Neospongodes atlantica, a potential case of an early biological introduction in the Southwestern Atlantic

Abstract

Soft corals (Anthozoa: Octocorallia) are discreet components in the Southwestern Atlantic reef communities. In Brazil, the native octocoral shallow-reef fauna is mostly represented by gorgonians. Consequently, except for the nephtheid Neospongodes atlantica, most of the known soft corals from this region are considered non-indigenous. Hitherto, the monotypic genus Neospongodes, which was proposed in the early 1900s, has been considered to be endemic to the Northeastern Brazilian coast. Herein, based on in situ records, we show that N. atlantica is a substrate generalist that has been probably expanding its distribution by dominating extensive shallow and mesophotic sandy and reef bottoms, generally outcompeting other reef benthic organisms, including Brazilian endemic species. Based on previously unidentified museum specimens, new records, and a broad literature review, we provide the most comprehensive modelling of the potential distribution of this species in the Southwestern Atlantic. Based on molecular inference supported by in-depth morphological analysis, the probable non-indigenous and, therefore, ancient introduction of N. atlantica in Brazilian waters is discussed. Finally, these results support that Neospongodes and the Indo-Pacific Stereonephthya are synonyms, which led us to propose the latter as taxonomically invalid.

Introduction

The Brazilian Exclusive Economic Zone harbors the largest and most diverse coral reef communities in the South Atlantic (Leão, Kikuchi & Testa, 2003; Francini-Filho et al., 2013), including a high percentage of endemic corals (Souza et al., 2017). Brazilian shallow-water reefs have been the focus of most marine assessments to date, including biodiversity surveys and mapping (e.g., Leão et al., 2016). However, in the last decade, ecosystems deeper than 30 m (mesophotic ecosystems) started to be assessed, with most studies concentrated in oceanic islands and the north, northeastern and central Brazilian continental shelfs (Cordeiro et al., 2015; Magalhães et al., 2015; Moura et al., 2016; Pinheiro, Bernardi & Simon, 2017; Francini-Filho et al., 2019; Soares, Tavares & Carneiro, 2018).

Recently, remotely operated vehicle (ROV) surveys have revealed dense monospecific aggregations of the soft coral Neospongodes atlantica Kükenthal, 1903 on soft-bottoms off several localities of the northeastern Brazilian coast, a still undescribed kind of benthic community (Moura et al., 2013). Neospongodes atlantica is the only representative of the genus and, to date, considered endemic to Brazil (Castro, Medeiros & Loiola, 2010). In terms of distributional records, N. atlantica has been reported only to its type locality and the type locality of N. bahiensis (see Kükenthal, 1903 - the later synonymized with the former by Verseveldt (1983)), both representing shallow-reefs from the Bahia State (∼12–16°S). One additional single record was that from Castro, Medeiros & Loiola (2010) at the Rio Grande do Norte State (∼6°S). Overall, octocorals are considered ecosystem engineers that, in some localities, support dense assemblages in shallow and deep-waters, adding tri-dimensionality, modulating water flow and, consequently, increasing the diversity in reef environments (Roberts, Wheeler & Freiwald, 2006; Buhl-Mortensen et al., 2010; Nelson & Bramanti, 2020). Octocorals are reported from all oceans and are ubiquitous in coral communities around the globe, being regarded as one of the main components and great competitors for space in benthic assemblages of the Indian and Central Western Pacific ocean basins (Fleury et al., 2008; Janes & Mary, 2012; Pérez et al., 2016), as well as their rise in the Caribbean during the last decades (Lasker et al., 2020).

In the Southwestern Atlantic, more specifically in the Brazilian coast, octocorals are considered discreet components of the reef communities (see Pérez et al., 2016; Aued et al., 2018), with reduced populations (Cassola et al., 2016) usually concentrated in narrow bathymetric and geographic ranges (e.g., Castro, Medeiros & Loiola, 2010; Francini-Filho et al., 2018). In general, the Caribbean and Brazilian octocoral communities are predominantly composed of gorgonian corals (e.g., families Gorgoniidae and Plexauridae) (Bayer, 1961; Pérez et al., 2016; Sánchez, 2016). On the other hand, the Indo-Pacific octocoral communities are dominated by soft corals, mainly those from the families Alcyoniidae, Xeniidae and Nephtheidae (Fabricius, 1997; Fabricius & Alderslade, 2001). Such biogeographical pattern raises uncertainties on the native condition of nephtheids, such as Neospongodes, in Brazilian waters.

Although other Neospongodes species have been described, it is currently accepted as a monotypic genus (Cordeiro et al., 2021). For example, Neospongodes agassizi (Deichmann, 1936) and Neospongodes caribaea (Deichmann, 1936) were transferred to the genus Chironephthya (Cairns & Bayer, 2009; Imahara et al., 2017), whereas Neospongodes portoricensis (Hargitt & Rogers, 1901) is accepted as Stereonephthya (Verseveldt, 1983). Because of such taxonomical challenges, it is also important to consider the relationship between the Neospongodes and Stereonephthya, the latter common in the Indo-Pacific (Fabricius & Alderslade, 2001; Chanmethakul, Chansang & Watanasit, 2010).

Morphologically, Neospongodes is almost indistinguishable from Stereonephthya in most characters, such as colony and sclerite shape, size, and distribution (Verseveldt, 1983; Ofwegen & Groenenberg, 2007). Also, recent molecular-based phylogenies have added to the previous evidence that there are species complexes that demand more in-depth studies (Ofwegen, 2005; Ofwegen, 2007). Assuming that both Neospongodes and Stereonephthya correspond to a single genus, its occurrence in the Southwestern Atlantic could represent an ancient introduction. Such hypothesis is tested herein in the light of classical morphology and molecular data. In such a context, since the Brazilian unique marine biodiversity is under crescent threats, such as industrial pollution, fisheries, ocean drilling, and bioinvasion (Werner, Pinto & Dutra, 2000; Miranda & Marques, 2016; Creed et al., 2017; Francini-Filho et al., 2018; Capel et al., 2020; Carpinelli et al., 2020; Tanasovici, Kitahara & Dias, 2020), conservation actions are needed to address such challenges (Castro & Pires, 2001; Picciani et al., 2016). Apart from shedding light on N. atlantica taxonomy and systematics, we also modeled its potential habitat (PH) distribution (including the newly found octocoral forest (OF)) through Species Distribution Models (SDMs) (Pearson et al., 2007). Taken together, our results provide the very first tools for decision-makers in terms of the potential invasiveness of this species on the Brazilian coast and discuss on possible ecological consequences of N. atlantica silent spread into Brazilian shallow-reef areas.

Material and Methods In situ records

Newly discovered and previously reported Brazilian OFs were accessed through non-targeted SCUBA and technical diving, and ROV surveys between 2007 and 2017 in depths of up to 80 m deep at three localities in distinct latitudes. In situ records resulted from occasional findings extracted from not-scaled and not-standardized surveys. For this reason, some information regarding dive/mission are missing, including ROV bottom time. The first survey, at the Equatorial outer continental shelf (3°26′S/38°08′W, off Ceará State), occurred in March 2010 at 61 m deep using a Seabotix ROV, revealing a relatively flat rocky substrate covered by a thin veneer of medium grained sands with about 12% of CaCO₃ (Moura et al., 2013; https://figshare.com/articles/media/Supplemental_Video_1_mp4/21534636). Another survey, carried out at the Cabeço Brasil through technical dives on November 2015 (08°13′S/34°36′W, off Pernambuco State), aimed at a mesophotic coral-sponge community between 50 and 75 m at a continental shelf-break paleo-channel. This paleo-channel displayed a central sandstone reef surrounded by soft-bottoms and rhodoliths (https://figshare.com/articles/media/Supplemental_Video_2_mp4/21539517). Finally, the last sets of in situ information gathered using technical and ROV dives were performed at the Abrolhos Bank (17°53′S/18°20′S and 38°40′W/39°10′W, Bahia State) around shallow reef pinnacles (e.g., Timbebas reef) between 18 and 81 m (https://figshare.com/articles/media/Supplemental_Video_3/21539613). Field studies were performed under ICMBio licenses SISBIO 15691-1 and SISBIO-11709-1.

