The Kidney-Related Effects of Polystyrene Microplastics on Human Kidney Proximal Tubular Epithelial Cells HK-2 and Male C57BL/6 Mice

Abstract

Background: Understanding the epidemic of chronic kidney disease of uncertain etiology may be critical for health policies and public health responses. Recent studies have shown that microplastics (MPs) contaminate our food chain and accumulate in the gut, liver, kidney, muscle, and so on. Humans manufacture many plastics-related products. Previous studies have indicated that particles of these products have several effects on the gut and liver. Polystyrene (PS)-MPs (PS-MPs) induce several responses, such as oxidative stress, and affect living organisms.

Objectives: The aim of this study was to investigate the effects of PS-MPs in kidney cells in vitro and in vivo.

Methods: PS-MPs were evaluated in human kidney proximal tubular epithelial cells (HK-2 cells) and male C57BL/6 mice. Mitochondrial reactive oxygen species (ROS), endoplasmic reticulum (ER) stress, inflammation, and autophagy were analyzed in kidney cells. In vivo, we evaluated biomarkers of kidney function, kidney ultrastructure, muscle mass, and grip strength, and urine protein levels, as well as the accumulation of PS-MPs in the kidney tissue.

Results: Uptake of PS-MPs at different concentrations by HK-2 cells resulted in higher levels of mitochondrial ROS and the mitochondrial protein Bad. Cells exposed to PS-MPs had higher ER stress and markers of inflammation. MitoTEMPO, which is a mitochondrial ROS antioxidant, mitigated the higher levels of mitochondrial ROS, Bad, ER stress, and specific autophagy-related proteins seen with PS-MP exposure. Furthermore, cells exposed to PS-MPs had higher protein levels of LC3 and Beclin 1. PS-MPs also had changes in phosphorylation of mitogen-activated protein kinase (MAPK) and protein kinase B (AKT)/mitogen-activated protein kinase (mTOR) signaling pathways. In an in vivo study, PS-MPs accumulated and the treated mice had more histopathological lesions in the kidneys and higher levels of ER stress, inflammatory markers, and autophagy-related proteins in the kidneys after PS-MPs treatment by oral gavage.

Conclusions: The results suggest that PS-MPs caused mitochondrial dysfunction, ER stress, inflammation, and autophagy in kidney cells and accumulated in HK-2 cells and in the kidneys of mice. These results suggest that long-term PS-MPs exposure may be a risk factor for kidney health.

Introduction

Since 1950, plastic products have become inexpensive, durable, convenient, and useful in many aspects of human life, resulting in dramatic increases in the human use of these products (Geyer et al. 2017; Rhodes 2018). A previous study predicted that 33 billion tons of plastic will be produced in 2050 (Rochman et al. 2013). Plastic products are reusable but due to irresponsible waste recycling and a slow biodegradation rate, plastic has accumulated in the environment worldwide (Díaz-Torres et al. 2017; Jambeck et al. 2015; Lamb et al. 2018). As characterized by Lebreton et al. (2018), plastic waste accumulation in the Pacific Ocean had formed what is commonly called the Great Pacific Garbage Patch (Lebreton et al. 2018), from which plastic can be broken into small fragments via physicochemical decomposition to become microplastics (MPs) and nanoplastics (NPs) (Song et al. 2017; Yousif and Haddad 2013). In addition, the mixed synthetic fibers that compose the textiles we wear daily have also been shown to generate MPs or NPs during laundering (Carney Almroth et al. 2018), and the resulting particles have been found in the ocean (Remy et al. 2015). However, these MPs or NPs do not disappear. For example, plastic cigarette filters were shown to take 7.5–14 y to decompose (Joly and Coulis 2018). But some of the materials themselves may break into MPs or NPs (Song et al. 2017; Yousif and Haddad 2013). These particles cross the gut of living organisms and can enter the circulatory system via trophic transfer (Carbery et al. 2018). These MPs or NPs may accumulate in our food chain (Smith et al. 2018). MPs or NPs can also potentially accumulate in humans given that they had been shown to accumulate in the gut, liver, and kidneys in mice (Deng et al. 2017b; Yang et al. 2019) and in the muscle tissue of northern fulmars (Herzke et al. 2016) due to consumption of food items such as fish (Abbasi et al. 2018), seafood (Cho et al. 2019; Li et al. 2018; Van Cauwenberghe and Janssen 2014), milk (Kutralam-Muniasamy et al. 2020), beer (Kosuth et al. 2018; Liebezeit and Liebezeit 2014), sea salt (Iñiguez et al. 2017; Kosuth et al. 2018), sugar (Liebezeit and Liebezeit 2013), honey (Liebezeit and Liebezeit 2013), tea in plastic teabags (Hernandez et al. 2019), unfiltered water (Pivokonsky et al. 2018), tap water (Kosuth et al. 2018), and bottled water (Schymanski et al. 2018; Welle and Franz 2018).

Chronic kidney disease (CKD) results from many diverse disease pathways that change the structure and function of the kidneys and irreversibly damage kidney function (Webster et al. 2017). In a retrospective study, many hospitalized patients did not know that they suffered from CKD (Saunders et al. 2015). An epidemic of CKD of uncertain etiology (CKDu) is emerging worldwide (Gifford et al. 2017; Jha et al. 2013). A better understanding of the causes of CKDu may be critical for health policies and public health responses. Previous studies have found that MPs/NPs accumulated in the gut, liver, and kidneys in mice (Deng et al. 2017b; Yang et al. 2019) and that they accumulated in seafood intended for human consumption (Smith et al. 2018). It is unclear whether polystyrene (PS)-MPs (PS-MPs) are risk factors in CKDu. MPs have been detected in many invertebrate species from the North Sea and in a subset of brown trout from the Swedish west coast (Karlsson et al. 2017). MPs pervade the global seafloor (Kane et al. 2020). In addition, PS is a popular plastic used worldwide (Hahladakis et al. 2018). Recently, PS-MPs have been found to induce several responses and to affect the physiological functions of various organisms. For example, one study showed that exposure of scleractinian coral species to PS-MPs regulated genes that are related to the stress response, zymogen granules, c-Jun N-terminal kinase (JNK) signaling pathways, sterol transport, and the epidermal growth factor (EGF)–extracellular signal-regulated kinase (ERK) one-half signaling pathway (Tang et al. 2018). PS-MPs induced oxidative stress in the livers of zebrafish (Danio rerio) (Lu et al. 2016) and mice (Deng et al. 2017b; Yang et al. 2019). Previous findings have also indicated that PS-MPs induced oxidative stress as the main mechanism of toxicity in other models (Barboza et al. 2018; Wu et al. 2019).

