1. Introduction
The periodontal ligament (PDL) is a connective tissue inserted into the root cementum on one side and into the alveolar bone on the other side of the periodontal gap that plays an integral part in maintaining periodontal tissue homeostasis. PDL cells are fibroblast-like cells characterized by collagen production but also possess some osteoblastic features [1]. Orthodontic tooth movement (OTM) involves the application of a mechanical force to a tooth by orthodontic appliances, forming tensile and pressure zones in the PDL [2]. OTM consequently leads to the participation of PDL cells in alveolar bone remodeling [3] but does not affect the periodontal and microbiological parameters [4]. Due to the numerous effects of vitamin D3, its supplementation has been targeted as a potential adjuvant therapeutic approach for orthodontic treatment. Several in vitro and in vivo studies have investigated the role of vitamin D on OTM in the past decades [5], suggesting that vitamin D can enhance tooth movement [6,7] and also increase the stability of tooth position after orthodontic treatment, preventing relapse [8].
Vitamin D3 binds to its intracellular receptor to exert its functions; this receptor is called the vitamin D receptor (VDR). The VDR is a member of the nuclear receptor superfamily of transcription factors. The VDR is well known due the fact that it mediates the biological effects of vitamin D3 [9]. The gene that encodes the VDR protein is located on chromosome 12 in humans, and has five promoters, eight coding exons, and six untranslated exons [10]. It is well known that the VDR presents many polymorphic regions [11,12] such as single-nucleotide polymorphisms (SNPs). SNPs are DNA sequence variations that occur when a single nucleotide differs among members of a biological species or paired chromosomes in an individual. SNPs can influence the expression and/or functions of the VDR and have been explored in complex traits, including oral phenotypes, such as periodontal disease [13,14,15], external apical root resorption as a sequela of orthodontic treatment [16], developmental dental alterations [17,18,19,20,21], and malocclusion [22]. Some recent studies have also shown that vitamin D3 has an effect on the PDL. The studies also demonstrate that PDL cells express the VDR gene [23,24,25,26,27].
Additionally, our previous study [23] suggested that functional differences between genotypes in some SNPs in the VDR gene may affect mRNA expression of the VDR in hPDL fibroblasts under simulated OTM conditions in vitro. Therefore, in the present study, we decided to replicate our previous study in a larger sample and also to explore new SNPs in the VDR in order to unravel the role of genetic polymorphisms on VDR expression in periodontal fibroblasts during simulated orthodontic compressive force.
2. Results
Table 1 shows the genotyping success rate of each SNP; all of them were higher than 90%.
The relative mRNA VDR expression results according to the genotypes of the five studied SNPs—BglI (rs739837, G/T), BsmI (rs1544410, T/C), ApaI (rs7975232, A/C), FokI (rs2228570, A/G), and TaqI (rs731236, A/G)—in the VDR gene are shown in Table 2. VDR expression was not statistically significant different according to the genotypes. An association was not observed (p > 0.05).
The SNP–SNP interaction was evaluated through linear regression analysis. The regression analysis did not demonstrate any statistically significant difference. No association was observed (p > 0.05). These results are demonstrated in Table 3.
3. Discussion
OTM is a process in which the application of a force induces bone resorption (by osteoclasts) on the pressure side and bone apposition (new bone formation by osteoblasts) on the tension side of the periodontal ligament. Thus, the alveolar bone remodeling that follows the application of orthodontic forces is a well-coordinated process resulting from biological cascades of resorption and apposition caused by mechanical forces [28]. In the past years, several research groups have explored the factors involved in OTM in vivo, in vitro, in clinical studies, and in systematic reviews [29,30,31,32]. There are also research groups investigating oral microbiota [4] and natural substances in oral health [33].
