.8\pm 4.3$ beats/min, $p<0.05$) when compared to baseline measures (MAP, $109.9\pm 1.2$ mmHg; HR, $349.7\pm 3.1$ beats/min). Treatment with DIZE had no effects on basal MAP or HR. However, treatment with either the ACE1 inhibitor Cap or the ACE2 activator DIZE abolished the HEM-induced sensitization of hypertension in the HEM rats (Cap, $\Delta 19.4\pm 3.1$ mmHg; DIZE, $\Delta 25.1\pm 2.2$ mmHg, $p<0.05$, Figures 1(a) and 1(b)) (two-way ANOVA for changes in MAP, $F3,15=19.72$, $p<0.001$).

Chronic Ang II infusion did not produce significant changes in HR in any of the groups (two-way ANOVA for changes in HR, $F3,15=0.09599$, $p=0.9611$) (Figures 1(c) and 1(d)).

3.2. The Effects of Treatment with ERS Antagonist or Agonist on HEM-Induced Sensitization of Hypertension

Treatment with either the ERS antagonist 4-PBA or agonist TM from the end of the first S-HEM or HEM treatment to the beginning of infusion of the slow-pressor dose of Ang II produced no effects on baseline MAP and HR. Like the sensitizing effect of HEM on Ang II-induced hypertension, treatment with TM in S-HEM rats also sensitized the hypertensive response to systemic Ang II ($\Delta 45.6\pm 4.4$ mmHg) when compared to that in S-HEM alone ($\Delta 26.9\pm 1.9$ mmHg, $p<0.05$, Figures 2(a) and 2(b)). However, blockade of ERS by treatment with 4-PBA did not alter the HEM-induced sensitization of hypertension in the HEM rats ($\Delta 49.2\pm 3.3$ mmHg, $p>0.05$, Figures 2(a) and 2(b)) (two-way ANOVA for changes in MAP, $F3,14=5.736$, $p=0.0089$).

[figures omitted; refer to PDF]

Chronic Ang II infusion produced comparable changes in HR in all groups (two-way ANOVA for changes in HR $F3,14=0.5714$, $p=0.643$) (Figures 2(c) and 2(d)).

3.3. Effects of Autonomic Blockade on BP

Figure 3 shows decreases in BP with acute ganglionic blockade in all groups. The average reduction in the BP response to Hex injection before S-HEM or HEM was $-18.8\pm 0.9$ mmHg. Following 14 days of Ang II infusion, acute Hex injection resulted in a significant reduction in BP in S-HEM rats ($-34.7\pm 2.0$ mmHg, $p<0.05$). However, the reductions in BP after Hex injection were further augmented in HEM rats ($-59.6\pm 4.2$ mmHg, $p<0.05$) or S-HEM rats treated with ER stress agonist ($-53.7\pm 3.6$ mmHg, $p<0.05$). Treatments with ACE1 inhibitor ($-34.8\pm 2.0$, $p<0.05$) or ACE2 activator ($-32.5\pm 1.5$ mmHg, $p<0.05$) in HEM rats significantly attenuated the Hex-induced reduction in BP, but treatment with the ERS blocker in HEM rats did not alter it ($-59.7\pm 2.6$ mmHg, $p>0.05$) (two-way ANOVA for changes in BP, $F6,30=27.66$, $p<0.0001$).

[figure omitted; refer to PDF]

Hemorrhage accounts for 30-40% of total trauma deaths. Blood transfusion with balanced components or whole blood for patients suffering from HS has dramatically increased survival [2–4]. However, the long-term consequences of HS and the development of chronic disorders, such as cardiovascular diseases including hypertension, and interventions to reduce such pathologies in survivors of HS have not been reported. The present study provides the first direct evidence implicating the sensitizing effects of hemorrhage on the development of hypertension and reveals the central mechanisms of the RAS and sympathetic activation in the sensitization process. Manipulation of the RAS by inhibition of its prohypertensive effects and activation of its antihypertensive effects antagonizes hemorrhage-elicited sensitization of hypertension, highlighting a potential target for pharmacologic therapy and management strategies of long-term cardiovascular consequences related to hemorrhage.