Mitochondria have central roles in glucose, fatty acid, and energy metabolism (Xu et al. 2020). Mitochondria also play important roles in oxidative stress and crosstalk in endoplasmic reticulum (ER) stress, the inflammasome, and autophagy in type 2 diabetes (Rocha et al. 2020). A previous study indicated that palmitic acid induced excessive mitochondrial reactive oxygen species (ROS) accumulation in podocytes (Jiang et al. 2020). Excessive mitochondrial ROS levels were associated with mitochondrial injury in mice with diabetic nephropathy (Hwang et al. 2012). Mice with diabetic kidney disease exhibited urinary albumin excretion (Han et al. 2018, 2019) Moreover, studies in dogs (Chacar et al. 2017) and cats (Ferlizza et al. 2017; Maeda et al. 2015) have shown that urinary proteins are one of the early biomarkers of CKD. In addition, the ER is an organelle with several essential functions, including protein synthesis and processing (Chen et al. 2010). Upon initiation of the unfolded protein response (UPR), ER stress is activated through three major signaling pathways: activating transcription factor 6 (ATF6), inositol-requiring enzyme 1α (IRE1α ) and protein kinase RNA-activated (PRKR)-like ER kinase (PERK) pathways (Saito and Imaizumi 2018). In addition, PERK regulates eukaryotic initiation factor 2α (EIF2α ) or phosphoinositide 3-kinase (PI3K)/AKT/mTOR signal pathway (Moretti et al. 2007). However, studies have revealed that ER stress is involved in various types of kidney diseases, including renal fibrosis, diabetic nephropathy, acute kidney injury, CKD, glomerulopathies associated with genetic mutations, and primary glomerulonephritis (Cybulsky 2017). CD36 has induced membrane calcium influx in response to ER stress, release of arachidonic acid from cytoplasmic phospholipase A2α (cPLA2α ), and generation of proinflammatory eicosanoids in Chinese hamster ovary cells (Kuda et al. 2011). Arachidonic acid is converted to prostaglandins through the cyclooxygenase (COX) pathway by the constitutive enzyme cyclooxygenase (COX)-1 or by inducible COX-2 in lung fibroblasts (Ghosh et al. 2004). Arachidonic acid metabolism is associated with kidney inflammation (Wang et al. 2019). In addition, autophagy is an important self-cleansing pathway (Mizushima 2018). Autophagy has been shown to maintain homeostasis of the glomeruli and tubules of mouse kidneys (Kimura et al. 2011) and has been implicated in cisplatin-induced kidney injury in vitro and in vivo (Bolisetty et al. 2010; Takahashi et al. 2012), senescence in mice (Hartleben et al. 2010; Liu et al. 2012), polycystic kidney disease (PKD) in mice (Belibi et al. 2011) and humans (Serra et al. 2010), and diabetic kidney disease in rats (Flaquer et al. 2010). Autophagy was also found to be necessary for stress adaptation in a mouse model of kidney injury, possibly because of its roles in removing protein aggregates and injured organelles and in promoting cell survival (Riediger et al. 2011). Autophagy-related markers such LC3, Beclin 1, and p62 are important participants in this process (Schmitz et al. 2016).

PS-MPs can damage the gut and liver of mice, and we found that a previous study has shown that PS-MPs accumulates in the kidneys in mice (Deng et al. 2017b; Yang et al. 2019). Another previous study also showed that PS-NPs (44 nm ) were internalized via both endocytosis and diffusion in human renal cortical epithelial cells. PS-NPs did not affect cell viability, metabolism, or cell cycle progression. However, PS-NPs did accumulate in the perinuclear region (Monti et al. 2015). The studies that obtained these findings did not determine the kidney conditions after the accumulation of PS-MPs or PS-NPs. Thus far, the effects of MPs or NPs of the following sizes have been studied in mice: 0.025μm (Rafiee et al. 2018), 0.05μm (Rafiee et al. 2018), 0.5μm (Deng et al. 2018; Lu et al. 2018; Luo et al. 2019b), 1μm (Deng et al. 2018), 4μm (Stock et al. 2019), 5μm (Jin et al. 2019; Luo et al. 2019a, 2019b; Yang et al. 2019), 10μm (Li et al. 2020; Stock et al. 2019), 20μm (Deng et al. 2017b; Jin et al. 2019), 50μm (Lu et al. 2018), and 150μm (Li et al. 2020). Most of the studies had used PS. In the present study, we evaluated the effects of PS-MPs in HK-2 cells and male C57BL/6 mice. Mitochondrial ROS, ER stress, inflammation, and autophagy were analyzed in kidney cells. In mice, we evaluated kidney tissue histology and ultrastructure, biomarkers of kidney function, muscle mass, and grip strength, as well as PS-MP accumulation in the kidney tissue. Furthermore, we examined the possible mechanisms underlying the effects induced by PS-MPs.

Methods

Physicochemical Characterization

The 2-μm PS-MPs were obtained from Life Technologies (C37278). The average hydrodynamic size, polydispersity index (PDI) and zeta potential of the PS-MPs were determined by dynamic laser scattering (DLS) (Zetasizer Nano ZS90). Briefly, we used PS-MPs stock solution (4% wt/vol) to prepare a final concentration of 75-μg/mL PS-MPs solution in ultrapure water. The dilution method was 15μL of PS-MPs stock solution added into 8mL ultrapure water, then 1-mL aliquots of the well-mixed solution were placed into cuvettes and the solutions were analyzed with DLS in triplicate. The average hydrodynamic size, PDI, and zeta potential data were performed and directly output by Zetasizer Nano software (version 5.0) and these data were calculated using Microsoft Office Excel. The shapes and sizes of the PS-MPs were analyzed using transmission electron microscopy (TEM) with an H-7650 instrument (Hitachi). The PS-MPs were suspended in water, dropped onto copper-coated carbon grids, and dried overnight at room temperature prior to imaging. The actual sizes of the PS-MPs were measured using TEM software.

Cell Lines

The human kidney proximal tubular epithelial cell line HK-2 (ATCC CRL-2190) was obtained from the American Type Culture Collection (ATCC). The HK-2 cells were incubated and maintained in keratinocyte–serum-free medium (SFM) with human recombinant EGF (rEGF) and bovine pituitary extract (BPE) (Life Technologies) at 37°C with 5% carbon dioxide (CO2 ) and passaged every 2–3 d. Autophagy-related gene 5 (ATG5)-wild-type (WT; Atg5+/+ ) and ATG5-knockout (Atg5−/− ) mouse embryonic fibroblasts (MEFs) were provided by N. Mizushima (Tokyo Medical and Dental University, Tokyo, Japan) (Kuma et al. 2004). The cells were cultured in Dulbecco’s Modified Eagle’s Medium Low Glucose (11885084; Life Technologies), supplemented with 10% fetal calf serum, penicillin (100U/mL ), and streptomycin (100mg/mL ) at 37°C with 5% CO2 and passaged every 2–3 d.

Uptake of PS-MPs by HK-2 Cells

HK-2 cells (8×104 ) were seeded onto 12-mm glass slides (1001/12; GmH & Co. KG) in 24-well culture plates overnight and treated with 2μm fluorescent yellow-green PS-MPs (L4530; Sigma-Aldrich) at concentrations of 0.025, 0.05, 0.1, 0.2, 0.4, or 0.8μg/mL for 120 min or at a concentration of 0.8μg/mL for 0, 5, 10, 30, or 60 min. Then, the slides were washed with phosphate-buffered saline (PBS) for 5 min, fixed with 4% paraformaldehyde for 15 min at room temperature, washed with tris-buffered saline containing 0.05% Tween-20 (TBS-T) for 10 min, stained with 0.1mg/mL 4,6-dimidyl-2-phenylindole (DAPI) (D1306; Life Technologies) at room temperature for 10 min and mounted onto glass slides (0100-01; SouthernBiotech). Then, all slides were examined with a fluorescence microscope with an excitation filter (ECLIPSE Ci; Nikon). The fluorescent yellow-green PS-MPs spectra exhibited excitation and emission maxima of ∼470 and∼505 nm , respectively. The excitation and emission wavelengths for the DAPI spectra were 360 nm and 460 nm , respectively. In addition, HK-2 cells (4×105 ) were treated with 0, 0.05, 0.1, 0.2, 0.4, or 0.8mg/mL PS-MPs for 1 or 2 h. The cells were harvested with Accutase (AT-104; Innovative Cell Technologies), centrifuged at 1,200 rpm for 5 min at room temperature, washed with PBS, and suspended in PBS. The signal was measured using a flow cytometer (LSRFortessa; BD Biosciences) with x-axis for the side-scattered light (SSC) and y-axis for cell counts in histograms.