It is well known that PDL fibroblasts react to the application of continuous mechanical orthodontic pressure to move teeth, with alterations in the expression of many important genes [32,34,35]. To mediate the activities of vitamin D, the nuclear transcription factor VDR binds sites in the DNA, stimulating the physiological regulation of several genes [36], including OTM-related genes. It is also known that the VDR is expressed in PDL cells [23,24,25,26,27]; thus, the influence of SNPs on the biologic activity of the VDR is worth studying. Therefore, in the present study we decided to explore the role of SNPs in different regions of the VDR gene on the mRNA expression of the VDR during simulated orthodontic comprehensive forces.
The human PDL cells used in our study are from healthy teeth of biologically unrelated individuals. The cells were obtained by allowing cells to grow out of periodontal ligament tissue from permanent teeth explants kept under growth-stimulating conditions [1]. This protocol has been used in numerous studies that evaluate OTM in vitro [23,32,34,35].
Multiple SNPs of the human VDR gene have been identified [37] and investigated in several conditions and phenotypes so far. In our study, we investigated five SNPs that were selected due to their minor allele frequency and potential relevance. It is important that this could be a limitation as we did not cover all the SNPs in different genes. rs2228570 (FokI) is the only missense SNP of the VDR. It is located in exon 2 and its base change generates a new initiation codon [25]. It is the only SNP that causes an actual difference in the structure of the VDR protein (methionine-to-threonine substitution) [38]. The influence of rs2228570 on transcriptional activation by the VDR is controversial. Some authors observed distinct functional differences between genotypes in rs2228570 [10,37,39], while others did not find differences in transcriptional activity among genotypes [40], including the study by Liu et al. [25], who did not observe a significant difference in human gingival fibroblasts and PDL cells, which is similar to our results. However, Liu et al. [26] observed that the homozygous GG genotype enhances RANKL expression and the RANKL/OPG ratio in human gingival fibroblasts and periodontal ligament cells, which could connect this SNP with differences in OTM in clinical practice. The RANKL/OPG ratio changes in the PDL under OTM pressure conditions [23,30,31,32]. PDL cells supplemented with vitamin D3 under simulated OTM conditions also downregulated the RANKL/OPG ratio [23].
The SNP rs731236 (TaqI) is also in the coding region of the VDR. The TaqI polymorphism is characterized by a single base transition that leads to a synonymous change at codon 352 in exon 9. Although this is a synonymous SNP, which does not cause a change in amino acid, we selected this SNP due its previous associations observed in the literature, including with periodontitis [15], attachment loss due to periodontal disease [13], and external apical root resorption during orthodontic treatment [16]. TaqI was also associated with increased transcriptional activity and a high serum level of vitamin D3 [12].
We also evaluated the SNP rs739837 (BgII), which is located in the 3′UTR of the VDR gene. This SNP was associated with a variety of conditions and phenotypes (NCBI), including periodontal disease [14] and molar incisor hypomineralization [17], and it was also suggested that it could be associated with VDR mRNA expression in PDL cells [23]. In the present study with a larger sample, we were not able to confirm that rs739837 is involved in VDR mRNA expression. The intronic SNP Apal (rs7975232) also presented a borderline association with VDR expression in the previous study [23], but this association was also not confirmed here. The other intronic SNP (BsmI, rs1544410) evaluated here was previously associated with clinical attachment loss due to periodontal disease [13]; however, in the present study, there was no association with VDR mRNA expression.
Although in the previous study the SNPs Apal and BgII were associated with VDR mRNA expression, it is important to emphasize that the previous study included samples of only nine patients in the genotyping analysis; it is possible that this exploratory investigation led to a type 1 error. In the current study, we evaluated samples from 57 patients. This larger sample presented an SNP frequency similar to that observed in the general population.
The increasing knowledge of the genetic factors affecting the biology of the orthodontic patient may improve the predictability and control of the direction and speed of OTM. To date, little research has been dedicated to exploring genetic factors that could influence gene expression during OTM. The identification of SNPs that can impact orthodontic treatment should receive attention from researchers.
4. Materials and Methods
4.1. Ethics Statement
The study protocol was approved by the institutional review board of the University of Regensburg, Germany (12-170-0150), and written informed consent was obtained from each participant in accordance with the Helsinki Declaration of 1975, as revised in 2013.