Authors’ Contributions

GSZ, ZGZ, BX, and AKJ designed the experiments; GBW, HBD, JYZ, SS, JLC, YZ, and ZAZ performed experiments and analyzed data; GSZ, ZGZ, and BX wrote the manuscript; GSZ, ZGZ, JLW, BX, and AKJ revised the manuscript. All authors read and approved the final manuscript. Guo-Biao Wu and Hui-Bo Du contributed equally to this work.

Acknowledgments

This work was supported by the Funds for Prevention of Geriatric Diseases of Hebei Province (No. 303132618 to GSZ), the National Natural Science Foundation of China (No. 81670446 to ZGZ), and National Institutes of Health research grants R01 HL-139575 (USA) (to AKJ and BX).

Glossary

Abbreviations

ACE:Angiotensin-converting enzyme

Ang II:Angiotensin II

AT1-R:Angiotensin II type 1 receptor

AVP:Arginine vasopressin

BP:Blood pressure

Cap:Captopril

CNS:Central nervous system

DIZE:Diminazene aceturate

ERS:Endoplasmic reticulum stress

GRP 78:Glucose-regulated protein 78

HEM:Hemorrhaged

Hex:Hexamethonium

HR:Heart rate

HS:Hemorrhagic shock

HTRS:Hypertensive response sensitization

IL-1β:Interleukin-1β

IL-6:Interleukin-6

LT:The lamina terminalis

MAP:Mean arterial pressure

MnPO:Median preoptic nucleus

OVLT:The vascular organ of the lamina terminalis

4-PBA:4-Phenylbutyric acid

PIC:Proinflammatory cytokine

PVN:Hypothalamic paraventricular nucleus

RAS:Renin-angiotensin system

RVLM:Rostral ventrolateral medulla

SFO:The subfornical organ

S-HEM:Sham hemorrhaged

SHRs:Spontaneously hypertensive rats

SNA:Sympathetic nerve activity

SNS:Sympathetic nervous system

TNF-α:Tumor necrosis factor-α

TM:Tunicamycin.

References

[1] F. H. Millham, "A brief history of shock," Surgery, vol. 148 no. 5, pp. 1026-1037, DOI: 10.1016/j.surg.2010.02.014, 2010.

[2] D. S. Gann, W. R. Drucker, "Hemorrhagic shock," Journal of Trauma and Acute Care Surgery, vol. 75 no. 5, pp. 888-895, DOI: 10.1097/TA.0b013e3182a686ed, 2013.

[3] M. Jacob, P. Kumar, "The challenge in management of hemorrhagic shock in trauma," Medical Journal, Armed Forces India, vol. 70 no. 2, pp. 163-169, DOI: 10.1016/j.mjafi.2014.03.001, 2014.

[4] E. Crowe, S. M. DeSantis, A. Bonnette, J. O. Jansen, J. M. Yamal, J. B. Holcomb, C. Pedroza, J. A. Harvin, M. B. Marques, E. B. C. Avritscher, H. E. Wang, "Whole blood transfusion versus component therapy in trauma resuscitation: a systematic review and meta-analysis," Journal of the American College of Emergency Physicians Open, vol. 1 no. 4, pp. 633-641, DOI: 10.1002/emp2.12089, 2020.

[5] K. Powell, K. Shah, C. Hao, Y. C. Wu, A. John, R. K. Narayan, C. Li, "Neuromodulation as a new avenue for resuscitation in hemorrhagic shock," Bioelectronic Medicine, vol. 5 no. 1,DOI: 10.1186/s42234-019-0033-z, 2019.

[6] G. Feuerstein, R. L. Zerbe, D. K. Meyer, I. J. Kopin, "Alteration of cardiovascular, neurogenic, and humoral responses to acute hypovolemic hypotension by administered prostacyclin," Journal of Cardiovascular Pharmacology, vol. 4 no. 2, pp. 246-253, DOI: 10.1097/00005344-198203000-00013, 1982.

[7] W. J. Lee, E. K. Yang, D. K. Ahn, Y. Y. Park, J. S. Park, H. J. Kim, "Central ANG II-receptor antagonists impair cardiovascular and vasopressin response to hemorrhage in rats," The American Journal of Physiology, vol. 268 no. 6, pp. R1500-R1506, DOI: 10.1152/ajpregu.1995.268.6.R1500, 1995.