Lentivirus Knockdown

HK-2 cells (2×105 ) were seeded in 10-cm plates overnight. Lentivirus with control short hairpin RNA (shRNA; TRC1.Void) or Atg5 shRNA#1 (CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTTG, TRCN0000151963) and Atg5 shRNA#2 (CCGGCCTGAACAGAATCATCCTTAACTCGAGTTAAGGATGATTCTGTTCAGGTTTTTG , TRCN0000330394) were purchased from the National RNAi Core Facility at Academia Sinica in Taiwan. Briefly, 8μg/mL polybrene (sc-134,220; Santa Cruz) was mixed with lentivirus (multiplicity of infection=3 ), which were then incubated in keratinocyte-SFM with human rEGF and BPE overnight at 37°C with 5% CO2 . The medium was changed after 24 h, 2μg/mL puromycin (ant-pr-1; InvivoGen) was added, and incubation was continued for 72 h. Stable ATG5 knockdown (ATG5KD ) HK-2 cells were constructed after puromycin selection. The ATG5KD HK-2 cells were incubated and maintained in keratinocyte-SFM with human rEGF and BPE at 37°C with 5% CO2 and passaged every 2 or 3 d.

Cell Viability Assay

Cell viability was assessed with a sulforhodamine B (SRB; Sigma) assay. SRB can bind to basic amino acids in proteins. The amount of dye represents the number of cells. Briefly, cells (4×103 ) were seeded in a 96-well culture plate and incubated overnight at 37°C. HK-2 cells were treated with PS-MPs (Life Technologies) at 0, 0.05, 0.1, 0.2, 0.4, or 0.8mg/mL for 1, 2, or 3 d. The cells were fixed with ice-cold 10% trichloroacetic acid (TCA; Sigma) at 4°C for at least 1 h or overnight. The TCA was removed, and the cells were washed twice with distilled water. Then, 0.1% SRB in 1% acetic acid (Sigma) was added, and the cell suspension was incubated at 25°C for 1 h. The cells were washed twice with 1% acetic acid and dried at 60°C in an oven for 30 min. Finally, the adhered cells were dissolved in 20 mM Tris base buffer (Sigma), and the plate was shaken for 30 min. The absorbance of the dye suspension was measured at a wavelength of 562 nm in an enzyme-linked immunosorbent assay (ELISA) reader (EMax Plus; Molecular Devices).

Apoptosis and Necrosis Analysis

Cells (4×105 ) were treated with PS-MPs at 0, 0.05, 0.1, 0.2, 0.4, or 0.8mg/mL for 24 or 48 h. The cells were harvested with Accutase (Innovative Cell Technologies), centrifuged at 1,200 rpm , and washed with PBS. Apoptosis and necrosis were quantified using a fluorescein isothiocyanate (FITC) Annexin V/propidium iodide (PI) apoptosis detection kit according to the manufacturer’s protocol (640914; BioLegend). Briefly, 5μL FITC Annexin V was added, 10μL PI solution was added, and the cells were vortexed gently and incubated for 15 min at room temperature in the dark. Finally, 400μL Annexin V binding buffer was added to each tube to stop the reaction. The signal was measured using a flow cytometer (BD Biosciences). The excitation and emission wavelengths for the FITC Annexin V spectra were 490 nm and 525 nm , respectively. A 488 nm -laser was used for excitation. The apoptotic index was presented as the percentage of Annexin V+PI+ and Annexin V+PI− cells in the four quadrants. The necrotic index is presented as the percentage of Annexin V−PI+ cells in the four quadrants.

Western Blot Analysis

HK-2 cells (4×105 ) were seeded in 6-well culture plates and incubated overnight at 37°C. The cells were treated with PS-MPs at 0, 0.05, 0.1, 0.2, 0.4, or 0.8mg/mL for 5 min, 10 min, 15 min, 30 min, 60 min, 24 h, or 48 h. Radioimmunoprecipitation assay buffer [25 mM Tris-hydrochloride (pH 7.6), 150 mM sodium chloride, 1% nonyl phenoxypolyethoxylethanol (NP-40), 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS)] with a protease inhibitor cocktail (11873580001; Roche) and phosphatase inhibitor (PIC009; Bioshop) was added to each well, and the lysates were collected. The cell lysates were subjected to three cycles of 30 s of vortexing and 30 s of cooling, and then centrifuged at 13,000×g for 30 min. The supernatant was taken for protein quantification with a Bradford protein assay (500-0006; Bio-Rad) and measured at a wavelength of 595 nm in an ELISA reader (Molecular Devices). Proteins (20–50μg ) were boiled for 5 min in SDS sample buffer [ 62.5mM Tris (pH 6.7), 1.25% SDS, 12.5% glycerol, and 2.5% β-mercaptoethanol ]. The proteins isolated from the cells and TD-PM10315 TOOLS Pre-Stained Protein Marker (10–315 kDa) (BIOTOOLS Co., Ltd.) were loaded onto gradient gels for SDS–polyacrylamide gel electrophoresis (PAGE) (TFU-GG420; BIOTOOLS). After transfer to a 0.45-μ m nitrocellulose membrane (GE10600002; Amersham), the proteins on the membrane were blocked with 5% skim milk (70166; Sigma) in TBS-T for 1 h and incubated with antibodies overnight at 4°C. Antibodies against phospho-eukaryotic initiation factor 2 alpha (p-EIF2 α (3398, 1:1,000), EIF2 α (5324, 1:2,000), IRE1 α (3294; 1:1,000), COX-1 (4841; 1:1,000), p-p38 (9211; 1:1,000), p38 (9212; 1:1,000), p-ERK1/2 (9101; 1:1,000), ERK1/2 (4695; 1:1,000), p-JNK (9251; 1:1,000), JNK (9252; 1:1,000), p-mTOR (2971; 1:1,000), mTOR (2983; 1:1,000), p-AKT (9275; 1:1,000), AKT (4685; 1:1,000), Beclin 1 (3738; 1:1,000), and Bad (9292; 1:1,000) were obtained from Cell Signaling Technology. Antibodies against ATF6 (24169-1; 1:1,000), Bcl2 (12789-1; 1:1,000), glyceraldehyde 3-phosphate dehydrogenase (GAPDH; 60004-1; 1:200,000), and Bax (50599-2-Ig; 1:3,000) were obtained from Proteintech. An antibody against cPLA 2 (sc-545, 1:500) was obtained from Santa Cruz Biotechnology; antibodies against p62 (PM045, 1:1,000) and LC3 (PM036, 1:1,000) were obtained from MBL International. The primary antibodies were washed from the membrane with TBS-T for 15 min three times at room temperature. The membrane was then incubated with antimouse (111-035-003; 1:1,000; Jackson) or antirabbit (111-035-003; 1:1,000; Jackson) secondary antibody for 2 h and washed with TBS-T for 15 min three times at room temperature. For phosphoprotein detection, the antibodies were stripped (TW-ST500; TOOLStripping Buffer; TOOLS) from the membrane at 37°C for 10 min. The membrane was then washed with a large amount of water and with TBS-T twice and reprobed for total antibody binding. The immunoreactive bands were visualized using an enhanced chemiluminescence (ECL) system (Amersham). Protein expression was quantified with ImageQuant (version 5.1; GE Healthcare). The band of western blot was quantified to normalize the total protein or GAPDH. Figures S2–S9 show the quantification of western blot and graph of the mean±standard deviation (SD).

Immunostaining Assay

HK-2 cells ( 8 × 10 4 ) were seeded on 12-mm glass slides (GmH & Co. KG) in 24-well culture plates and treated with PS-MPs. After fixing the cells in 4% paraformaldehyde for 15 min, the slides were washed in PBS. Bovine serum albumin (BSA; 3%) was added to the slides, and the slides were incubated for 30 min. The slides were then incubated with the LC3 antibody (MBL; 1:200) diluted in 3% BSA at 4°C overnight and washed in TBS-T for 15 min three times. Then, the slides were incubated with a secondary antibody (111-095-003; 1:200; Jackson) labeled with FITC for 2 h at room temperature. Finally, the slides were stained with 0.1mg / mL DAPI (Life Technologies) at room temperature for 10 min and mounted on glass slides (0100-01; SouthernBiotech). Then, all slides were examined with a fluorescence microscope with an excitation filter (Nikon) or a Leica TCS SP5 confocal microscope (Leica Microsystems). The fluorescence intensity was examined in three fields of view ( > 100cells/field ). The excitation and emission wavelengths for the FITC spectra were 490nm and 525nm , respectively. The excitation and emission wavelengths for the DAPI spectra were 360nm and 460nm , respectively.