4.2. Sample Collection and In Vitro Compression Model for Orthodontic Tooth Movement
We collected human periodontal ligament (hPDL) from permanent teeth that were caries-free and without restorations. All teeth were extracted in a routine dental treatment at the maxillofacial surgery clinic at the University of Regensburg. If the patient had more than one tooth extracted, only one tooth per patient was selected.
A total of 57 hPDL samples (1 per patient) was used. The sample size was determined based on our previous study [23] to detect an expected mean difference of 0.7 with a power of 80% and a significance level of 5%, assuming a standard deviation of 0.6. The hPDL was collected, isolated, cultivated, and characterized according to a well-established protocol, previously published [22,34,35]. Briefly, tissue from hPDL samples were grown in 6-well cell culture plates until proliferation of adherently growing hPDL fibroblasts under normal cell culture conditions (37 °C, 5% CO2, water-saturated) in full media. The media consisted of DMEM high glucose (D5796, Sigma-Aldrich®, Munich, Germany), 10% FCS (P30–3306, PAN-Biotech, Aidenbach, Germany), 1% L-glutamine (SH30034.01, GE-Healthcare-Europe, Munich, Germany), 100 µM ascorbic acid (A8960, Sigma-Aldrich®, St. Louis, MO, USA), and 1% antibiotics/antimycotics (A5955, Sigma-Aldrich®). Fibroblasts were identified through their morphological spindle shape and the hPDL-specific marker gene, as previously reported and described in Kirschneck et al. in 2017 [34]. They were frozen in liquid nitrogen (90% FCS, 10% DMSO, freezing 1 °C/min) until use for further studies. For the cell culture experiments, pooled hPDL fibroblasts of the fifth passage were randomly seeded at a density of 2000 cells per mm2 onto 6-well cell culture plates. A physiological compressive strain (orthodontic force) of 2 g/cm2 using a sterile glass disc was applied for 48 h to simulate orthodontic tooth movement in pressure areas of the hPDL. This was performed under cell culture conditions at 70% confluency without changing the cell culture medium, according to published protocols [22,34,35]. Figure 1 shows the scheme of the in vitro experiment.
4.3. Total RNA Isolation and Quantification of Relative Gene Expression (RT-qPCR)
The RNA from hPDL fibroblasts was isolated using 1 mL peqGOLD TriFastTM (PEQLAB Biotechnology GmbH, Erlangen, Germany) following the instructions of the manufacturer. Total RNA was instantaneously cooled on ice. Total RNA amount and purity were photometrically measured at 280 nm, 260 nm, and 230 nm (NanoPhotometer N60, Implen, Munich, Germany). For the synthesis of the complementary DNA (cDNA), 500 ng of RNA per sample were transcribed with a Mastercycler® ep realplex-S thermocycler (Eppendorf AG, Hamburg, Germany).
To determine the relative expression of the VDR, a primer mix containing SYBR® Green JumpStart™ Taq ReadyMix™ (S4438, Sigma–Aldrich), the primer pairs, and 5.25 μL nuclease-free H2O (T143, Carl-Roth GmbH) were mixed with 1.5 μL cDNA per sample and a 96-well plate was used. RT-qPCR was performed in a realplex master cycler (Eppendorf AG, Hamburg, Germany). The VDR forward primer (5′-3′) was TAAGACCTACGACCCCA, and the reverse primer (5′-3′) was CTGGGAGTGTGTCTGGAGTTG. For normalization of the target gene, two previously established reference genes that are stable in hPDL fibroblasts were used [34]: RPL22 [forward primer (5′-3′) was TGATTGCACCCACCCTGTAG, and the reverse primer (5′-3′) was GGTTCCCAGCTTTTCCGTTC]; and PPIB [forward primer (5′-3′) was TGATTGCACCCACCCTGTAG, and the reverse primer (5′-3′) was GGTTCCCAGCTTTTCCGTTC]. The primers were designed according to MIQE quality guidelines using NCBI Primer-BLAST and additional software. Eurofins MWG Operon LLC (Huntsville, AL, USA; High Purity Salt Free Purification HPSF®) synthesized and purified the primers. A non-template control without cDNA was tested to evaluate primer dimers or contaminating DNA. The relative VDR expression was calculated as follows: 2−ΔCq with ΔCq = Cq (VDR) − Cq (mean RPL22/PPIB), divided by the respective arithmetic 2−ΔCq mean of the untreated samples.