[8] E. J. Whalen, S. J. Lewis, A. K. Johnson, "Hemodynamic responses elicited by γ 2 -MSH or blood replacement in hemorrhaged rats," The Journal of Surgical Research, vol. 139 no. 1, pp. 121-127, DOI: 10.1016/j.jss.2006.09.025, 2007.

[9] R. L. Zerbe, M. A. Bayorh, G. Feuerstein, "Vasopressin: an essential pressor factor for blood pressure recovery following hemorrhage," Peptides, vol. 3 no. 3, pp. 509-514, DOI: 10.1016/0196-9781(82)90117-6, 1982.

[10] R. L. Zerbe, G. Feuerstein, D. K. Meyer, I. J. Kopin, "Cardiovascular, sympathetic, and renin-angiotensin system responses to hemorrhage in vasopressin-deficient rats," Endocrinology, vol. 111 no. 2, pp. 608-613, DOI: 10.1210/endo-111-2-608, 1982.

[11] I. T. Velasco, M. Rocha-e-Silva, "Hypertonic saline resuscitation is prevented by intracerebroventricular saralasin but not by captopril," Brazilian Journal of Medical and Biological Research, vol. 22 no. 2, pp. 237-239, 1989.

[12] B. Jian, C. H. Hsieh, J. Chen, M. Choudhry, K. Bland, I. Chaudry, R. Raju, "Activation of endoplasmic reticulum stress response following trauma- hemorrhage," Biochimica et Biophysica Acta, vol. 1782 no. 11, pp. 621-626, DOI: 10.1016/j.bbadis.2008.08.007, 2008.

[13] V. Sukumaran, K. Watanabe, P. T. Veeraveedu, N. Gurusamy, M. Ma, R. A. Thandavarayan, A. P. Lakshmanan, K. Yamaguchi, K. Suzuki, M. Kodama, "Olmesartan, an AT1Antagonist, attenuates oxidative stress, endoplasmic reticulum stress and cardiac inflammatory mediators in rats with heart failure induced by experimental autoimmune myocarditis," International Journal of Biological Sciences, vol. 7 no. 2, pp. 154-167, DOI: 10.7150/ijbs.7.154, 2011.

[14] C. N. Young, "Endoplasmic reticulum stress in the pathogenesis of hypertension," Experimental Physiology, vol. 102 no. 8, pp. 869-884, DOI: 10.1113/EP086274, 2017.

[15] G. Feuerstein, A. K. Johnson, R. L. Zerbe, R. Davis-Kramer, A. I. Faden, "Anteroventral hypothalamus and hemorrhagic shock: cardiovascular and neuroendocrine responses," The American Journal of Physiology, vol. 246 no. 4, pp. R551-R557, DOI: 10.1152/ajpregu.1984.246.4.R551, 1984.

[16] M. Khanmoradi, A. Nasimi, "Endogenous angiotensin II in the paraventricular nucleus regulates arterial pressure during hypotension in rat, a single-unit study," Neuroscience Research, vol. 114, pp. 35-42, DOI: 10.1016/j.neures.2016.09.004, 2017.

[17] A. M. Whitaker, P. E. Molina, "Angiotensin (1-7) contributes to nitric oxide tonic inhibition of vasopressin release during hemorrhagic shock in acute ethanol intoxicated rodents," Life Sciences, vol. 93 no. 17, pp. 623-629, DOI: 10.1016/j.lfs.2013.08.020, 2013.

[18] A. M. Whitaker, J. K. Sulzer, P. E. Molina, "Augmented central nitric oxide production inhibits vasopressin release during hemorrhage in acute alcohol-intoxicated rodents," American Journal of Physiology. Regulatory, Integrative and Comparative Physiology, vol. 301 no. 5, pp. R1529-R1539, DOI: 10.1152/ajpregu.00035.2011, 2011.

[19] M. Yalcin, V. Savci, "Restoration of blood pressure by centrally injected U-46619, a thromboxane A(2) analog, in hemorrhaged hypotensive rats: investigation of different brain areas," Pharmacology, vol. 70 no. 4, pp. 177-187, 2004.

[20] R. A. Dampney, "Central neural control of the cardiovascular system: current perspectives," Advances in Physiology Education, vol. 40 no. 3, pp. 283-296, DOI: 10.1152/advan.00027.2016, 2016.