Measurement of Mitochondrial ROS Production

HK-2 cells ( 8 × 10 4 ) were seeded on 12-mm glass slides (GmH & Co. KG) in 24-well culture plates overnight; treated with PS-MPs at 0.025, 0.05, 0.1, 0.2, 0.4, or 0.8μg / mL ; and harvested after 6 h. MitoTEMPO, a mitochondrial ROS antioxidant (SML0737; Sigma) (Cai et al. 2016) was used at 40, 80 or 100μ M and treated with PS-MPs with 0.8μg / mL or not in HK-2 cells. Mitochondrial ROS levels were analyzed via treatment of the cells in 5μ M MitoSOX Red (M36008; Life Technologies) for 10 min at 37°C. Then the cells were washed with PBS three times, fixed with 4% paraformaldehyde for 15 min, washed with PBS for 5 min, stained with 0.1mg / mL DAPI (Life Technologies) for 10 min, and mounted on glass slides (SouthernBiotech) at room temperature. Images of MitoSOX Red fluorescence were collected using a fluorescence microscope with an excitation filter (Nikon). The spectra for MitoSOX Red showed excitation and emission maxima of ∼ 510and580nm , respectively. The excitation and emission wavelengths for the DAPI spectra were 360nm and 460nm , respectively. The fluorescence intensity was examined in three fields of view ( > 50cells/field ). The fluorescence was analyzed and quantified with TissueQuest (TissueGnostics GmbH) to quantify the fluorescence of MitoSOX Red-positive cells. Briefly, the files were selected, and the red and blue fluorescence was separated. The dimensions were 1,080 × 1,024 pixels, the resolution was ∼ 96 dpi, the bit depth was 8, and the color representation was uncalibrated. The data were then analyzed.

Animal Model

Six-week-old male C57BL/6 mice were obtained from the National Laboratory Animal Center in Taiwan and were maintained in compliance with institutional policy. All animal procedures were approved by the institutional animal care and use committee at Taipei Medical University (approval no. LAC-2019-0520). The mice were raised in an animal center room with a 12-h light/dark cycle and 55 % ± 10 % relative humidity at 22 ± 2 ° C . A previous study has shown that a regime of 0.1mg / d of 5μ m and 20μ m PS-MPs (once daily by oral gavage) accumulated PS-MPs in the mouse kidneys for 4 wk (Deng et al. 2017b). In this experiment, PS-MPs were diluted in distilled water, and mice were administered the PS-MPs by oral gavage at 0.2mg / d and 0.4mg / d twice per week for 4 or 8 wk. The mice in the sham group received water. The mice were randomized into three groups of five mice each. If the veterinarian advised it or if the weight loss of a mouse was more than 15%, the mouse was humanely euthanized before the end of the experiments. Otherwise, the mice were humanely euthanized via CO 2 exposure at the end of the experiments, and their kidneys and leg muscles were obtained and fixed with 10% formalin for further histological analysis. Urine was collected directly into 1.5-mL sterile Eppendorf tubes from the mice the day before they were euthanized at the end of the experiments. The mice used for urine collection were not raised in segregated cages during the experiments.

Biochemical Evaluation

Mice were randomized into three groups of five mice each and treated at 0.2mg / d or 0.4mg / d twice per week for 4 or 8 wk. The mice in the sham group received water. Whole-blood samples were collected from the sham and treated mice by intracardiac puncture immediately after the mice were euthanized. Then, the blood samples were left to stand for 30 min and centrifuged at 2,000 × g for 20 min to separate the serum. Biochemical indices including blood urea nitrogen (BUN) levels (417-65291; Wako) and creatinine levels (1875418; Roche), were tested using a Hitachi 7080 analyzer by the National Laboratory Animal Center in Taiwan.

SDS-PAGE and Western Blot Analysis

Urine samples from different mice were centrifuged at 1,200 × g for 10 min, and 8μ L of each sample was dissolved in the sample buffer [ 62.5mM Tris (pH 6.7), 1.25% SDS, 12.5% glycerol, and 2.5% β-mercaptoethanol ] for loading. Briefly, urine samples were boiled for 5 min in the sample buffer for loading of protein. The urine samples and HR Pre-Stained Protein Markers (10-170 kDa) (161-0374; Bio-Rad) were loaded onto gradient SDS-PAGE gels (BIOTOOLS) and subjected to electrophoresis. The gel was stained with Coomassie blue (TTD-BS1L; TOOLStart Blue Staining Reagent; BIOTOOLS) for 30 min and destained with water for 10 min. The gel was scanned with an SCX-3405 scanner (Samsung). The samples were analyzed using SDS-PAGE. After transfer to a nitrocellulose membrane (Amersham), the proteins were incubated with an anti-albumin antibody (1:1,000; GTX102419; GeneTex). The subsequent steps were conducted as described previously. Western blotting was performed with a separate gel. The immunoreactive bands were visualized using an enhanced chemiluminescent (ECL) Western Blotting Detection Reagents (RPN2235, Amersham).

PS-MP Detection with Raman Spectra in Kidney Tissues

Mice were administered PS-MPs by oral gavage at 0.4mg / d twice per week for 8 wk. The mice in the sham group received water. There were five mice in each group. The mice were humanely euthanized via CO 2 exposure at the end of the experiments, and one kidney was obtained from each mouse. To prepare a standard curve for calibration, 10 mg of ground tissues from the control group were mixed with different concentrations of PS-MPs to prepare samples with 0, 0.4, 1.6, 4, and 8mg /gkidney . The powders were dried in a desiccator with a vacuum system. The dried samples were further measured with a micro-Raman system. Raman spectra were acquired by using a Jobin–Yvon LabRAM high-resolution Raman spectrometer (Horiba iHR 320) and a 785-nm laser (DPSSL Driver II; 10mW ), integrated with an Olympus BX53 microscope.

Tubular Injury Analysis

One kidney from each mouse was fixed in 10% formalin for 24 h and embedded with Shandon HistoCentre 3 (Thermo), sectioned at 2-μ m thickness with a Leica microtome (RM2245), and stained with hematoxylin and eosin (H&E) for histological analyses. The tubular injury rate was examined in 20 fields of view per kidney (5 mice per group). The severity of tubular damage was scored from 0 to 5 according to morphological changes in the tubular lesion area, such as tubular dilatations, loss of brush borders, and flattening of the tubular epithelia. The tubular damage index (TDI) was assessed as follows: 0, normal; 1, area of tubular dilation and brush border attenuation involving < 10 % of the field of view; 2, lesion area between 10% and 20% of the field of view; 3, lesion area between 20% and 30% of the field of view; 4, lesion area between 30% and 40% of the field of view; and 5, lesion area > 40 % of view. The tubular injury rates were analyzed in a blinded manner.