4.4. DNA Extraction and Genotyping Analysis
The DNA of hPDL cell samples was isolated using the GenElute Mammalian Genomic DNA Miniprep kit (Sigma Aldrich, Munich, Germany). DNA extraction was performed according to the manufacturer’s instructions. For purity and quantification of the DNA, optical density was measured at 260 nm and 230 nm (NanoPhotometer N60, Implen, Munich, Germany). The OD260nm/280nm ratio > 1.8 indicated protein-free DNA.
A total of five SNPs in the VDR gene, which is located in 12q13.11, were selected based on their minor allele frequency (>10%) and their previously reported association. The SNPs’ characteristics are presented in Table 1. Genotyping was performed by real-time PCR using the TaqMan assay in the Mastercycler® ep realplex-S thermocycler (Eppendorf AG, Hamburg, Germany). The SNPs were blindly genotyped using TaqMan assay. PCR reactions were performed in a total final volume of 5 μL (2.5 μL Taqman genotyping master mix, 0.125 μL SNP assay; Applied Biosystems, Foster City, CA, and 4 ng DNA/reaction in water). Thermal cycling was performed by starting with a hold cycle of 95 °C for 10 min, followed by 40 amplification cycles of 92 °C for 15 s and 60 °C for 1 min.
4.5. Statistical Analysis
The software GraphPad Prism 8.0.1 (GraphPad Software Inc., San Diego, CA, USA) was used for statistical analyses. The Shapiro–Wilk test was used to assess the normality of the gene expression data and Levene’s test to determine homogeneity of variance across groups. A non-parametric Kruskal–Wallis test was used to evaluate significant differences between three or more groups. We used Kruskal–Wallis with Dunn’s multiple comparison test to compare the levels of VDR expression among the three genotypes of each SNP in the co-dominant model. The post hoc tests used were Dunn’s tests. A linear regression analysis was performed to evaluate SNP–SNP interaction. Statistical significance was established at 5% for all analyses (p < 0.05).
5. Conclusions
The SNPs BglI (rs739837), BsmI (rs1544410), ApaI (rs7975232), FokI (rs2228570), and TaqI (rs731236) did not show an impact on VDR gene expression in hPDL fibroblasts during simulated orthodontic compressive force. Further studies with larger samples and other SNPs in candidate genes are needed.
Writing—original draft preparation, E.C.K. and C.K.; data curation, E.C.K., C.K. and A.S.; supervision, A.S., P.P. and M.A.H.d.M.-O.; study design, E.C.K., G.T.J. and C.K.; funding support, C.K., E.C.K. and P.P.; investigation, E.C.K., A.S., M.B.C.R.d.O. and G.S.; review and editing, E.C.K., P.P., C.K., A.S., M.B.C.R.d.O., M.A.H.d.M.-O. and G.S. All authors have read and agreed to the published version of the manuscript.
The study was conducted in accordance with the Declaration of Helsinki 1975, revised in 2013, and approved by the Research Ethics Committee of the University of Regensburg, Germany (12-170-0150).
Informed consent was obtained from all subjects involved in the study.
Data are contained within the article or the
The authors want to thank Eva Zaglauer for providing technical assistance, as well as the Alexander von Humboldt Foundation and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—Brazil (CAPES).
We confirm that this manuscript has not been published elsewhere and is not under consideration in whole or in part by another journal. All authors have approved the manuscript and agree with submission to the International Journal of Molecular Sciences. The authors have no conflict of interest to declare.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Enlarge this image.Figure 1. Experimental design. A—Physiological control (no pressure). B—Simulated orthodontic compressive force of 2 g/cm2 applied by a 17.1 g glass disc (right side).