[21] A. K. Johnson, B. Xue, "Central nervous system neuroplasticity and the sensitization of hypertension," Nature Reviews. Nephrology, vol. 14 no. 12, pp. 750-766, DOI: 10.1038/s41581-018-0068-5, 2018.

[22] B. Xue, Y. Zhang, A. K. Johnson, "Interactions of the brain renin-angiotensin-system (RAS) and inflammation in the sensitization of hypertension," Frontiers in Neuroscience, vol. 14,DOI: 10.3389/fnins.2020.00650, 2020.

[23] C. C. Li, W. X. Chen, J. Wang, M. Xia, Z. C. Jia, C. Guo, X. Q. Tang, M. X. Li, Y. Yin, X. Liu, H. Feng, "Nicotinamide riboside rescues angiotensin II–induced cerebral small vessel disease in mice," CNS Neuroscience & Therapeutics, vol. 26 no. 4, pp. 438-447, DOI: 10.1111/cns.13276, 2020.

[24] C. N. Young, R. L. Davisson, "Angiotensin-II, the brain, and hypertension: an update," Hypertension, vol. 66 no. 5, pp. 920-926, DOI: 10.1161/HYPERTENSIONAHA.115.03624, 2015.

[25] P. Nakagawa, J. Gomez, J. L. Grobe, C. D. Sigmund, "The renin-angiotensin system in the central nervous system and its role in blood pressure regulation," Current Hypertension Reports, vol. 22 no. 1,DOI: 10.1007/s11906-019-1011-2, 2020.

[26] R. A. S. Santos, W. O. Sampaio, A. C. Alzamora, D. Motta-Santos, N. Alenina, M. Bader, M. J. Campagnole-Santos, "The ACE2/angiotensin-(1-7)/MAS axis of the renin-angiotensin system: focus on angiotensin-(1-7)," Physiological Reviews, vol. 98 no. 1, pp. 505-553, DOI: 10.1152/physrev.00023.2016, 2018.

[27] H. Xia, S. Sriramula, K. H. Chhabra, E. Lazartigues, "Brain angiotensin-converting enzyme type 2 shedding contributes to the development of neurogenic hypertension," Circulation Research, vol. 113 no. 9, pp. 1087-1096, DOI: 10.1161/CIRCRESAHA.113.301811, 2013.

[28] M. Yamazato, Y. Yamazato, C. Sun, C. Diez-Freire, M. K. Raizada, "Overexpression of angiotensin-converting enzyme 2 in the rostral ventrolateral medulla causes long-term decrease in blood pressure in the spontaneously hypertensive rats," Hypertension, vol. 49 no. 4, pp. 926-931, DOI: 10.1161/01.HYP.0000259942.38108.20, 2007.

[29] Y. Feng, H. Xia, Y. Cai, C. M. Halabi, L. K. Becker, R. A. Santos, R. C. Speth, C. D. Sigmund, E. Lazartigues, "Brain-selective overexpression of human angiotensin-converting enzyme type 2 attenuates neurogenic hypertension," Circulation Research, vol. 106 no. 2, pp. 373-382, DOI: 10.1161/CIRCRESAHA.109.208645, 2010.

[30] H. Xia, T. M. de Queiroz, S. Sriramula, Y. Feng, T. Johnson, I. N. Mungrue, E. Lazartigues, "Brain ACE2 overexpression reduces DOCA-salt hypertension independently of endoplasmic reticulum stress," American Journal of Physiology. Regulatory, Integrative and Comparative Physiology, vol. 308 no. 5, pp. R370-R378, DOI: 10.1152/ajpregu.00366.2014, 2015.

[31] Y. M. Chao, M. D. Lai, J. Y. Chan, "Redox-sensitive endoplasmic reticulum stress and autophagy at rostral ventrolateral medulla contribute to hypertension in spontaneously hypertensive rats," Hypertension, vol. 61 no. 6, pp. 1270-1280, DOI: 10.1161/HYPERTENSIONAHA.111.00469, 2013.

[32] C. N. Young, X. Cao, M. R. Guruju, J. P. Pierce, D. A. Morgan, G. Wang, C. Iadecola, A. L. Mark, R. L. Davisson, "ER stress in the brain subfornical organ mediates angiotensin-dependent hypertension," The Journal of Clinical Investigation, vol. 122 no. 11, pp. 3960-3964, DOI: 10.1172/JCI64583, 2012.