Museum specimens and morphological analysis

Fifty-nine specimens of N. atlantica from the Petrônio Alves Coelho Oceanographic Museum (MOUFPE-CNI) and National Museum (MNRJ) collections (Table S1) were examined to investigate the distribution of OFs in Brazilian waters. Fragments of specimens were dissolved in sodium hypochlorite to allow sclerite examination with a light-microscope and also a scanning electron microscope (Jeol 6460-LV). Identifications followed Bayer (1961) and Bayer, Grasshoff & Verseveldt (1983). A specimen sampled through technical diving off Recife (Pernambuco State, Brazil) was used for DNA extraction.

DNA extraction, amplification and sequencing

Total genomic DNA was extracted using the DNeasy blood and tissue kit (Qiagen, Inc. Valencia, CA, USA) following the manufacturer’s protocol. DNA extraction yield and quality were verified using a spectrophotometer (Nanodrop, Thermo Fisher Scientific, Waltham, MA, USA) and a 1% agarose gel electrophoresis, respectively. Polymerase chain reactions (PCR) cycling of mitochondrial genes followed McFadden et al. (2006) and Cairns & Wirshing (2015), and targeted the genes: mtMutS (msh1); and COI + IGR1 (Table 1). The nuclear long ribosomal gene 28S rDNA was partially amplified according to Halàsz et al. (2015) (Table 1). For each gene, PCR reaction totaled 15 µl containing: 1.5 µl of the 10X PCR buffer; 0.45 µl of MgCl2 (50 mM); 0.3 µl of dNTP (10 mM); 0.3 µl of each primer (10 µM); 11.09 µl of ddH2O; 0.06 µl of Platinum taq DNA Polymerase (0.6 U); and 1.0 µl of the DNA sample. Amplicons were purified according to ExoSAP-IT protocol and sequenced using the AB 3500 Genetic Analyzer in both directions. This study is registered under SISGEN record A7E8638.

Phylogenetic analysis

Sequences were edited and concatenated using Geneious v.2020.2.2 and Fasta Alignment Joiner (Villesen, 2007), and then aligned with nepththeid sequences deposited in GenBank (Table S1) using MUSCLE available at the EMBL-EBI platform (Edgar, 2004; Madeira et al., 2019), and manually refined using Jalview v.2.11.1.0 (Waterhouse et al., 2009). Statistical analyzes were performed using the software MEGA-X (Kumar et al., 2018). Acrophytum claviger (GenBank accession: JX203823.1) was used as an outgroup. The JModelTest2 (Darriba et al., 2012) was used to define the best-fit model of evolution of the resulting nucleotide alignment. Bayesian Inference (BI) of the mtMutS alignment was performed using MrBayes v.3.2.7 (Ronquist & Huelsenbeck, 2003) at the CIPRES platform (Miller, Pfeiffer & Schwartz, 2010) with four parallel runs with 10 million generations each. The first quarter of the sampled topologies were discarded as burnin. For the concatenated alignment, BI was performed in four parallel runs with 4 million generations each and had the same percentage of the sampled trees discarded as burnin. Maximum-likelihood analysis (ML) was performed using the RAxML v.8.2.12 with 1,000 bootstrap replications (Stamatakis, 2014).

Table 1: List of primers utilized to amplify and partially sequence the mitochondrial (COI, MSH1) and nuclear (28S) gene regions.

Primers	Sequence 5′–3′	References	Gene
MSH1-F	AGGAGAATTATTCTAAGTATGG	Herrera, Baco & Sánchez (2010)	mtMuts
MSH1-3458R	TSGAGCAAAAGCCACTCC	Sánchez, Lasker & Taylor (2003)	mtMuts
CO1-LA-8398F	AATGGCGGGGACAGCTTCGAGTATGTTAATACGG	Brugler & France (2008)	CO1
CO1-OCT-R	ATCATAGCATAGACCATACC	France & Hoover (2002)	CO1
28S-Far	CACGAGACCGATAGCGAACAAGTA	McFadden & van Ofwegen (2013)	28S
28S-Rab	TCGCTACGAGTCTCCACCAGTGTTT	McFadden & van Ofwegen (2013)	28S

DOI: 10.7717/peerj.14347/table-1

Occurrence, environmental data, and modelling

Besides the examined specimens and video surveys, previously published information on occurrence records (latitude and longitude) (Epifanio et al., 1999; Dutra et al., 2006a; Ferreira et al., 2009; Lima et al., 2013) and also from open data sources (e.g., http://splink.cria.org.br and http://gbif.org) were compiled.

Through simple rarefaction, occurrence data were reduced to one per pixel (∼1 km) of the study area. Pixels that showed environmental data values far from the centroid of the overall values (based on the weighted value of each PC result) were excluded from further analyzes using the rarefaction filter for environmental heterogeneity available in SDMtoolbox v.2.2 (Brown et al., 2017). The remaining records were managed in two groups: (i) new records and in situ data (model building records); and (ii) existing records (model evaluation records) (ESM 2).

Environmental (predictor) variables were sourced from the bio-oracle database (http://www.bio-oracle.org; Tyberghein et al., 2012; Assis et al., 2018) (Table 2). Bathymetric information was harvested from naturalearthdata.com. These variables were cropped to the study area using the “CropRaster” function of the ENMGadgets R package (Barve & Barve, 2013). Since N. atlantica has few documented occurrence records, we assumed a small number of variables as sufficient (Ficetola et al., 2014). Therefore, a Principal Component Analysis (PCA) was performed to check which variables of the environmental dataset had a higher contribution value (e.g., r > 0.7).

Table 2: Variables used to generate models and respective auto-correlations.

Variables	Correlations
Chlorophyll.max	Primary productivity.max
Dissolved oxygen.min	No correlations
Nitrate.range	Sillicate.range
Primary productivity.max	Chlorophyll.max
Salinity.max	Temperature.max, Temperature.range
Sillicate.range	Nitrate.range
Temperature.max	Salinity.max, Temperature.range
Temperature.range	Sillicate.range, Temperature.max

DOI: 10.7717/peerj.14347/table-2

The calibration area for the models (M) corresponds to the entire area to which the species had access at some point (Barve et al., 2011). The choosing of M has been well discussed in the literature (Soberón & Peterson, 2005; Owens et al., 2013), especially to reduce the hypothesis bias regarding the access of species (Anderson & Raza, 2010). Since the known distribution of N. atlantica is limited, we extended the area around the occurrence records by 20 km² in diameter, thus creating a perimeter (M) representing only the known accessible area for the species (Fig. 1). This method reduces uncertainties about the distribution of the species and the risk of extrapolating the model to new areas beyond the known distribution (Nuñez Penichet et al., 2021; Fulgêncio-Lima et al., 2021; Machado-Stredel, Cobos & Peterson, 2021). Overall, the model projection area (G) extends along the Brazilian Continental shelf (Fig. 1), from the coastline to the shelf-break (0–200 m).

Figure 1: Study area, including the model calibration area (M) and the model projection area (G). DOI: 10.7717/peerj.14347/fig-1

The Maxent software (Phillips, 2005) was used through the dismo package (Hijmans et al., 2013) to model potential habitats (PH) for N. atlantica in the study area, with the Kuenm package (Kükenthal, 1903) applied to find the best parameterization configuration. Candidate models were calibrated using all “feature classes” (FC) combinations available at the Maxent; 29 parameters “Regularization Multiplayer” (RM) (0.1–1 with 0.1 interval and 1–10 with 0,5 intervals), maximum “background” number (100,00), 100 repetitions, and 64 sets of variables.

For each Maxent configuration parameter, two candidate models were created using the “kuenm_val” function, of which one with the complete set of modeling records and the other with 75% of the modeling records. To evaluate candidate models, three criteria were used via “kuenm_ceval” function: (i) models built with 75% of the modeling records were evaluated for statistical significance using the “partial ROC tests” (Peterson, Papeş & Soberón, 2008), and then for performance through the omission rate (using 25% of the modeling records); (ii) models constructed with the complete set of modeling records were evaluated using the corrected small sample Akaike Information Criterion (AICc) (Warren, Glor & Turelli, 2010); and (iii) models that passed in both criteria were projected in G. The best model of those projected in G was chosen according to “partial ROC tests” and omission rates (E = 5%), respectively (Kükenthal, 1903).