Immunohistochemistry

The sections were placed in an oven (60°C) for 1 h. The sections were washed twice with xylene (Sigma) for 10 min each, twice with 100% ethyl alcohol (Sigma) for 10 min each, once with 95% ethyl alcohol for 5 min, and once with 75% ethyl alcohol for 5 min. For immunostaining, the sections were boiled with citrate buffer solution [ 0.01 M (pH 6.0), with 1% Tween 20] for 30 min. Immunohistochemistry (IHC) consumables and reagents from Thermo Scientific (Life Technologies) were used according to the protocol. Briefly, the sections were blocked with hydrogen peroxide (TA-060-H202Q; Thermo Scientific) for 10 min, washed with TBS-T for 15 min three times, and blocked UltraVision protein block (TL-060-QHL; Thermo Scientific) for 10 min at room temperature. The slides were incubated with antibodies against IRE1 α (1:500; NB100-2,324; Novusbio), LC3 (1:2,000; MBL), COX-1/PTGS1 (1:1,000; A7341; ABclonal Technology), or dystrophin (1:100; sc-73592; Santa Cruz) in 3% BSA overnight at 4°C, and washed with TBS-T for 15 min three times at room temperature. The slides were hybridized with a primary antibody amplifier quanto (TL-060-QHL; Thermo Scientific) for 10 min, washed with TBS-T for 15 min three times, hybridized with a horseradish peroxidase (HRP) polymer quanto (TL-060-QHL; Thermo Scientific) for 10 min, and washed with TBS-T for 15 min three times at room temperature. The slides were stained with 3,3′-diaminobenzidine (DAB; TA-060-QHDX; Thermo Scientific), the reactions were stopped with water, and the sections were counterstained with hematoxylin (HMM500; ScyTek) at room temperature for 3 min. For Masson’s trichrome staining (TRM-2-IFU, ScyTek), a kit was used according to manufacturer’s to the protocol. Finally mounting medium was added to the slides, and coverslips were mounted. Once the mounting medium solidified, the sections were scanned with Motic Digital Slide Assistant (Motic VM3.0). The images were analyzed with ImageJ plugins to quantify the positive cells (Papadopulos et al. 2007). The IHC of positive percentage areas were examined in 10 fields of view.

Transmission Electron Microscopy

Six-week-old male C57BL/6 mice received PS-MPs by oral gavage at 0.4mg / d twice per week for 8 wk. The mice were treated about 1 wk after they arrived. The mice in the sham group received water. For the qualitative experiment, the mice were randomized into two groups of three mice per group. The mice were humanely euthanized via CO 2 exposure at the end of the experiments, and their kidneys were obtained after perfusion ( 0.1 M PBS) and fixation [ 0.1 M PBS, 4% paraformaldehyde, 0.1% glutaraldehyde (pH 7.4)] with a Masterflex peristaltic pump (7518-00) with flow rate for 1 drop/s of ∼ 20 mL . The kidney tissues were embedded in EPON resin (13940; Electron Microscopy Sciences), sectioned into 60-nm-thick sections, and observed under an HT7700 (Hitachi) transmission electron microscope. In detail, the samples were washed with 0.1 M cacodylate (205541; Merck) for 15 min three times; postfixed in 1% osmium tetroxide (Ubichem) for 1–2 h; treated with 0.1 M cacodylate for 15 min three times; washed in 70%, 80%, 90%, 95%, and 100% alcohol for 15 min per wash; incubated in propylene oxide (PO; 110205; Sigma) for 10 min; incubated in 1:1 PO/EPON resin overnight with vacuum under 50cmHg ; incubated in EPON resin for another 8 h, placed in an oven at 62°C for 48–72 h, and finally sectioned with an ultramicrotome (EM UC7; Leica).

Forelimb Grip Strength Test

Six-week-old male C57BL/6 mice received PS-MPs by oral gavage at 0.4mg / d twice per week for 8 wk. The mice were treated about 1 wk after they arrived. The mice in the sham group received water. For function analysis, the mice were randomized into two groups of seven mice per group. A conventional handgrip strength meter (Digitech; DTG-2) was used (Takeshita et al. 2017). Briefly, the grip strength meter was changed to the peak model and reset to 0 kgf. Then, the inspector allowed a mouse to grasp a bar mounted on the force gauge, and the mouse’s tail was gently pulled back until the mouse released the bar. The grip strength meter thus recorded the maximum force of the mouse’s forelimb grip. The order in which the mice were tested was randomized, and the inspector was blinded to the results of the previous tests.

Statistical Analysis

The data were analyzed with GraphPad Prism (version 8.4.3; GraphPad Software) and are expressed as the means±SDs . The data were analyzed by t -test, one-way analysis of variance (ANOVA), and two-way ANOVA according to groups; Dunnett’s multiple comparison test, Sidak’s multiple comparisons test, and Tukey’s multiple comparisons test were used for further comparisons between groups. Statistical significance was determined at p < 0.05 . The actual p -values for the nonsignificant and significant results are shown in Table S4.

Results

PS-MP Characterization

PS-MPs with a primary particle size of 2μ m were purchased from Life Technologies. The detailed physicochemical characteristics of the PS-MPs after suspension in water are summarized in Table S1. The hydrodynamic diameter of the PS-MPs was 1.878 ± 0.677μ m . The zeta potential of the PS-MPs was − 76 ± 1.2mV . The PDI for the PS-MPs was 0.189. Furthermore, the TEM images suggested that the PS-MPs were mostly spherical in shape (Figure S1).

Uptake of PS-MPs by HK-2 Cells

The effects of different concentrations of PS-MPs were investigated after 2 h. As shown in Figure 1A, fluorescence analysis revealed that 0.8mg / mL PS-MPs resulted in the most obvious effects. When the effects of 0.8mg / mL PS-MPs over different uptake durations were investigated, fluorescence analysis revealed that a 60-min uptake time produced the most obvious effects (Figure 1B). As shown in Figure 1C,D, among different concentrations of PS-MPs, the 0.8-mg/ mL concentration had the most obvious effects after uptake for 1 h ( 0-mg/ mL group vs. 0.4-mg/ mL group, p = 0.0025 ; 0-mg/ mL group vs. 0.8-mg/ mL group, p < 0.001 ) or 2 h ( 0-mg/ mL group vs. 0.2-mg/ mL group: p = 0.0039 ; 0-mg/ mL group vs. 0.4-mg/ mL group: p < 0.001 ; 0-mg/ mL group vs. 0.8mg /ml group: p = 0.001 ). The mean and SD summary data for quantification are shown in Table S3. SSC showed a shift in peak from left to right in a concentration-dependent manner. The SSC data were used to identify cellular granularity. HK-2 cells treated with PS-MPs at 0.8mg / mL took up ∼ 3.55 ± 0.6 times more PS-MPs than the control cells at 2 h.

[Image omitted - see PDF]

Cell Viability, Mitochondrial ROS, and Expression of Apoptosis-Related Protein in HK-2 Cells Treated with PS-MPs

As shown in Figure 2A, the cell viability of cells treated with PS-MPs was similar to those treated with the water control. None of the treated groups had significant differences except on Day 3 ( 0-mg/ mL group vs. 0.8-mg/ mL group: p = 0.0241 ) (Tables S3 and S4). The necrosis index was significantly different between the control group and the 0.4- or 0.8-mg/ mL groups, and it was ∼ 10 % in both of these groups compared with ∼ 5 % in the control ( 0-mg/ mL group vs. 0.4-mg/ mL group: p = 0.0319 ; 0-mg/ mL group vs. 0.8-mg/ mL group: p = 0.0026 ) (Figure 2B,C). The mean and SD summary data for quantification of western blots are shown in Table S3. However, the apoptosis index did not significantly differ among groups (Figure 2B,C). HK-2 cells treated with PS-MPs at different concentrations exhibited higher mitochondrial ROS levels (Figure 2D). Specifically, cells treated with 0.2, 0.4, or 0.8mg / mL PS-MPs had significantly higher mitochondrial ROS levels ( 0-mg/ mL group vs. 0.2-mg/ mL group: p = 0.0331 ; 0-mg/ mL group vs. 0.4-mg/ mL group: p < 0.001 ; 0-mg/ mL group vs. 0.8-mg/ mL group: p < 0.001 ), and the fold-change in the 0.8-mg/ mL group compared with the control group was 3 ± 0.6 times (Figure 2E). In addition, the expression of Bad, which is associated with mitochondrial-mediated apoptosis regulation, was significantly higher after treatment of HK-2 cells with 0.8-mg/ mL PS-MPs for 5–60 min in HK-2 cells (Figure 2F and Figure S2). The expression of Bcl2, which is also associated with mitochondrial-mediated apoptosis regulation, was significantly lower after treatment of HK-2 cells with 0.8-mg/ mL PS-MPs for 20–60 min in HK-2 cells (Figure 2G and Figure S2). However, the expression of Bax, which is also associated with mitochondrial-mediated apoptosis regulation, was not significantly changed after PS-MPs treatment of HK-2 cells (Figure 2H and Figure S2).