[33] B. Xue, T. G. Beltz, F. Guo, R. L. Thunhorst, A. K. Johnson, "Controlled hypotensive hemorrhage sensitizes angiotensin II-elicited hypertension," The FASEB Journal, vol. 30 no. S1,DOI: 10.1096/fasebj.30.1_supplement.1234.2, 2016.

[34] J. G. Freeman, C. E. Hock, J. S. Edmonds, A. M. Lefer, "Anti-shock actions of a new converting enzyme inhibitor, enalaprilic acid, in hemorrhagic shock in cats," The Journal of Pharmacology and Experimental Therapeutics, vol. 231 no. 3, pp. 610-615, 1984.

[35] D. P. Obert, A. K. Wolpert, S. Korff, "Modulation of endoplasmic reticulum stress influences ischemia-reperfusion injury after hemorrhagic shock," Shock, vol. 52 no. 5, pp. e76-e84, DOI: 10.1097/SHK.0000000000001298, 2019.

[36] M. Yin, Z. H. Li, C. Wang, Y. Li, H. Zhang, H. B. Du, Z. A. Zhao, C. Y. Niu, Z. G. Zhao, "Stellate ganglion blockade repairs intestinal mucosal barrier through suppression of endoplasmic reticulum stress following hemorrhagic shock," International Journal of Medical Sciences, vol. 17 no. 14, pp. 2147-2154, DOI: 10.7150/ijms.47662, 2020.

[37] D. M. Bennion, E. A. Haltigan, A. J. Irwin, L. L. Donnangelo, R. W. Regenhardt, D. J. Pioquinto, D. L. Purich, C. Sumners, "Activation of the neuroprotective angiotensin-converting enzyme 2 in rat ischemic stroke," Hypertension, vol. 66 no. 1, pp. 141-148, DOI: 10.1161/HYPERTENSIONAHA.115.05185, 2015.

[38] P. Ernsberger, J. L. Johnson, T. Rosenthal, D. Mirelman, R. J. Koletsky, "Therapeutic actions of allylmercaptocaptopril and captopril in a rat model of metabolic syndrome," American Journal of Hypertension, vol. 20 no. 8, pp. 866-874, DOI: 10.1016/j.amjhyper.2007.02.015, 2007.

[39] A. L. Swislocki, T. L. LaPier, D. T. Khuu, K. Y. Fann, M. Tait, K. J. Rodnick, "Metabolic, hemodynamic, and cardiac effects of captopril in young, spontaneously hypertensive rats," American Journal of Hypertension, vol. 12 no. 6, pp. 581-589, DOI: 10.1016/S0895-7061(99)00012-6, 1999.

[40] H. Wang, Y. Wu, W. Han, J. Li, K. Xu, Z. Li, Q. Wang, K. Xu, Y. Liu, L. Xie, J. Wu, H. He, H. Xu, J. Xiao, "Hydrogen sulfide ameliorates blood-spinal cord barrier disruption and improves functional recovery by inhibiting endoplasmic reticulum stress-dependent autophagy," Frontiers in Pharmacology, vol. 9,DOI: 10.3389/fphar.2018.00858, 2018.

[41] G. Huber, F. Schuster, W. Raasch, "Brain renin-angiotensin system in the pathophysiology of cardiovascular diseases," Pharmacological Research, vol. 125, pp. 72-90, DOI: 10.1016/j.phrs.2017.06.016, 2017.

[42] J. S. Bains, A. V. Ferguson, "Paraventricular nucleus neurons projecting to the spinal cord receive excitatory input from the subfornical organ," The American Journal of Physiology, vol. 268 no. 3, pp. R625-R633, DOI: 10.1152/ajpregu.1995.268.3.R625, 1995.

[43] A. K. Johnson, P. M. Gross, "Sensory circumventricular organs and brain homeostatic pathways," The FASEB Journal, vol. 7 no. 8, pp. 678-686, DOI: 10.1096/fasebj.7.8.8500693, 1993.

[44] A. D. Shafton, A. Ryan, E. Badoer, "Neurons in the hypothalamic paraventricular nucleus send collaterals to the spinal cord and to the rostral ventrolateral medulla in the rat," Brain Research, vol. 801 no. 1-2, pp. 239-243, DOI: 10.1016/S0006-8993(98)00587-3, 1998.