The final models were created in G through three types of extrapolations: (1) strict extrapolation, in which the models show a response even if the environmental conditions of G are outside the environmental range of the calibration area (M); (2) without extrapolation, in which areas of G with more extreme environmental conditions than those in the calibration area (M) receive zero response; and (3) extrapolation by fixation, which was the one used to calculate the Potential Suitable Habitat (PH). The final models were built using extrapolation by clamping, where areas of G that are environmentally different from M are fixed on the periphery of the environmental region of the calibration area (M) (Kükenthal, 1903), making the model assign a low environmental suitability value to these areas.

To assess the risk of extrapolating the environmental space from M to G, the multivariate environmental distances between the transfer area (G) and the nearest portion of the calibration region (M) were calculated applying the mobility-oriented parity metric (MOP) (Owens et al., 2013) using the “kuenm_mmop” function. The map indicating the places with a high risk of extrapolation (risk of uncertainty) was constructed using the “kuenm_mop” function. Finally, the binary adequation map was built using maximum threshold values, which are more adequate to species with reduced occurrence records (Liu, White & Newell, 2013). All shapefiles were obtained from open sources (IBGE, http://www.naturalearthdata.com), and the maps were built using the Information System and Geoprocessing software (Quantum GIS (Development Team, 2014)). All data used in the modelling analyzes are available as (Data S1–Data S3).

Results In situ records

Conventional SCUBA, ROV and technical dive surveys revealed extensive aggregations of N. atlantica dominating deeper soft-substrata (mesophotic depth) on the continental shelf (Fig. 2A; ESM 2, ESM 3) and shallow reef-walls surrounded by sandy bottoms (Figs. 2B–2D). All observed contact interactions were harmful to other coral species (Figs. 2C–2D). Although in situ evidence of OFs was only obtained for the surveyed sites, they may follow the distribution range of N. atlantica. The Cabeço, for example, area with the largest OF found during our surveys had nearly 1 km² surveyed but the OF limits were not reached.

Figure 2: Substrate dominance and allelopathic competition of Neospongodes atlantica to Brazilian native corals at Timbebas reef (17°28′37.2″S, 39°01′37.2″W, 10–15 m deep). (A) Aggregation of N. atlantica on sandy bottom in the Abrolhos region, Bahia. (B) N. atlantica colonies dominating a reef edge on Abrolhos reefs. (C) Bleaching and partial necrosis caused by N. atlantica on the scleractinian coral Montastraea cavernosa (arrow). (D) N. atlantica covering a black-coral colony (Stichopathes sp.). All photos by RB Francini-Filho. DOI: 10.7717/peerj.14347/fig-2

Morphology

Assessment/identification of museum samples yielded 60 records of Neospongodes atlantica (between ∼1°S and 19°S, from 1 to 75 m depths; Table S2), most of which have not been published before. The species has highly flexible and arborescent colonies rarely taller than 100 mm, with branches standing upwards (Fig. 3A), resulting in a width of about 60 mm. Colonies coloration varies from white, pink to pale brown, and are attached to substrate through slender coenenchyme basal expansions. The polyps occur on the branches, but most are distally concentrated, all with a projecting supporting bundle of sclerites in the form of spindles of up to 1.7 mm in length (Figs. 3C, 4A, Fig. S1). The colony stalk is up to 20 mm wide, have no polyp, and is composed of several longitudinal channels separated by thin walls, in which spindles are common (Figs. 3D, 4D). In most examined samples, one of the channels shows a higher concentration of such sclerites, forming an irregular pseudo-axis (Figs. 3B, 3E). It is important to mention that colony measurements given herein correspond to ethanol-preserved samples, which are mostly contracted. Polyps with an anthocodial armature formed by spindles arranged in chevrons of up to six lines (0.5 to 1.0 mm long), become smaller and more linear towards the tentacles (0.15 to 0.30 mm long) (Figs. 4B, 4C, 4E). Spindles on the supporting bundles often curved and pink-colored (0.3 to 1.2 mm).

Figure 3: Main distinctive morphological characters in Neospongodes atlantica (MOUFPE 431). (A) Entire colony. (B) View of the stalk with a central channel, in which sclerites occur in a higher density. (C) View of anthocodia on a branch tip showing projecting supporting bundles. (D) Colony with its stalk transversally sectioned, showing longitudinal channels. (E) Colony channels in detail. Abbreviations: ch - channel; p - projecting tip of a spindle; sb - supporting bundle of sclerites; and ch* - pseudo-axis. DOI: 10.7717/peerj.14347/fig-3

Figure 4: Sclerites of Neospongodes atlantica Kukenthal, 1903 (MOUFPE 439). (A) Spindles of the supporting bundle; (B) spindles of the anthocodial points; (C) flattened rods of the crown region; (D) spindles of the interior of the stalk; (E) flattened rods of the adaxial portion of the polyp; (F) sclerites of the surface of the stalk. DOI: 10.7717/peerj.14347/fig-4

Molecular and phylogenetic analysis

Molecular analysis resulted in sequences of 662 bp long for the mtMutS, 707 bp for the COI and only 322 bp for the 28S marker. The final alignment, consisting of three concatenated genes (mtMutS, COI, and 28S), included 103 taxa and is 2,181 bp long, of which 1,275 of the 1,840 variable sites are parsimony informative. The best-fit models for the final alignment were the GTR+G (mtMutS), HKY+G (COI), and K80+I+G (28S). Pairwise distance between Stereonephthya cf. cundabiluensis from Palau (GenBank accession numbers: KF915783 and KF955259) and N. atlantica resulted in differences smaller than 0.5% within mitochondrial markers. However, when comparing the 28S dataset, the specimen identified as Dendronephthya sp. from Palau (GenBank accession number: KF915355) is more similar to sequenced N. atlantica (p-distance of 0.094) than to Stereonephthya species, which have a pairwise distance between 0.11 to 0.29.

The ML and BI (Fig. 5) phylogenies based on the concatenated alignment unequivocally retrieved a clade containing all Stereonephthya spp. and N. atlantica (95-ML; 100-Posterior Probability [BI]). This clade is close related to that formed by Litophyton, Nephthea, and Dendronephthya savignyi (97-ML; 100-PP). Remaining Dendronephthya representatives tested (30 specimens; 98-ML and 100-PP) were recovered as a sister clade to the aforementioned groups. Most of the remaining genera included in our phylogeny appears to be monophyletic, the exception being Paralemnalia sp. (40981) that is more closely related to Lemnalia spp. than to its congeners. The only discrepancy between ML and BI recovered topologies was the position of the Gersemia clade that although monophyletic, was retrieved diverging from Eunephthya thysoides in the ML and as polytomy in the BI topology (see dashed line in Fig. 5).

Figure 5: Maximum Likelihood and Bayesian inference phylogenetic reconstructions of the family Nephtheidae based on the extended Octocorallia barcoding genes (mtMutS + COI + 28S) concatenated data. The Brazilian specimen of Neospongodes atlantica sampled from Recife is highlighted in red. Green circles on nodes indicate supports over 80% for ML and posterior probability of 100 (BI). Dashed branch indicate the Gersemia clade leading branch retrieve in BI. Genbank sequences of Nephthea (40972, 40973, CO34070, CO34112) correspond to Litophyton, recently synonymized. DOI: 10.7717/peerj.14347/fig-5

Species distribution models

A PCA showed that more than 99% of the environmental variance was explained by groups of two, three, or four variables (Data S2). Pearson correlation selecting eight variables (Data S2), suggested that 64 out of the 93 possible combinations have auto-correlation above 0,8. Thus, we built 24 datasets with two variables, 28 with three variables, and 12 with four (Data S2).

After filtering procedures, a total of 23 records were used for model building (new records) and 12 records were used for model testing (independent records) (Fig. 6). The evaluation of the models calibrated in M resulted in 15 candidates according to omission rates and AICc (Data S3) (Table 3). The final model (from those projected in G) was built using maximum temperature (57.2% of contribution) and maximum silicate (42.8% of contribution), RM = 0.6 and FC = pt.

Figure 6: Occurrence records and current potential habitat. (A) Modeling records of Neospongodes atlantica (new) and evaluation records (previously existing records). (B) Potential habitat area for N. atlantica in the Brazilian coast, from intertidal zone to shelf-break. DOI: 10.7717/peerj.14347/fig-6

Table 3: Candidate models calibrated in M.