[Image omitted - see PDF]

Expression of Proteins Related to ER Stress, Inflammation, and Autophagy in HK2 Cells Treated with PS-MPs

As shown in Figure 3A and Figure S3, cells exposed to PS-MPs at different concentrations for 24 h had higher expression of the ER stress-related protein IRE1 α . Therefore, the expression of other ER stress-related proteins ATF6 and the p-EIF2α /EIF2 α ratio were not significantly different. In addition, the phosphorylation of MAPK signaling molecules, such as p38, ERK1/2, and JNK was higher in treated cells compared with control (Figure 3B and Figure S4). Specifically, p-p38, p-ERK1/2, and p-JNK levels were highest at 10–30 min after exposure. Cells exposed to PS-MPs also exhibited higher expression of inflammation-related proteins such as cPLA 2 and COX-1. Specifically, cPLA 2 expression was significantly higher after treatment with 0.8-mg/ mL PS-MPs ( 0-mg/ mL group vs. 0.8-mg/ mL group: p = 0.0171 (Figure 3C and Figure S5). COX-1 expression was significantly higher in cells exposed to 0.4-mg/ mL PS-MPs ( 0-mg/ mL group vs. 0.4-mg/ mL group: p = 0.0284 ; 0-mg/ mL group vs. 0.8-mg/ mL group: p = 0.023 ) (Figure 3C and Figure S5). In contrast, cells exposed to PS-MPs had lower levels of phosphorylation in AKT/mTOR signaling pathway components, such as mTOR and AKT, in a concentration-dependent manner in HK-2 cells (Figure 3D and Figure S6). Cells exposed to PS-MPs exhibited higher expression of autophagy-related protein LC3 and Beclin 1. The expression of p62 was not significantly different with increasing PS-MPs concentration. Moreover, LC3-II levels were higher in a concentration-dependent manner (Figure 3E and Figure S7). Expression of LC3 in HK-2 cells following exposure to PS-MPs was also concentration-dependent (Figure 3F). Specifically, cells treated with PS-MPs at 0.1 to 0.8mg / mL had significantly higher LC3 expression as determined by immunofluorescence ( 0-mg/ mL group vs. 0.1-mg/ mL group: p = 0.0265 ; 0-mg/ mL group vs. 0.2-mg/ mL group: p < 0.001 ; 0-mg/ mL group vs. 0.4-mg/ mL group: p < 0.001 ; 0mg / mL group vs. 0.8-mg/ mL group: p < 0.001 ). Approximately 22.61 ± 3.8 % of HK-2 cells treated with 0.8-mg/ mL PS-MPs expressed LC3 signals (Figure 3G). The mean and SD summary data for quantification of Figure 3G are shown in Table S3.

[Image omitted - see PDF]

Mitochondrial ROS in HK-2 Cells Exposed to PS-MPs and Treated with or without MitoTEMPO Superoxide Dismutase

As shown in Figure 4A,B, cells treated with 100μ M MitoTEMPO and exposed to PS-MPs had less mitochondrial ROS than those treated with PS-MP alone ( 0.8mg / mL ), with a reading of 295.5 ± 21.5 % for PS-MPs alone and 169.4 ± 9.6 % for PS-MPs with 100μ M MitoTEMPO ( 0.8-mg/ mL PS-MP group vs. 0-mg/ mL group: p = 0.0019 ; 0.8-mg/ mL PS-MP group vs. 0.8-mg/ mL PS-MP+ 100μ M MitoTEMPO group: p = 0.0135 ). Bad expression was significantly lower after PS-MP and MitoTEMPO treatment than with PS-MP treatment alone (Figure 4C and Figure S8A). Similar to Bad expression, IRE1 α expression (Figure 4D and Figure S8B), and LC3-II expression, was lower after PS-MP and MitoTEMPO treatment than with PS-MP treatment alone (Figure 4G and Figure S8E). The phosphorylation of mTOR was significantly higher after PS-MP and MitoTEMPO treatment (Figure 4F and Figure S8D) compared with PS-MP treatment alone. However, ERK1/2 phosphorylation did not differ in cells treated with PS-MP and MitoTEMPO (Figure 4E and Figure S8C) compared with PS-MP exposure alone.

[Image omitted - see PDF]

Cell Viability in ATG5 HK-2 Knockdown Cells and ATG5 MEF KO Cells Treated with PS-MPs

As shown in Figure 5A, an ATG5KD HK-2 cell line was constructed and tested. The results showed that ATG5 protein expression was lower in the knockdown cells than in the control cells. ATG5KD HK-2 cells treated with PS-MPs had ∼ 20 – 30 % lower cell viability than control cells treated with PS-MPs. Treatment with 0.8-mg/ mL PS-MPs reduced the viability in the two knockdown lines, ATG5KD # 1 and ATG5KD # 2 , to 75.6 ± 2.2 % and 66.6 ± 13.6 % , respectively (ATG5KD # 1 : 0-mg/ mL group vs. 0.4-mg/ mL group: p = 0.0174 , 0-mg/ mL group vs. 0.8-mg/ mL group: p = 0.0047 ; ATG5KD # 2 : 0-mg/ mL group vs. 0.4-mg/ mL group: p < 0.001 , 0-mg/ mL group vs. 0.8-mg/ mL group, p < 0.001 ) (Figure 5B). The levels of ATG5 and LC3-II were lower after PS-MPs were added to the ATG5KD HK-2 cells. However, COX-1 expression was higher (Figure 5C and Figure S9). The cells therefore showed knockdown of ATG5 expression and higher COX-1 protein expression. A t g 5 − / − MEFs exposed to PS-MPs had higher levels of cell death; the viability in A t g 5 − / − MEF cells treated with 0.4-mg/ mL or 0.8-mg/ mL PS-MPs was 84.5 ± 4.9 or 65.6 ± 7.4 % of that the control cells, respectively (Figure 5D). A t g 5 + / + MEF cells vs. A t g 5 − / − MEFs: 0.4-mg/ mL group, p = 0.0321 ; 0.8-mg/ mL group, p < 0.001 ). Furthermore, in A t g 5 + / + MEFs, the apoptosis index was 19.7 ± 2.4 or 25.1 ± 1.8 after treatment with 0.4-mg/ mL or 0.8-mg/ mL PS-MPs, respectively (Figure 5E,F). In A t g 5 − / − MEFs, the apoptosis index was 27.5 ± 2.4 or 36.9 ± 4.5 after treatment with 0.4-mg/ mL or 0.8-mg/ mL PS-MPs, respectively. The apoptosis index was significantly higher in a concentration-dependent manner in A t g 5 − / − MEF cells compared with A t g 5 + / + MEF cells ( A t g 5 + / + MEF cells vs. A t g 5 − / − MEFs: 0.4-mg/ mL group, p = 0.0426 ; 0.8-mg/ mL group, p = 0.003 ). However, the necrosis index did not show any significant differences (Figure 5F and Table S4).