[45] E. J. Do, E. Yang, K. S. Kim, H. J. Kim, W. J. Lee, "Changes in peripheral and central angiotensinogen mRNA levels after acute hemorrhage in conscious rats (abstract)," The Korean Journal of Physiology & Pharmacology, vol. 27, 1993.

[46] A. K. Johnson, Z. Zhang, S. C. Clayton, T. G. Beltz, S. W. Hurley, R. L. Thunhorst, B. Xue, "The roles of sensitization and neuroplasticity in the long-term regulation of blood pressure and hypertension," American Journal of Physiology. Regulatory, Integrative and Comparative Physiology, vol. 309 no. 11, pp. R1309-R1325, DOI: 10.1152/ajpregu.00037.2015, 2015.

[47] M. F. Doobay, L. S. Talman, T. D. Obr, X. Tian, R. L. Davisson, E. Lazartigues, "Differential expression of neuronal ACE2 in transgenic mice with overexpression of the brain renin-angiotensin system," American Journal of Physiology. Regulatory, Integrative and Comparative Physiology, vol. 292 no. 1, pp. R373-R381, DOI: 10.1152/ajpregu.00292.2006, 2007.

[48] J. Calka, C. H. Block, "Angiotensin-(1-7) and nitric oxide synthase in the hypothalamo- neurohypophysial system," Brain Research Bulletin, vol. 30 no. 5-6, pp. 677-685, DOI: 10.1016/0361-9230(93)90099-W, 1993.

[49] Y. Zhang, J. Lu, J. Shi, X. Lin, J. Dong, S. Zhang, Y. Liu, Q. Tong, "Central administration of angiotensin-(1-7) stimulates nitric oxide release and upregulates the endothelial nitric oxide synthase expression following focal cerebral ischemia/reperfusion in rats," Neuropeptides, vol. 42 no. 5-6, pp. 593-600, DOI: 10.1016/j.npep.2008.09.005, 2008.

[50] N. M. Sharma, K. P. Patel, "Post-translational regulation of neuronal nitric oxide synthase: implications for sympathoexcitatory states," Expert Opinion on Therapeutic Targets, vol. 21 no. 1, pp. 11-22, DOI: 10.1080/14728222.2017.1265505, 2017.

[51] B. Xue, Z. Zhang, T. G. Beltz, F. Guo, M. Hay, A. K. Johnson, "Estrogen regulation of the brain renin-angiotensin system in protection against angiotensin II-induced sensitization of hypertension," American Journal of Physiology. Heart and Circulatory Physiology, vol. 307 no. 2, pp. H191-H198, DOI: 10.1152/ajpheart.01012.2013, 2014.

[52] M. J. Gething, J. Sambrook, "Protein folding in the cell," Nature, vol. 355 no. 6355, pp. 33-45, DOI: 10.1038/355033a0, 1992.

[53] D. Ron, P. Walter, "Signal integration in the endoplasmic reticulum unfolded protein response," Nature Reviews. Molecular Cell Biology, vol. 8 no. 7, pp. 519-529, DOI: 10.1038/nrm2199, 2007.

[54] C. Hetz, "The unfolded protein response: controlling cell fate decisions under ER stress and beyond," Nature Reviews. Molecular Cell Biology, vol. 13 no. 2, pp. 89-102, DOI: 10.1038/nrm3270, 2012.

[55] L. N. Jiang, Y. L. Mi, L. M. Zhang, G. Q. Liu, H. H. Wang, Z. G. Zhao, C. Y. Niu, "Engagement of posthemorrhagic shock mesenteric lymph on CD4 + T lymphocytes _in vivo_ and _in vitro_," The Journal of Surgical Research, vol. 256, pp. 220-230, DOI: 10.1016/j.jss.2020.06.044, 2020.

[56] V. Burghi, N. C. Fernandez, Y. B. Gandola, V. G. Piazza, D. T. Quiroga, E. Guilhen Mario, J. Felix Braga, M. Bader, R. A. S. Santos, F. P. Dominici, M. C. Munoz, "Validation of commercial Mas receptor antibodies for utilization in Western blotting, immunofluorescence and immunohistochemistry studies," PLoS One, vol. 12 no. 8,DOI: 10.1371/journal.pone.0183278, 2017.