Criterion	Number of models
All candidate models	53,824
Statistically significant models	24,182
Models that meet the omission rate criteria	34,193
Models that meet the AICc criteria	34
Statistically significant models that meet the omission rate criteria	6,169
Statistically significant models that meet the AICc criteria	24
Statistically significant models that meet the omission rate and AICc criteria	15

DOI: 10.7717/peerj.14347/table-3

The total area with PH for N. atlantica in the examined area is approximately 553,015.5 km², occupying 73.07% of the G area (Fig. 6). The use of buffers around the occurrence records to calibrate the model can reduce uncertainties when such model is extrapolated to new areas beyond the calibration area (Ficetola et al., 2014; Fulgêncio-Lima et al., 2021; Machado-Stredel, Cobos & Peterson, 2021). Bathymetric analyzes showed that 29.4% of the PH is between 0 and 20 m deep (162,670 km²), 24.2% from 20 to 50 m (134,382 km²), 16.6% between 50 and 75 m (91,943.9 km²), 10.9% from 75 to 100 m (60,674.6 km²), and 18.6% around 100 and 200 m (103,345 km²) (Fig. 7).

Figure 7: Potential habitat for Neospongodes atlantica at five different depths within the Brazilian coast from the intertidal zone to the end of the continental shelf. DOI: 10.7717/peerj.14347/fig-7

The mobility-oriented parity analysis (MOP) revealed that most of the areas with PH showed a high risk of strict extrapolation within the Brazilian continental shelf (G) (Fig. 8). These G areas have values outside the environmental range of the calibration area (M). However, the regions in the southernmost and northernmost (Amazon reefs) limits showed very low or zero risk of extrapolation (Fig. 8).

Figure 8: Potential habitat end mobility-oriented parity analysis (MOP). Assessment of the risk of extrapolation of M in G. DOI: 10.7717/peerj.14347/fig-8

Discussion Neospongodes atlantica and the systematics of nephtheids

Nephtheids have been classified mostly based on morphological data. Nonetheless, despite morphology being essential for the correct identification of octocorals, due to plasticity and homoplasy, it is nothing less than challenging to differentiate nephtheid genera and species (Ofwegen & Groenenberg, 2007). Therefore, improved morphological data acquisition techniques, such as sclerite analysis using SEM, combined with genetic data, suggested that, not only Nephtheidae, but many octocoral families and genera were unnatural groupings resulting from poor identifications/descriptions (Verseveldt, 1983; Ofwegen, 2005; Ofwegen & Groenenberg, 2007). For example, Dendronephthya Kükenthal (1905), Litophyton Forskål (1775), and Stereonephthya, genera that were recovered as a well-supported clade in the present study, are morphologically complex and, in general, poorly studied, as discussed in the most recent and comprehensive revisions (Ofwegen & Groenenberg, 2007; Ofwegen, 2020). Although this grouping has received high statistical support, their morphological complexity is reflected in the resulting phylogeny. Exceptions were the genera Capnella, Lemnalia, Paralemnalia, Eunephthya, and Gersemia, in which morphology classifications correspond to well-supported molecular clades (e.g., McFadden et al., 2014).

In their nephtheid molecular analysis, Ofwegen & Groenenberg (2007) found two main clades: (I) Chromonephthea/Stereonephthya; and (II) Nephthea/Litophyton. As a result, Litophyton and Nephthea were later merged (Ofwegen, 2016; Ofwegen, 2020). Although our results corroborate that Nephthya savignyi Ehrenberg (1834), the type species of Dendronephthya, belongs to Litophyton (Ofwegen & Groenenberg, 2007), most of the available Dendronephthya sequences falls as a sister group of their Clades I and II (Fig. 5), indicating that a further revision of Dendronephthya is also needed. Despite several uncertainties regarding the diagnostic morphological characters in nephtheids (Verseveldt, 1983; Ofwegen & Groenenberg, 2007), most of its genera appears to be well-resolved. The recalcitrant taxa are limited to some species in need of additional assessments, such as Neospongodes atlantica, which was recovered herein within a clade composed solely by Stereonephthya representatives (Fig. 5).

Overall, the distinction between Stereonephthya and Neospongodes is based on weak evidence: the presence of an accumulation of sclerites in the center of the stalk of the latter, called herein pseudoaxis (see Verseveldt, 1983; Ofwegen & Groenenberg, 2007). The nature of such an axis was already discussed in the literature and it is known to be convergent in Neospongodes, Scleronephthya, and in several Dendronephthya and Stereonephthya representatives (Verseveldt, 1983). In addition, colony shape is not a good generic diagnostic character (Ofwegen, 2016), as shown by Litophyton savignyi (=Nephthya savignyi). Thus, so far, the polyp armature along with its highly projecting supporting bundle, despite convergent in some genera, seems to be consistent in Stereonephthya and Neospongodes (Fig. 3; Fig. S1). The only uncertainty of such character remains on S. portoricensis, as Bayer (1961) illustrates it with projecting supporting bundles (Fig. S1), a feature reiterated by Verseveldt (1983) although no signs of it is seen in his detailed drawing of the antocodium (Fig. S1). Both Stereonephthya and Neospongodes share well-developed supporting bundles of the polyps with strong projecting tip; ventral side of the polyp stalk has small tiny rods; and strong dorsal points but ventral points poorly supported or lacking (Utinomi, 1954). Thus, based on the current molecular and morphological evidence, there are no reasons to keep both genera separated, as previously suggested by Ofwegen & Groenenberg (2007).

Octocoral forests and their extensive distribution

Our results fill a considerable gap in the distribution of N. atlantica along the Brazilian coast, especially in between the records from Ceará (3°26′S and 38°08′W) and Bahia states (∼12°S to ∼17°S, see Castro, Medeiros & Loiola (2010)). In this area, N. atlantica appears as a minor element in the shallow reef environments, especially in the Abrolhos regions (Laborel, 1969; Castro et al., 2005; Leão & Kikuchi, 2000). However, it forms dense aggregations on soft bottoms at mesophotic depths (Moura et al., 2013). These results contrast with the Indo-Pacific region, where the majority of shallow water nephtheids are associated with zooxanthellae (Litophyton, Lemnalia, Capnella, etc.) (Fabricius & Alderslade, 2001; Schubert, Brown & Rossi, 2017), and only a few such depth generalists are found below 25–30 m. Nonetheless, the symbiotic taxa of this family are also found in mesophotic depths, on both hard and soft substrates (e.g., Umbellulifera). Eastern nephteids may form either monospecific carpets or diverse aggregations with as many as 31 species per 600 m² (Bayer, 1961; Tursch & Tursch, 1982) and, in reef communities, they may total a biomass 10 times higher than that of scleractinian corals (Benayahu & Loya, 1987; Tursch & Tursch, 1982).

Despite being considered a typical reef species, the mesophotic OFs found in Brazil suggest that N. atlantica should be referred to as a soft-bottom species, as its occurrence in reefs is restricted to reef-sand interfaces and reef-walls influenced by the amount of suitable habitat (soft bottom) around them, as recorded for the Cabeço and Timbebas Reef (Fig. 2). Such a behavior is shared by other nephtheid genera such as Dendronephthya and Umbellulifera, both considered typical sand dwellers (Fabricius & Alderslade, 2001).

Although inhabiting the photic zone, N. atlantica is an azooxanthellate species that, similarly to the Indo-Pacific Dendronephthya and Stereonephthya (see Fabricius & McCorry, 2006; Ofwegen & Groenenberg, 2007), appears to have a preference for low-light exposition. Whereas light availability limits the occurrence of the majority of Indo-Pacific zooxanthellate soft-corals to shallow and well-lit depths Tursch & Tursch, 1982), N. atlantica forms aggregations to up to 95 m deep (Pérez, Neves & Oliveira, 2011). In terms of substrate, based on data available from museum samples and the Abrolhos stations from Moura et al. (2013), N. atlantica appears to have a preference for sandy bottoms with high CaCO3 and moderate silt/mud concentrations. Given its success in such substrata, reef communities close to sediment discharges (e.g., dredging or river discharges) should be carefully monitored. In that context, most areas modeled as PSH for N. atlantica were found at the northernmost and southernmost limits of the Brazilian Continental Shelf, where no record of the species are yet known but great quantities of sand, silt, and mud dischargers occur from the Amazon and La Plata rivers respectively. Although these unknown occurrence areas might be considered as an accurate representation of the spatial extent that provides habitable conditions for the targeted species (Peterson, Papeş & Soberón, 2008), the MOP analysis indicated that most of the PH in those areas point to the risk of high extrapolation. Such areas have values outside the climatic range of the calibration area (see Raghavan et al., 2019) and, therefore, caution is required when assessing the probability of N. atlantica occurrence in these areas.