[Image omitted - see PDF]

Body Weight, BUN and Creatinine Levels, and Tubule Characterization of Mice Treated with PS-MPs

As shown in Figure 6A, body weight did not significantly differ between mice that were dosed orally with PS-MPs and those that received vehicle over the course of 4 or 8 wk of treatment (Tables S3 and S4). In addition, serum BUN did not have significant differences. However, after 4 wk of treatment, serum creatinine levels were significantly lower in the 0.2-mg/ d group ( 0.19 ± 0.01mg /dL ) and the 0.4-mg/ mL group ( 0.20 ± 0.01mg /dL ) than in the sham group ( 0.24 ± 0.02mg /dL ) (sham group vs. 0.2-mg/ d group: p = 0.001 ; sham group vs. 0.4-mg/ mL group: p = 0.0026 ). After 8 wk of treatment, the serum creatinine levels were lower in the 0.2-mg/ d group ( 0.42 ± 0.01mg /dL ) and the 0.4-mg/ mL group ( 0.38 ± 0.02mg /dL ) than in the sham group ( 0.45 ± 0.01mg /dL ) (sham group vs. 0.2-mg/ d group: p = 0.0068 ; sham group vs. 0.4-mg/ mL group: p < 0.001 ; 0.2-mg/ d group vs. 0.4-mg/ mL group: p = 0.0026 ) (Figure 6B). Serum creatinine is a common measure of renal function in the clinic (Lacour 1992). However, serum creatinine is also affected by muscle mass (Baxmann et al. 2008; Thongprayoon et al. 2016). As a result, we examined muscular tissue. As shown in Figure S10A, Masson’s trichrome staining and immunostaining of dystrophin, which is primarily expressed in skeletal muscle and other muscle tissues (Gao and McNally 2015), was lower in the treatment groups compared with the sham group. The grip strength test showed that grip strength was 13% lower in the treatment groups than in the sham group (Figure S10B). Furthermore, compared with the sham group, the groups treated with PS-MPs at different concentrations for 4 and 8 wk showed different degrees of tubular injury (Figure 6C,D). IHC showed higher expression of IRE1 α in the groups treated with concentrations of 0.2mg / d and 0.4mg / d than in the sham group (Figure 6E). IHC staining also showed that COX-1 expression (Figure 6F) and LC3 expression (Figure 6G) were significantly higher in the PS-MP–exposed groups than in the sham group. In addition, SDS-PAGE of mouse urine was performed after oral gavage of 0.4-mg/ d PS-MPs. Staining of the SDS-PAGE gel showed that the urine of the PS-MPs–treated mice had higher protein levels than that of the sham-treated mice (Figure S11A). The urine samples showed albumin leakage (Figure S11B). We further evaluated the concentrations of PS-MPs in kidney tissues. The kidney tissues exhibited a specific Raman peak at 1,000 cm − 1 (Wręczycki et al. 2020), giving a mean intensity of 597.4 ± 17.43 , which corresponded to 3.07 ± 0.15mg /gkidney (Figure 7A–D). Statistical results of each mouse Raman analysis (Figure 7D) (sham group vs. 0.4-mg/ mL group: p < 0.001 ) based on the concentration and PS-MP Raman intensity plot (Figure 7B and Table S2). Next, the ultrastructure of kidney tissues treated with PS-MPs were observed using TEM (Figure 7E). We found that PS-MPs were present in tubular epithelial cells.

[Image omitted - see PDF]

Discussion

Recent studies have indicated that organs/tissues such as the gut, liver, and kidneys in mice (Deng et al. 2017b; Yang et al. 2019) and muscle tissue in northern fulmars (Herzke et al. 2016) can accumulate MPs. PS-MPs treatment can decrease mucus secretion and alter the microbiota in the gut (Lu et al. 2018) and induce inflammation in the small intestine (Li et al. 2020) in mice. However, most studies focused on liver-related variables, such as lipid accumulation (Deng et al. 2017b), changes in hepatic lipid expression (Lu et al. 2018), obvious changes in liver histopathology and alteration of serum and hepatic markers (Luo et al. 2019a). Several reports have shown that PS-MPs accumulate in the kidneys in mice, but they did not determine the effects with regard to kidney damage or regulatory mechanisms (Deng et al. 2017b; Yang et al. 2019). To our knowledge, we are the first to present evidence supporting the accumulation of PS-MPs in vitro (in HK-2 cells) and in vivo (in mice). (Figures 1 and 7 and Table S2). We found that the hydrodynamic diameter of PS-MPs was 1.878 ± 0.677μ m . Notably, particles with a zeta potential > 30mV or < − 30mV have been shown to be stable in suspension and not to aggregate (Mohanraj and Chen 2006); the zeta potential of PS-MPs in the present study was − 76 ± 1.2mV , which is < − 30mV . Therefore, the particles were stable in suspension. The PDI for the PS-MPs was 0.189 (Table S1). Previous studies have demonstrated that a PDI of ∼ 0.2 or below indicates that the particles are stable following dispersion (Saremi et al. 2011). We found that the PS-MPs did not affect kidney cell viability (Figure 2A). PS-MP treatment for 1 or 2 h is used for early endocytosis detection (Liu et al. 2017). However, in the present study, kidney cells treated with PS-MPs had higher levels of mitochondrial ROS, Bad, ER stress-related proteins, inflammation-related proteins, and autophagy-related proteins than found in sham-treated cells (Figures 2 and 3). A previous study showed that mitochondrial-mediated apoptosis is regulated by antiapoptotic (Bcl2) and proapoptotic (Bad and Bax) proteins (Savitskaya and Onishchenko 2015). In addition, exposure to PS-MPs in scleractinian coral regulated the JNK and ERK1/2 signaling pathways (Tang et al. 2018). We further found that protein expression in the MAPK signaling pathways (p38, JNK, and ERK1/2 signaling pathways) and AKT/mTOR signaling pathways were differentially phosphorylated (Figure 3B,D and Figure S8), suggesting that PS-MPs regulated the signaling of these pathways. Inhibition of mitochondrial ROS production mitigated the PS-MP–induced effects on Bad, IRE1 α , and LC3 in HK-2 cells, suggesting that these effects occurred via the ERK1/2 and AKT/mTOR signaling pathways (Figure 4 and Figure S8). In addition, kidney tissue sections showed higher expression of IRE1 α , COX-1, and LC3, similar to the findings in cells (Figure 6 and Table S5). The results showed that PS-MPs injured the kidneys.

The mechanisms of MPs cytotoxicity involve stimulation of oxidative stress via free radical generation originating from ROS (Barboza et al. 2018; Brandts et al. 2018; Liu et al. 2019; Pitt et al. 2018; Qu et al. 2018; Tang et al. 2018). ROS overproduction can alter the homeostasis of cellular components, including DNA, RNA, carbohydrates, lipids, and proteins, via consumption of antioxidant systems components. These damages were associated with physiological alterations, gene instability, and carcinogenesis (Birben et al. 2012; Nita and Grzybowski 2016). In the present study, our results indicate that PS-MPs induced oxidative stress via mitochondrial ROS (Figure 2D,E). Thus, mitochondrial ROS may play an important role in the effects of PS-MPs.

In addition, muscle tissue was shown to accumulate MPs in animals, but no related effects with regard to muscle damage or regulatory mechanisms were found (Abbasi et al. 2018; Herzke et al. 2016). As shown in Figure 6B, creatinine levels were significantly lower in mice treated with PS-MP for 4 and 8 wk. Previous studies have demonstrated that serum creatinine is affected by muscle mass (Baxmann et al. 2008; Thongprayoon et al. 2016). As shown in Figure S10A, Masson’s trichrome staining and immunostaining of dystrophin showed that muscle mass was lower in the PS-MP–treated mice compared with the sham group. The grip strength test also that PS-MP–treated mice exhibited 13% lower grip strength than sham-treated mice (Figure S10B). These results suggest that the loss of muscle function occurred after PS-MP treatment. PS-MP–induced muscle dysfunction may interfere with creatinine production to result in lower kidney serum index values given that we could not find any indications of kidney injury from analysis of serum indexes, such as creatinine and BUN. In addition, we found that the urinary protein level was higher for mice treated by oral gavage with PS-MPs. The SDS-PAGE results showed that the urine of PS-MP-treated mice had higher proteins than those of sham-treated mice (Figure S11). Immunoblotting showed that one of the leaked proteins was albumin, and one sample showed higher levels than those observed in the sham group of mice (Figure S11). Some studies have shown that urinary proteins are early biomarkers of CKD (Chacar et al. 2017; Ferlizza et al. 2017; Maeda et al. 2015). The results of the present study suggest that PS-MPs not only injure the kidneys but also harm the muscle tissue.