Characteristics of the SNPs and genotyping success rate of each SNP.
| SNP | Reference Sequence | # Base Change | # Gene Function and Location | * Genotyping Rate |
|---|---|---|---|---|
| BgII | rs739837 | G/T | 3 Prime UTR Variant | 54/57 (94.6%) |
| BsmI | rs1544410 | T/C | Intron Variant | 55/57 (96.5%) |
| Apal | rs7975232 | A/C | Intron Variant | 57/57 (100%) |
| FokI | rs2228570 | A/G | Missense Variant | 57/57 (100%) |
| TaqI | rs731236 | A/G | Synonymous Variant | 53/57 (92.9%) |
Note: * means PCR success amplification rate. #
VDR expression according to the genotypes.
| SNP | Genotype | n | Fold Change VDR Expression | p-Value | ||
|---|---|---|---|---|---|---|
| Median | 25th Percentile | 75th Percentile | ||||
| BgII | GG | 12 | 0.78 | 0.36 | 1.18 | 0.874 |
| GT | 27 | 0.74 | 0.52 | 1.16 | ||
| TT | 15 | 0.95 | 0.48 | 1.65 | ||
| BsmI | CC | 17 | 0.97 | 0.36 | 1.61 | 0.579 |
| CT | 34 | 0.68 | 0.54 | 1.12 | ||
| TT | 5 | 1.01 | 0.94 | 1.41 | ||
| Apal | AA | 14 | 0.84 | 0.54 | 1.42 | 0.844 |
| AC | 27 | 0.87 | 0.43 | 1.62 | ||
| CC | 16 | 0.65 | 0.45 | 1.17 | ||
| FokI | AA | 8 | 0.69 | 0.57 | 1.18 | 0.938 |
| AG | 25 | 0.87 | 0.41 | 1.22 | ||
| GG | 24 | 0.89 | 0.50 | 1.20 | ||
| TaqI | AA | 4 | 0.87 | 0.66 | 1.30 | 0.901 |
| AG | 39 | 0.80 | 0.48 | 1.97 | ||
| GG | 12 | 0.71 | 0.42 | 1.22 | ||
Note: Kruskal–Wallis test was used. No statistically significant differences were observed (p > 0.05).
Linear regression analysis to evaluate SNP–SNP interaction.
| Variable | Reference * | Estimate | Standard Error | 95% CI | t |
|---|---|---|---|---|---|
| BgII [GT] | GG | −1.33 | 1.50 | −4.37 to 1.71 | 0.88 |
| BgII [TT] | −1.40 | 1.71 | −4.85 to 2.05 | 0.81 | |
| BsmI [CT] | CC | −1.32 | 1.09 | −3.54 to 0.89 | 1.20 |
| BsmI [TT] | 0.36 | 2.05 | −3.77 to 4.51 | 0.17 | |
| Apal [AC] | CC | 0.18 | 1.25 | −2.36 to 2.72 | 0.14 |
| Apal [AA] | 0.56 | 1.66 | −2.79 to 3.92 | 0.33 | |
| FokI [AA] | AG | 0.01 | 1.27 | −2.55 to 2.59 | 0.01 |
| FokI [GG] | 0.67 | 1.03 | −1.41 to 2.76 | 0.65 | |
| TaqI [GG] | AA | 0.19 | 2.30 | −4.45 to 4.84 | 0.08 |
| TaqI [AG] | 1.55 | 2.10 | −2.70 to 5.80 | 0.73 |
Note: * genotypes used as a reference in the analysis. No statistically significant differences were observed (p > 0.05).