Taking into consideration that (i) morphological differentiation between Neospongodes and Stereonephthya (if it really exists) is yet to be proposed, (ii) N. atlantica is molecularly identical to Indo-Pacific Stereonephthya, and (iii) N. atlantica is the only representative of the family in the Southwestern Atlantic (Chromonephthea braziliensis has been reported as non-indigenous (NIS) in Brazil (see Ofwegen (2005))), we consider it inappropriate to keep both genera separated. Therefore, according to the International Code of Zoological Nomenclature, all species names currently associated with Stereonephthya should be moved to Neospongodes, as the latter has date priority in relation to the former. Unfortunately, the data presented herein suggest that N. atlantica was probably introduced in the Southwestern Atlantic as earlier as 1903 (i.e., the year of its description) either by Portuguese or Dutch vessels transiting within the marine trade routes (Ebert, 2003; see also Morandini et al., 2017). Otherwise, the alternative hypothesis would be a common origin shared with Stereonephthya portoricensis, a species found in mesophotic to deep Caribbean waters (Cairns, 2017) in a previous Atlantic-Pacific-split scenario. To test these hypotheses, it would be necessary to sequence S. portoricensis, which is unavailable at this moment.

Considering the hypothesis that N. atlantica is a NIS is alarming, even though it would not be the first long-hidden introduced species into Brazilian waters. For example, the once thought native octocoral Carijoa riisei and the bivalve Perna perna have been suggested to be introduced a long time ago (Grigg, 2003; Concepción et al., 2010; Pierri, Fossari & Magalhães, 2016; Galván-Villa & Ríos-Jara, 2018; Lima et al., 2018), even though there is not a consensus in the case of the bivalve (Calazans et al., 2021). Some of the problems of NIS are related to the fact that they can become invasive, altering the ecosystem function and, therefore, causing biodiversity loss and economic impacts (Bax et al., 2003; Chakraborty, 2019; Carpinelli et al., 2020). In the case of N. atlantica, its populations have apparently increased recently on soft (as previous expeditions did not report it) and hard-substrate. Nonetheless, as most of the records presented herein are from mesophotic depths (see Table S2), its spread along the Brazilian continental shelf remained mostly unnoticed. In our field observations, it was found to cause tissue necrosis in one of the main reef-building scleractinian species in Brazil, the great-star-coral Montastraea cavernosa (Fig. 2), a species that is abundant at mesophotic depths (Francini-Filho et al., 2019). Many soft corals, including nephtheids, bear diverse secondary metabolites, which makes them unpalatable, as well as strong spatial competitors (Tursch, 1982; Sammarco, La Barre & Coll, 1987; Allam et al., 2021). Terpenoids either in tissue or in the surrounding water make these soft-corals superior competitors even without direct contact with other organisms (allelopathy), such as scleractinian corals (Coll et al., 1982; Fabricius, 1997). For example, an invasive xeniid octocoral has invaded the Venezuelan Caribbean and, more recently, its abundance has surpassed that of all other benthic taxa in that region (Ruiz-Allais, Benayahu & Lasso-Alcalá, 2021). Invasive xeniids and other non-indigenous octocoral species from other families have also been reported in Brazil (Mantelatto et al., 2018; Carpinelli et al., 2020; Menezes et al., 2021), raising concerns on the fate of invaded localities biodiversity and, consequently, ecosystem function. Therefore, we recommend that populations of N. atlantica should be monitored in order to keep track of its spread and eventual invasiveness in Brazilian marine environments, along with other recently aquarium-introduced octocorals (Mantelatto et al., 2018; Carpinelli et al., 2020).

Additional Information and Declarations

Competing Interests

Leonardo HU Monteiro is employed by Grupo Sandmine & Inframar. The authors declare there are no competing interests.

Author Contributions

Ralf T.S. Cordeiro conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Ágatha Nascimento Carpinelli conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Ronaldo B. Francini-Filho performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Barbara de Moura Neves performed the experiments, analyzed the data, authored or reviewed drafts of the article, and approved the final draft.

Carlos D. Pérez analyzed the data, authored or reviewed drafts of the article, and approved the final draft.

Umberto de Oliveira conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Paulo Sumida performed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Henrique Maranhão performed the experiments, authored or reviewed drafts of the article, and approved the final draft.

Leonardo H.U. Monteiro performed the experiments, analyzed the data, authored or reviewed drafts of the article, and approved the final draft.

Pedro Carneiro performed the experiments, analyzed the data, authored or reviewed drafts of the article, and approved the final draft.

Marcelo V. Kitahara conceived and designed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft.

Field Study Permissions

The following information was supplied relating to field study approvals (i.e., approving body and any reference numbers):

ICMBio approved the study (SISBIO 15691-1, SISBIO-11709-1).

DNA Deposition

The following information was supplied regarding the deposition of DNA sequences:

The sequences are available in the Supplementary Files and at Genbank: OL684635, OL684634, OL684632 and OL684633.

Data Availability

The following information was supplied regarding data availability:

The raw data are available in the Supplementary Files.

The in situ video records of soft coral beds are available at figshare: Cordeiro, Ralf; Carpinelli, Ágatha; Francini-filho, Ronaldo; Neves, Bárbara; Pérez, Carlos; Oliveira, Umberto; et al. (2022): Supplemental Video 1. figshare. Media. https://doi.org/10.6084/m9.figshare.21534636.v2.

Cordeiro, Ralf; Carpinelli, Ágatha; Francini-filho, Ronaldo; de Moura Neves, Bárbara; Pérez, Carlos Daniel; Oliveira, Umberto; et al. (2022): Supplemental Video 2. figshare. Media. https://doi.org/10.6084/m9.figshare.21539517.v2.

Cordeiro, Ralf; Carpinelli, Ágatha; Francini-filho, Ronaldo; de Moura Neves, Bárbara; Pérez, Carlos Daniel; de Oliveira, Umberto Diego Rodrigues; et al. (2022): Supplemental Video 3. figshare. Media. https://doi.org/10.6084/m9.figshare.21539613.v1.

Funding

The present study was funded by the São Paulo Research Foundation (FAPESP #2014/01332-0 and #2018/13554-8), the National Research Council (CNPq #301436/2018-5) and the Pernambuco Research Foundation (FACEPE Proc. No APQ-0522-2.04/19 and APQ-0913-2.04/17). Additional grants were provided by CNPq/MCTI/FACEPE/PROTAX No001/2015 and 440633/2015, MCTI/CNPq/FAPs No 34/2012, and Coordination of Superior Level Staff Improvement –CAPES (process number 88887.485211/2020-00). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

Allam K, Khedr A, Allam A, Abdelkader M, Elkhayat E, Fouad M. 2021. Chemical and biological diversity in Nephthea soft corals in the current decade: a review. Journal of advanced Biomedical and Pharmaceutical Sciences 4(3):124-133

Anderson RP, Raza A. 2010. The effect of the extent of the study region on GIS models of species geographic distributions and estimates of niche evolution: preliminary tests with montane rodents (genus Nephelomys) in Venezuela. Journal of Biogeography 37:1378-1393

Assis J, Tyberghein L, Bosch S, Verbruggen H, Serrão EA, De Clerck O. 2018. Bio-ORACLE v2.0: Extending marine data layers for bioclimatic modelling. Global Ecology and Biogeography 27:277-284

Aued AW, Smith F, Quimbayo JP, Cândido DV, Longo GO, Ferreira CEL, Witman JD, Floeter SR, Segal B. 2018. Large-scale patterns of benthic marine communities in the Brazilian Province. PLOS ONE 13:e0198452

Barve N, Barve V. 2013. ENMGadgets: tools for pre and post processing in ENM workflows.