Several studies have indicated the effects of fine particulate matter [PM ≤ 2.5μ m in aerodynamic diameter ( PM 2.5 )] on the human respiratory system (Xing et al. 2016), lung cancer, and chronic airway inflammatory diseases (Li et al. 2018). In addition, one study indicated that PM air pollution is a risk factor for CKD and end-stage renal disease (Bowe et al. 2018). We wondered whether treatment with 2-μ m PS-MPs have similar effects. PM 2.5 is known to induce autophagy in vitro (Deng et al. 2017a; Fu et al. 2017; Zhou et al. 2017). Our results suggest that PS-MPs also induce autophagy (Figure 3E–G). We constructed stable ATG5KD kidney cells to prove the role of autophagy in the kidney cells (Figure 5A). We found that cell viability was lower after PS-MPs were added to stable ATG5KD kidney cells compared with those treated with water (Figure 5A–C). In addition to autophagy, PM 2.5 induces apoptosis failure, which is a mode of cell death that represents a transition from apoptosis to necrosis in human lung epithelial cells (BEAS-2B cells) (Zhou et al. 2017). In the present study, cells treated with PS-MPs had higher levels of mitochondrial ROS, Bad, some ER stress-related proteins, some inflammation-related proteins, and some autophagy-related proteins in kidney cells (Figures 2 and 3 and Figure S2–S9). However, PS-MPs did not induce apoptosis in HK-2 cells (Figure 2B,C). Our results also indicated that MEF cells treated with PS-MPs did not affect cell viability compared to those treated with the vehicle alone. In contrast, in A t g 5 − / − MEFs, in which the autophagic function was knocked out, treatment with PS-MPs resulted in higher markers of apoptosis (Figure 5D–F). Autophagy sometimes acts as an adaptive stress response in kidney injury that removes protein aggregates and promotes cell survival (Riediger et al. 2011) and sometimes causes cell death by enhancing apoptosis (Chien et al. 2007). We found that inhibition of autophagy regulation can result in the expression of higher inflammation protein and cell death (Figure 5). Therefore, our results suggest that autophagy plays a protective role against PS-MP–induced kidney damage.

The World Wildlife Fund has reported that the average human ingests ∼ 5,000 mg of plastic per week (de Wit and Bigaud 2019). The average body weight of humans worldwide is 62 kg (Walpole et al. 2012). Thus, humans might be exposed to plastics at a dose of 80.64mg / kg per week. In particular, the people who consume large amounts of sugar and seafood might ingest many MPs, according to a table of human MP consumption (Cox et al. 2019). We gavaged PS-MPs that were diluted in distilled water into the esophagus to achieve doses of 0.2mg / d and 0.4mg / d twice per week and continued treatment for 4 and 8 wk. According to this regimen, the maximum dose of PS-MPs in a 30-g mouse was 26.67mg / kg per week, and this concentration altered some ER stress, inflammation, autophagy-related proteins and induced kidney abnormalities. Thus far, MPs have been found in the human stool (Schwabl et al. 2019), and MPs or NPs have been detected in many organs of different animal species (Wang et al. 2020). Current findings indicate a possible risk of long-term MP or NP accumulation in humans due to food chain contamination (Wang et al. 2020). In addition, CKD is largely attributable to common risk factors, such as hypertension and diabetes (Global Burden of Disease Study 2013 Collaborators 2015). Previous study results have shown that CKDu occurs in many countries regardless of income (Gifford et al. 2017; Jha et al. 2013). Therefore, we wonder whether long-term exposure to PS-MPs that might be a risk factor in CKDu.

Thus far, plastic control and cleanup plans have been created by many countries worldwide (Xanthos and Walker 2017). A Netherlands-based organization, the Ocean Cleanup, uses massive nets to clean the garbage that floats on the world ocean (Williams 2019). The Australian government uses filters on large drains that stop garbage from entering the ocean (Inhabitat 2018). Plastic packaging and single-use plastic items such as medical masks, plastic spoons, plastic cups, plastic drinking straws, plastic jars, plastic bags, and plastic bottles account for a large proportion of plastic waste (Claudia 2018). Many countries including the European Union, China, the USA, and the UK, have recently implemented policies to restrict single-use plastic items (Krishnan 2019). In addition, facial cleansers containing plastic particles (Duis and Coors 2016) have been banned in 15 countries (Plastic Soup Foundation 2020). Preventing MPs or NPs from synthetic fiber textiles from flowing into rivers (Carney Almroth et al. 2018) and preventing MPs from wastewater treatment plants from flowing into the oceans are important pursuits (Leslie et al. 2017). Control measures and bans on MPs or NPs can reduce the return of these materials to humans via the food chain. We hope our results can help accelerate the implementation of global bans on single-use plastics. Because of the coronavirus disease 2019 (COVID-19) outbreak, large amounts of personal protective equipment and many relatively single-use plastic products are rapidly entering our natural environment (Haque et al. 2021).

Figure 8 shows the schematic diagram of the proposed mechanism by PS-MPs in kidney cells. We have demonstrated that PS-MPs are taken up by kidney cells in mice and that PS-MPs can result in higher levels of mitochondrial ROS, as well as the expression of Bad, the ER stress-related protein IRE1 α , the inflammation-related proteins cPLA 2 and COX-1, and the autophagy-related proteins Beclin1 and LC3. PS-MPs also can alter the phosphorylation of proteins involved in the MAPK and AKT/mTOR signaling pathways. Furthermore, inhibition of mitochondrial ROS mitigated the effects of PS-MPs on Bad, IRE1 α , and LC3 levels via AKT/mTOR signaling pathways. Autophagy may be an adaptive response to PS-MP stress that alters the levels of inflammation-related proteins, such as COX-1 and apoptosis. Oral gavage of 0.2-mg/ mL or 0.4-mg/ mL PS-MPs in mice also affected tubular lesions and IRE1 α , COX-1, and LC3 levels, as shown by IHC. Moreover, PS-MPs affects urinary proteins in treated mice. Finally, we found that PS-MPs results in muscle injury and altered muscle function, as determined by the expression of dystrophin and grip strength analysis. Thus, we found that PS-MPs may cause changes in mitochondrial ROS, Bad, ER stress-related proteins, inflammation-related proteins, and autophagy-related proteins in addition to causing kidney damage and protein leakage.

[Image omitted - see PDF]

Acknowledgments

We acknowledge C.-M. Lee for his excellent technical support in transmission electron microscopy (HT7700; HITACHI) at the Taipei Medical University Core Facility. Experiments and data analysis were performed in part through the use of the Medical Research Core Facilities Center, Office of Research and Development at the China Medical University, Taichung, Taiwan. ATG5 WT and null MEF cells provided from Dr. Noboru Mizushima (Tokyo Medical and Dental University, Tokyo, Japan). This study was supported by the Ministry of Science and Technology, Taiwan (MOST 108-2314-B-039-061-MY3, MOST 109-2314-B-038-078-MY3, and MOST 109-2314-B-038-109) and by the China Medical University, Taichung, Taiwan (CMU109-N-01).