Supplementary Materials
The following supporting information can be downloaded at:
References
1. Jönsson, D.; Nebel, D.; Bratthall, G.; Nilsson, B.O. The human periodontal ligament cell: A fibroblast-like cell acting as an immune cell. J. Periodontal. Res.; 2011; 46, pp. 153-157. [DOI: https://dx.doi.org/10.1111/j.1600-0765.2010.01331.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21118418]
2. Meikle, M.C. The tissue, cellular, and molecular regulation of orthodontic tooth movement: 100 years after Carl Sandstedt. Eur. J. Orthod.; 2006; 28, pp. 221-240. [DOI: https://dx.doi.org/10.1093/ejo/cjl001] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16687469]
3. Li, Y.; Jacox, L.A.; Little, S.H.; Co, C.C. Orthodontic tooth movement: The biology and clinical implications. Kaohsiung J. Med. Sci.; 2018; 34, pp. 207-214. [DOI: https://dx.doi.org/10.1016/j.kjms.2018.01.007] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29655409]
4. Sfondrini, M.F.; Butera, A.; Michele, P.; Luccisano, C.; Ottini, B.; Sangalli, E.; Gallo, S.; Pascadopoli, M.; Gandini, P.; Scribante, A. Microbiological Changes during Orthodontic Aligner Therapy: A Prospective Clinical Trial. Appl. Sci.; 2021; 11, 6758. [DOI: https://dx.doi.org/10.3390/app11156758]
5. Almoammar, K. Vitamin D and orthodontics: An insight review. Clin. Cosmet. Investig. Dent.; 2018; 10, pp. 165-170. [DOI: https://dx.doi.org/10.2147/CCIDE.S157840]
6. Collins, M.K.; Sinclair, P.M. The local use of vitamin D to increase the rate of orthodontic tooth movement. Am. J. Orthod. Dentofac. Orthop.; 1988; 94, pp. 278-284. [DOI: https://dx.doi.org/10.1016/0889-5406(88)90052-2]
7. Kale, S.; Kocadereli, I.; Atilla, P.; Asan, E. Comparison of the effects of 1,25 dihydroxycholecalciferol and prostaglandin E2 on orthodontic tooth movement. Am. J. Orthod. Dentofac. Orthop.; 2004; 125, pp. 607-614. [DOI: https://dx.doi.org/10.1016/j.ajodo.2003.06.002]
8. Kawakami, M.; Takano-Yamamoto, T. Local injection of 1,25-dihydroxyvitamin D3 enhanced bone formation for tooth stabilization after experimental tooth movement in rats. J. Bone Miner. Metab.; 2004; 22, pp. 541-546. [DOI: https://dx.doi.org/10.1007/s00774-004-0521-3]
9. Van der Velden, U.; Kuzmanova, D.; Chapple, I.L.C. Micronutritional approaches to periodontal therapy. J. Clin. Periodontol.; 2011; 38, pp. 142-158. [DOI: https://dx.doi.org/10.1111/j.1600-051X.2010.01663.x]
10. Arai, H.; Miyamoto, K.; Taketani, Y.; Yamamoto, H.; Morita, K.; Tonai, T.; Nishisho, T.; Mori, S.; Takeda, E. A vitamin D receptor gene polymorphism in the translation initiation codon: Effect on protein activity and relation to bone mineral density in Japanese women. J. Bone Miner. Res.; 1997; 12, pp. 915-921. [DOI: https://dx.doi.org/10.1359/jbmr.1997.12.6.915]
11. Uitterlinden, A.G.; Fang, Y.; Van Meurs, J.B.; Pols, H.A.P.; Van Leeuwen, J.P.T.M. Genetics and biology of vitamin D receptor polymorphisms. Gene; 2004; 338, pp. 143-146. [DOI: https://dx.doi.org/10.1016/j.gene.2004.05.014] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/15315818]
12. Martelli, F.S.; Martelli, M.; Rosati, C.; Fanti, E. Vitamin D: Relevance in dental practice. Clin. Cases Miner. Bone Metab.; 2014; 11, pp. 15-19. [DOI: https://dx.doi.org/10.11138/ccmbm/2014.11.1.015] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25002874]