Barve N, Barve V, Jiménez-Valverde A, Lira-Noriega A, Maher SP, Peterson AT, Soberón J, Villalobos F. 2011. The crucial role of the accessible area in ecological niche modeling and species distribution modeling. Ecological Modelling 222:1810-1819

Bax N, Williamson A, Aguero M, Gonzalez E, Geeves W. 2003. Marine invasive alien species: a threat to global biodiversity. Marine Policy 27:313-323

Bayer FM. 1961. The shallow-water Octocorallia of the West Indian region. Studies on the Fauna of Curaçao and other Caribbean Islands 12:1-373

Bayer FM, Grasshoff M, Verseveldt J. 1983. Illustrated trilingual glossary of morphological and anatomical terms applied to Octocorallia. Brill Archive 1-75

Benayahu Y, Loya Y. 1987. Long-term recruitment of soft-corals (Octocorallia: Alcyonacea) on artificial substrata at Eilat (Red Sea) Marine Ecology Progress Series 8:161-167

Brown DK, Penkler DL, Amamuddy OSheik, Ross C, Atilgan AR, Atilgan C, Ö TastanBishop. 2017. MD-TASK: a software suite for analyzing molecular dynamics trajectories. Bioinformatics 33:2768-2771

Brugler MR, France SC. 2008. The mitochondrial genome of a deep-sea bamboo coral (Cnidaria, Anthozoa, Octocorallia, Isididae): genome structure and putative origins of replication are not conserved among octocorals. Journal of Molecular Evolution 67:125-136

Buhl-Mortensen L, Vanreusel A, Gooday AJ, Levin LA, Priede IG, Buhl-Mortensen P, Gheerardyn H, King NJ, Raes M. 2010. Biological structures as a source of habitat heterogeneity and biodiversity on the deep ocean margins. Marine Ecololgy 31:21-50

Cairns SD. 2017. Deep-sea coral taxa in the US Caribbean region: depth and geographical distribution. 1:1-8

Cairns SD, Bayer FM. 2009. Octocorallia (Cnidaria) of the Gulf of Mexico. In: Felder DL, Camp DK, eds. Gulf of Mexico-origins, waters, and biota. Biodiversity. College Station: Texas A & M University Press. 321-331

Cairns SD, Wirshing HH. 2015. Phylogenetic reconstruction of scleraxonian octocorals supports the resurrection of the family Spongiodermidae (Cnidaria, Alcyonacea) Invertebrate Systematics 29:345-368

Capel KC, López C, Moltó-Martín I, Zilberberg C, Creed JC, Knapp IS, Hernández M, Forsman ZH, Toonen RJ, Kitahara MV. 2020. Atlantia, a new genus of Dendrophylliidae (Cnidaria, Anthozoa, Scleractinia) from the eastern Atlantic. PeerJ 8:e8633

Carpinelli ÁN, Cordeiro RTS, Neves LM, RL DM, Kitahara MV. 2020. Erythropodium caribaeorum (Duchassaing and Michelotti, 1860) (Cnidaria: Alcyonacea), an additional alien coral in the Southwestern Atlantic. Zootaxa 4822:175-190

Cassola GE, Pacheco MSC, Barbosa MC, Hansen DM, Ferreira CEL. 2016. Decline in abundance and health state of an Atlantic subtropical gorgonian population. Marine Pollution Bulletin 104:329-334

Castro C, Medeiros M, Loiola L. 2010. Octocorallia (Cnidaria: Anthozoa) from Brazilian reefs. Journal of Natural History 44:763-827

Castro CB, Pires DO. 2001. Brazilian coral reefs: what we already know and what is still missing. Bulletin of Marine Science 69:357-371

Castro CB, Segal B, Pires DO, Medeiros MS. 2005. Distribution and diversity of coral communities in the Abrolhos reef complex, Brazil. In: Dutra GF, Allen GR, Werner T, McKenna SA, eds. A rapid marine biodiversity assessment of the Abrolhos Bank, Bahia, Brazil. RAP Bulletin of Biological Assessment. Washington D.C.: Conservation International. 38:19-39

Chakraborty SK. 2019. Bioinvasion and environmental perturbation: synergistic impact on coastal–Mangrove Ecosystems of West Bengal, India. Impacts of Invasive Species on Coastal Environments 29:71-245

Chanmethakul T, Chansang H, Watanasit S. 2010. Soft Coral (Cnidaria: Alcyonacea) distribution patterns in Thai Waters. Zoological Studies 49(1):72-84

Cobos ME, Peterson AT, Osorio-Olvera L, Jiménez-García D. 2019. An exhaustive analysis of heuristic methods for variable selection in ecological niche modeling and species distribution modeling. Ecological Informatics 53:100983

Coll JC, Bowden BF, Tapiolassk DM, Dunlap WC. 1982. In situ isolation of allelochemicals released from soft corals (Coelenterata: Octocorallia): a totally submersible sampling apparatus. Journal of Experimental Marine Biology and Ecology 60:293-299

Concepción G, Kahng S, Crepeau M, Franklin E, Coles S, Toonen R. 2010. Resolving natural ranges and marine invasions in a globally distributed octocoral (genus Carijoa) Marine Ecology Progress Series 401:113-127

Cordeiro R, McFadden C, vanOfwegen L, Williams G. 2021. World List of Octocorallia. Neospongodes Kükenthal, 1903. World Register of Marine Species

Cordeiro RTS, Neves BM, Rosa-Filho JS, Perez CD. 2015. Mesophotic coral ecosystems occur offshore and north of the Amazon River. Bulletin of Marine Science 91:491-510

Creed JC, Fenner D, Sammarco P, Cairns S, Capel K, Junqueira AO, Cruz I, Miranda RJ, Carlos-Junior L, Mantelatto MC. 2017. The invasion of the azooxanthellate coral Tubastraea (Scleractinia: Dendrophylliidae) throughout the world: history, pathways and vectors. Biological Invasions 19:283-305

Darriba D, Taboada GL, Doallo R, Posada D. 2012. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9:772

Deichmann E. 1936. XLIX. The Alcyonaria of the western part of the Atlantic Ocean. Memoirs of the Museum of Comparative Zoology at Harvard College, LIII 53:1-317

Development Team. 2014. QGIS Geographic Information System. Open Source Geospatial Foundation Project.

Dutra GF, Allen GR, Werner T, McKenna SA. 2006a. A rapid marine biodiversity assessment of the Abrolhos Bank, Bahia, Brazil. Center for Applied Biodiversity Science 38:1-160

Ebert C. 2003. Chapter three: Dutch trade with Brazil before the Dutch West India Company, 1587-1621. In: Postma J, Enthoven V, eds. Riches from Atlantic Commerce - Dutch Transatlantic Trade and Shipping, 1585-1817, Series The Atlantic World. 1:49-75

Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32:1792-1797

Ehrenberg CG. 1834. Beiträge zur physiologischen Kenntniss der Corallenthiere im allgemeinen, und besonders des rothen Meeres, nebst einem Versuche zur physiologischen Systematik derselben. Berlin: Abhandlungen der Königlichen Akademie der Wissenschaften. 1:225-380 . https://www.biodiversitylibrary.org/page/29725862

Epifanio RDA, Martins DL, Villaça R, Gabriel R. 1999. Chemical defenses against fish predation in three Brazilian octocorals: 11 β, 12 β-epoxypukalide as a feeding deterrent in Phyllogorgia dilatata. Journal of Chemical Ecology 25(10):2255-2265

Fabricius KE. 1997. Soft coral abundance on the central Great Barrier Reef: effects of Acanthaster planci, space availability, and aspects of the physical environment. Coral Reefs 16:159-167

Fabricius KE, Alderslade P. 2001. Soft corals and sea fans: a comprehensive guide to the tropical shallow-water genera of the Central West-Pacific, the Indian Ocean and the Red Sea. Townsville: Australian Institute of Marine Science. 264

Fabricius KE, McCorry D. 2006. Changes in octocoral communities and benthic cover along a water quality gradient in the reefs of Hong Kong. Marine Pollution Bulletin 52:22-33

Ferreira CEL, Junqueira A de O R, Villac MC, Lopes RM. 2009. Marine bioinvasions in the Brazilian coast: brief report on history of events, vectors, ecology, impacts and management of non-indigenous species. Biological Invasions in Marine Ecosystems 204:459-477

Ficetola GF, Rondinini C, Bonardi A, Katariya V, Padoa-Schioppa E, Angulo A. 2014. An evaluation of the robustness of global amphibian range maps. Journal of Biogeography 41:211-221

Fleury BG, Lages BG, Barbosa JP, Kaiser CR, Pinto AC. 2008. New hemiketal steroid from the introduced soft coral Chromonephthea braziliensis is a chemical defense against predatory fishes. Journal of Chemical Ecology 34:987-993

Forskål P. 1775. Descriptiones Animalium, Avium, Amphibiorum, Piscium, Insectorum, Vermium; quae in Itinere Orientali Observavit Petrus Forskål. In: Post Mortem Auctoris editit Carsten Niebuhr. Mölleri, Hafniae: Adjuncta est materia Medica Kahirina. 19, xxxiv 164 pp

France SC, Hoover LL. 2002. DNA sequences of the mitochondrial COI gene have low levels of divergence among deep-sea octocorals (Cnidaria: Anthozoa) Hydrobiologia 471:149-155

Francini-Filho RB, Asp NE, Siegle E, Hocevar J, Lowyck K, D’Avila N, Vasconcelos AA, Baitelo R, Rezende CE, Omachi CY, Thompson CC, Thompson FL+2 more. 2018. Perspectives on the Great Amazon Reef: extension, biodiversity, and threats. Frontiers in Marine Science 5:1-5

Francini-Filho RB, Coni EOC, Meirelles PM, Amado-Filho GM, Thompson FL, Pereira-Filho GH, Bastos AC, Abrantes DP, Ferreira CM, Gibran FZ, Güth AZ, Sumida PYG, Oliveira NL, Kaufman L, Minte-Vera CV, Moura RL+6 more. 2013. Dynamics of Coral Reef Benthic Assemblages of the Abrolhos Bank, Eastern Brazil: inferences on natural and anthropogenic drivers. PLOS ONE 8:e54260

Francini-Filho RB, Cordeiro MC, Omachi CY, Rocha AM, Bahiense L, Garcia GD, Tschoeke D, de Almeida MG, Rangel TP, De Oliveira BCV, de Almeida DQ+1 more. 2019. Remote sensing, isotopic composition and metagenomics analyses revealed Doce River ore plume reached the southern Abrolhos Bank Reefs. Science of The Total Environment 697:134038

Fulgêncio-Lima LG, Andrade AFA, Vilela B, Lima-Júnir DP, Souza RA, Sgarbi LF, Simião Ferreira J, De Marco P, Silva DP. 2021. Invasive plants in Brazil: climate change effects and detection of suitable areas within conservation units. Biological Invasions 23:1577-1594

Galván-Villa CM, Ríos-Jara E. 2018. First detection of the alien snowflake coral Carijoa riisei (Duchassaing and Michelotti, 1860) (Cnidaria: Alcyonacea) in the port of Manzanillo in the Mexican Pacific. Bioinvasions Records 7:1-6

Grigg R. 2003. Invasion of a deep black coral bed by an alien species, Carijoa riisei, off Maui, Hawaii. Coral Reefs 22:121-122

Halàsz A, Reynolds AM, McFadden CS, Toonen RJ, Benayahu Y. 2015. Could polyp pulsation be the key to species boundaries in the genus Ovabunda (Octocorallia: Alcyonacea: Xeniidae)? Hydrobiologia 759:95-107

Hargitt CW, Rogers CG. 1901. The Alcyonaria of Porto Rico. Bulletin of the United States Fish Commission 20:265-287

Herrera S, Baco A, Sánchez JA. 2010. Molecular systematics of the bubblegum coral genera (Paragorgiidae, Octocorallia) and description of a new deep-sea species. Molecular Phylogenetics and Evolution 55:123-135

Imahara Y, Yamamoto H, Takaoka H, Nonaka M. 2017. First records of four soft coral species from Japan, with a list of soft corals previously found from the shallow waters of the Ryukyu Archipelago, Japan, and an overview on the systematics of the genera Siphonogorgia and Chironephthya. Fauna Ryukyuana 38:1-30

Janes MP, Mary AG. 2012. Synopsis of the family Xeniidae (Cnidaria: Octocorallia): status and trends. In: Proceedings of the 12th international coral reef symposium. 19-13

Kükenthal W. 1903. Ueber eine neue Nephthyidengattung aus dem südatlantischen Ocean. Zoologischer Anzeiger 26:272-275

Kükenthal W. 1905. Versuch einer Revision der Alcyonarien. II. Die Familie der Nephthyiden. 2. Teil. Die Gattungen Dendronephthya n.g. und Stereonephthya n.g. Zoologische Jahrbucher 21:503-726 plates 26-32 . https://biodiversitylibrary.org/page/27519836

Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35:1547-1549

Laborel J. 1969. Madréporaires et hydrocoralliairesrécifaux dês cotes brésiliennes, Systématique, écologie, répartitionverticale et géographie. Annales de l’Institut Océanographique 47:171-229

Lasker HR, Bramanti L, Tsounis G, Edmunds PJ. 2020. Chapter thirteen - the rise of octocoral forests on Caribbean reefs. Advances in Marine Biology 87(1):361-410

Leão ZMAN, Kikuchi RKP. 2000. The Abrolhos Reefs of Brazil. In: Seeliger U, Björn K, eds. Coastal Marine Ecosystems of Latin America. Berlin: Springer-Verlag. 83-96

Leão ZMAN, Kikuchi RKP, Ferreira BP, Neves EG, Sovierzoski HH, Oliveira MDM, Maida M, Correia MD, Johnsson R. 2016. Brazilian coral reefs in a period of global change: a synthesis. Brazilian Journal of Oceanography 64:97-116

Leão ZMAN, Kikuchi RKP, Testa V. 2003. Corals and coral reefs of Brazil. In: Cortés J, ed. Latin American coral reefs. Amsterdam: Elsevier Science B.V. 9-52

Lima LA, Migliolo L, Castro CB, Pires DO, López-Abarrategui C, Goncalves EF, Dias SC. 2013. Identification of a novel antimicrobial peptide from Brazilian coast coral Phyllogorgia dilatata. Protein and Peptide Letters 20:11531158

Lima LB, Oliveira FJM, Giacomini HC, Lima-Junior DP. 2018. Expansion of aquaculture parks and the increasing risk of non-native species invasions in Brazil. Reviews in Aquaculture 10:111-122

Liu C, White M, Newell G. 2013. Selecting thresholds for the prediction of species occurrence with presence-only data. Journal of Biogeography 40:778-789

Machado-Stredel F, Cobos ME, Peterson A. 2021. A simulation-based method for selecting calibration areas for ecological niche models and species distribution models. Frontiers of Biogeography 13(4):e48814

Madeira F, Park YM, Lee J, Buso N, Gur T, Madhusoodanan N, Basutkar P, Tivey AR, Potter SC, Finn RD. 2019. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Research 47:W636-W641

Magalhães GM, Amado-Filho GM, Rosa MR, Moura RL, Brasileiro PS, Moraes FC, Francini-Filho RB, Pereira-Filho GH. 2015. Changes in benthic communities along a 0–60 m depth gradient in the remote St. Peter and St. Paul Archipelago (Mid-Atlantic Ridge, Brazil) Bulletin of Marine Science 91:377-396

Mantelatto MC, Silva AG, Louzada TS, McFadden CS, Creed JC. 2018. Invasion of aquarium origin soft corals on a tropical rocky reef in the southwest Atlantic, Brazil. Marine Pollution Bulletin 130:89-94

McFadden CS, Brown A, Brayton C, Hunt C, van Ofwegen L. 2014. Application of DNA barcoding in biodiversity studies of shallow-water octocorals: molecular proxies agree with morphological estimates of species richness in Palau. Coral Reefs 33:275-286

McFadden CS, France SC, Sánchez JA, Alderslade P. 2006. A molecular phylogenetic analysis of the Octocorallia (Cnidaria: Anthozoa) based on mitochondrial protein-coding sequences. Molecular Phylogenetics and Evolution 41:513-527

McFadden CS, van Ofwegen LP. 2013. A second, cryptic species of the soft coral genus Incrustatus (Anthozoa: Octocorallia: Clavulariidae) from Tierra del Fuego, Argentina, revealed by DNA barcoding. Helgoland Marine Research 67:137-147

Menezes N, McFadden C, Miranda R, Nunes J, Lolis L, Barros F, Pinto T. 2021. New non-native ornamental octocorals threatening a South-west Atlantic reef. Journal of the Marine Biological Association of the United Kingdom 101(6):911-917

Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: Proceedings of the gateway computing environments workshop (GCE). 1-8

Miranda LM, Marques AC. 2016. Hidden impacts of the Samarco mining waste dam collapse to Brazilian marine fauna - an example from the staurozoans (Cnidaria) Biota Neotropica 16:e20160169

Morandini AC, Stampar SN, Maronna MM, Silveira FL. 2017. All non-indigenous species were introduced recently? The case study of Cassiopea (Cnidaria: Scyphozoa) in Brazilian waters. Journal of the Marine Biological Association of the United Kingdom 97(2):321-328

Moura RL, Amado-Filho GM, Moraes FC, Brasileiro PS, Salomon PS, Mahiques MM, Bastos AC, Almeida MG, Silva JM, Araujo BF, Brito FP+1 more. 2016. An extensive reef system at the Amazon River mouth. Science Advances 2:e1501252

Moura RL, Secchin NA, Amado-Filho GM, Francini-Filho RB, Freitas MO, Minte-Vera CV, Teixeira JB, Thompson FL, Dutra GF, Sumida PYG, Guth AZ, Lopes RM, Bastos AC+3 more. 2013. Spatial patterns of benthic megahabitats and conservation planning in the Abrolhos Bank. Cont Shelf Res 70:109-117

Nelson H, Bramanti L. 2020. From trees to Octocorals: the role of self-thinning and shading in underwater animal forests. In: Rossi S, Bramanti L, eds. Perspectives on the marine animal forests of the world. Cham: Springer.