13. Brito Júnior, R.B.; Scarel-Caminaga, R.M.; Trevilatto, P.C.; Souza, A.P.; Barros, S.P. Polymorphisms in the vitamin D receptor gene are associated with periodontal disease. J. Periodontol.; 2004; 75, pp. 1090-1095. [DOI: https://dx.doi.org/10.1902/jop.2004.75.8.1090] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/15455736]
14. Tanaka, K.; Miyake, Y.; Hanioka, T.; Arakawa, M. VDR gene polymorphisms, interaction with smoking and risk of periodontal disease in Japanese women: The Kyushu Okinawa maternal and child health study. Scand. J. Immunol.; 2013; 78, pp. 371-377. [DOI: https://dx.doi.org/10.1111/sji.12095] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23841669]
15. Wang, C.; Zhao, H.; Xiao, L.; Xie, C.; Fan, W.; Sun, S.; Xie, B.; Zhang, J. Association between vitamin D receptor gene polymorphisms and severe chronic periodontitis in a Chinese population. J. Periodontol.; 2009; 80, pp. 603-608. [DOI: https://dx.doi.org/10.1902/jop.2009.080465]
16. Fontana, M.L.; de Souza, C.M.; Bernardino, J.F.; Hoette, F.; Hoette, M.L.; Thum, L.; Ozawa, T.O.; Capelozza Filho, L.; Olandoski, M.; Trevilatto, P.C. Association analysis of clinical aspects and vitamin D receptor gene polymorphism with external apical root resorption in orthodontic patients. Am. J. Orthod. Dentofac. Orthop.; 2012; 142, pp. 339-347. [DOI: https://dx.doi.org/10.1016/j.ajodo.2012.04.013]
17. Fatturi, A.L.; Menoncin, B.L.; Reyes, M.T.; Meger, M.; Scariot, R.; Brancher, J.A.; Kuchler, E.C.; Feltrin-Souza, J. The relationship between molar incisor hypomineralization, dental caries, socioeconomic factors, and polymorphisms in the vitamin D receptor gene: A population-based study. Clin. Oral Investig.; 2020; 24, pp. 3971-3980. [DOI: https://dx.doi.org/10.1007/s00784-020-03263-y]
18. Barbosa, M.C.F.; Lima, D.C.; Reis, C.L.B.; Reis, A.L.M.; Rigo, D.; Segato, R.A.B.; Storrer, C.L.M.; Küchler, E.C.; Oliveira, D.S.B. Vitamin D receptor FokI and BglI genetic polymorphisms, dental caries, and gingivitis. Int. J. Paediatr. Dent.; 2020; 30, pp. 642-649. [DOI: https://dx.doi.org/10.1111/ipd.12631]
19. Xavier, T.A.; Madalena, I.R.; Silva, R.A.B.; Silva, L.A.B.; Silva, M.J.B.; De Rossi, A.; Küchler, E.C.; Fukada, S.Y. Vitamin D deficiency is a risk factor for delayed tooth eruption associated with persistent primary tooth. Acta Odontol. Scand.; 2021; 79, pp. 600-605. [DOI: https://dx.doi.org/10.1080/00016357.2021.1918762]
20. Herrmann, S.; Küchler, E.C.; Reis, C.L.B.; Paddenberg, E.; Zbidat, N.; Mattos, N.H.R.; Schröder, A.; Proff, P.; Kirschneck, C. Association of third molar agenesis and microdontia with genetic polymorphisms in vitamin-D-related genes. Ann. Anat.; 2022; 20, 151972. [DOI: https://dx.doi.org/10.1016/j.aanat.2022.151972]
21. Küchler, E.C.; Carelli, J.; Morais, N.D.; Brancher, J.A.; Lopes, C.M.C.F.; Baratto-Filho, F.; Paddenberg, E.; Menezes, M.A.H.O.; Moro, A.; Kirschneck, C. Assessing the association between vitamin D receptor and dental age variability. Clin. Oral Investig.; 2022; 26, pp. 1677-1682. [DOI: https://dx.doi.org/10.1007/s00784-021-04140-y] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34463798]