Nuñez Penichet C, Osorio-Olvera L, Gonzalez VH, Cobos ME, Jiménez L, DeRaad DA, Alkishe A, Contreras-Díaz RG, Nava-Bolaños A, Utsumi K, Ashraf U, Adeboje A, Peterson AT, Soberon J+4 more. 2021. Geographic potential of the world’s largest hornet, Vespa mandarinia Smith (Hymenoptera: Vespidae), worldwide and particularly in North America. PeerJ 9:e10690

Ofwegen LP. 2005. A new genus of nephtheid soft corals (Octocorallia: Alcyonacea: Nephtheidae) from the Indo-Pacific. National Natuurhistorisch Museum 79:1-236

Ofwegen LP. 2007. Towards a revision of the nephtheidae (Coelenterata: Octocorallia) 4764:1-288

Ofwegen LP. 2016. The genus Litophyton (Forskål, 1775) (Octocorallia, Alcyonacea, Nephtheidae) in the Red Sea and the western Indian Ocean. ZooKeys 1-128

Ofwegen LP. 2020. The genus Litophyton (Forskål, 1775) (Octocorallia: Alcyonacea: Nephtheidae) from Australia. Zootaxa 4764

Ofwegen L, Groenenberg D. 2007. A centuries old problem in nephtheid taxonomy approached using DNA data (Coelenterata: Alcyonacea) Contributions to Zoology 76:153-178

Owens HL, Campbell LP, Dornak LL, Saupe EE, Barve N, Soberón J, Ingenloff K, Lira-Noriega A, Hensz CM, Myers CE. 2013. Constraints on interpretation of ecological niche models by limited environmental ranges on calibration areas. Ecological Modelling 263:10-18

Pearson RG, Raxworthy CJ, Nakamura M, Townsend Peterson A. 2007. Predicting species distributions from small numbers of occurrence records: a test case using cryptic geckos in Madagascar. Journal of Biogeography 34:102-117

Pérez CD, de Moura Neves B, Cordeiro RT, Williams GC, Cairns SD. 2016. Diversity and distribution of Octocorallia. The Cnidaria, Past, Present and Future 109-123

Pérez CD, Neves BM, Oliveira DH. 2011. New records of octocorals (Cnidaria: Anthozoa) from the Brazilian coast. Aquatic Biology 13:203-214

Peterson AT, Papeş M, Soberón J. 2008. Rethinking receiver operating characteristic analysis applications in ecological niche modeling. Ecological Modelling 213:63-72

Phillips SJ. 2005. A brief tutorial on Maxent. AT & T Research 190:231-259

Picciani N, Seiblitz IGL, Paiva PC, Castro CB, Zilberberg C. 2016. Geographic patterns of Symbiodinium diversity associated with the coral Mussismilia hispida (Cnidaria, Scleractinia) correlate with major reef regions in the Southwestern Atlantic Ocean. Marine Biology 163:236

Pierri B, Fossari T, Magalhães A. 2016. The brown mussel Perna perna in Brazil: native or exotic? Arquivo Brasileiro de Medicina Veterinária e Zootecnia 68:404-414

Pinheiro H, Bernardi G, Simon T, Joyeux JC, Macieira RM, Gasparini JL, Rocha C, Rocha LA. 2017. Island biogeography of marine organisms. Nature 549:82-85

Raghavan RK, Peterson AT, Cobos ME, Ganta R, Foley D. 2019. Current and future distribution of the lone star tick, Amblyomma americanum (L.)(Acari: Ixodidae) in North America. PLOS ONE 14:e0209082

Roberts JM, Wheeler AJ, Freiwald A. 2006. Reefs of the deep: the biology and geology of cold-water coral ecosystems. Science 312:543-547

Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572-1574

Ruiz-Allais JP, Benayahu Y, Lasso-Alcalá OM. 2021. The invasive octocoral Unomia stolonifera (Alcyonacea, Xeniidae) is dominating the benthos in the Southeastern Caribbean Sea. Memoria de la Fundación La Salle de Ciencias Naturales 187:63-80

Sammarco PW, La Barre S, Coll JC. 1987. Defensive strategies of soft corals (Coelenterata: Octocorallia) of the Great Barrier Reef. Oecologia 74:93-101

Sánchez JA, Lasker HR, Taylor DJ. 2003. Phylogenetic analyses among octocorals (Cnidaria): mitochondrial and nuclear DNA sequences (lsu-rRNA, 16S and ssu-rRNA, 18S) support two convergent clades of branching gorgonians. Molecular Phylogenetics and Evolution 29(1):31-42

Sánchez JA. 2016. Diversity and evolution of octocoral animal forests at both sides of tropical America. In: Marine animal forests. Cham: Springer.

Schubert N, Brown D, Rossi S. 2017. Symbiotic versus non-symbiotic octocorals: physiological and ecological implications. In: Marine animal forests. Cham: Springer.

Soares MO, Tavares TCL, Carneiro PBM. 2018. Mesophotic ecosystems: distribution, impacts and conservation in the South Atlantic. Diversity and Distributions 25(2):255-268

Soberón J, Peterson AT. 2005. Interpretation of models of fundamental ecological niches and species’ distributional areas.

Souza JN, Nunes FL, Zilberberg C, Sanchez JA, Migotto AE, Hoeksema BW, Serrano XM, Baker AC, Lindner A. 2017. Contrasting patterns of connectivity among endemic and widespread fire coral species (Millepora spp.) in the tropical Southwestern Atlantic. Coral Reefs 36:701-716

Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:1312-1313

Tanasovici RM, Kitahara MV, Dias GM. 2020. Invasive coral Tubastraea spp. population growth in artificial habitats and its consequences to the diversity of benthic organisms. Marine Biology 167:1-12

Tursch B. 1982. Chemical protection of a fish (Abudefduf leucogaster Bleeker) by a soft coral (Litophyton viridis May) Journal of Chemical Ecology 8:1421-1428

Tursch B, Tursch A. 1982. The soft coral community on a sheltered Reef Quadrat at Laing Island (Papua New Guinea) Marine Biology 68:321-332

Tyberghein L, Verbruggen H, Pauly K, Troupin C, Mineur F, De Clerck O. 2012. Bio-oracle: a global environmental dataset for marine species distribution modelling. Global Ecology and Biogeography 21:272-281

Utinomi H. 1954. Dendronephthya of Japan, II. New species and new records of Dendronephthya and the allied Stereonephthya from Kii region. Publications of the Seto Marine Biological Laboratory 3(3):319-338

Verseveldt J. 1983. The octocorallian genera Spongodes Lesson. Neospongodes Kükenthal and Stereonephthya Kükenthal. Beaufortia 33:1-13

Villesen P. 2007. FaBox: an online toolbox for fasta sequences. Molecular Ecology Notes 7:965-968

Warren DL, Glor RE, Turelli M. 2010. ENMTools: a toolbox for comparative studies of environmental niche models. Ecography 33:607-611

Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ. 2009. Jalview Version 2—a multiple sequence alignment editor and analysis workbench. Bioinformatics 25:1189-1191

Werner TB, Pinto LP, Dutra GF. 2000. Abrolhos 2000: conserving the Southern Atlantic’s richest coastal biodiversity into the next century. Coastal Management 28:99-108