22. Küchler, E.C.; Reis, C.L.B.; Marañón-Vásquez, G.; Nelson-Filho, P.; Matsumoto, M.A.N.; Stuani, M.B.S.; Oliveira, M.A.H.M.; Proff, P.; Kirschneck, C. Parathyroid hormone gene and genes involved in the maintenance of vitamin D levels association with mandibular retrognathism. J. Pers. Med.; 2021; 11, 369. [DOI: https://dx.doi.org/10.3390/jpm11050369] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34063310]
23. Küchler, E.C.; Schröder, A.; Teodoro, V.B.; Nazet, U.; Scariot, R.; Spanier, G.; Proff, P.; Kirschneck, C. The role of 25-hydroxyvitamin-D3 and vitamin D receptor gene in human periodontal ligament fibroblasts as response to orthodontic compressive strain: An in vitro study. BMC Oral Health; 2021; 21, 386. [DOI: https://dx.doi.org/10.1186/s12903-021-01740-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34362362]
24. Liu, K.; Meng, H.; Hou, J. Characterization of the autocrine/paracrine function of vitamin D in human gingival fibroblasts and periodontal ligament cells. PLoS ONE; 2012; 7, e39878. [DOI: https://dx.doi.org/10.1371/journal.pone.0039878] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22761920]
25. Liu, K.; Han, B.; Meng, H.; Hou, J. Influence of rs2228570 on transcriptional activation by the vitamin D receptor in human gingival fibroblasts and periodontal ligament cells. J. Periodontol.; 2017; 88, pp. 915-925. [DOI: https://dx.doi.org/10.1902/jop.2017.170030]
26. Liu, K.; Han, B.; Hou, J.; Meng, H. Preliminary investigation on the molecular mechanisms underlying the correlation between VDR-FokI genotype and periodontitis. J. Periodontol.; 2020; 91, pp. 403-412. [DOI: https://dx.doi.org/10.1002/JPER.19-0368]
27. Andrukhov, O.; Andrukhova, O.; Hulan, U.; Tang, Y.; Bantleon, H.P.; Rausch-Fan, X. Both 25-Hydroxyvitamin-D3 and 1,25-Dihydroxyvitamin-D3 reduces inflammatory response in human periodontal ligament cells. PLoS ONE; 2014; 9, e90301. [DOI: https://dx.doi.org/10.1371/journal.pone.0090301]
28. Jeon, H.H.; Teixeira, H.; Tsai, A. Mechanistic insight into orthodontic tooth movement based on animal studies: A critical review. J. Clin. Med.; 2021; 10, 1733. [DOI: https://dx.doi.org/10.3390/jcm10081733]
29. Ren, Y.; Maltha, J.C.; Kuijpers-Jagtman, A.M. Optimum force magnitude for orthodontic tooth movement: A systematic literature review. Angle Orthod.; 2003; 73, pp. 86-92.
30. Li, B.; Zhang, Y.H.; Wang, L.X.; Li, X.; Zhang, D. Expression of OPG, RANKL, and RUNX2 in rabbit periodontium under orthodontic force. Genet. Mol. Res.; 2015; 14, pp. 19382-19388. [DOI: https://dx.doi.org/10.4238/2015.December.29.48]
31. Yang, C.Y.; Jeon, H.H.; Alshabab, A.; Lee, W.J.; Chung, C.; Graves, D.T. RANKL deletion in periodontal ligament and bone lining cells blocks orthodontic tooth movement. Int. J. Oral Sci.; 2018; 10, 3. [DOI: https://dx.doi.org/10.1038/s41368-017-0004-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29483595]
32. Butera, A.; Gallo, S.; Maiorani, C.; Molino, D.; Chiesa, A.; Preda, D.; Esposito, F.; Scribante, A. Probiotic Alternative to Chlorhexidine in Periodontal Therapy: Evaluation of Clinical and Microbiological Parameters. Microorganisms; 2020; 29, 69. [DOI: https://dx.doi.org/10.3390/microorganisms9010069] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33383903]
33. Küchler, E.C.; Schröder, A.; Corso, P.; Scariot, R.; Spanier, G.; Proff, P.; Kirschneck, C. Genetic polymorphisms influence gene expression of human periodontal ligament fibroblasts in the early phases of orthodontic tooth movement. Odontology; 2019; 108, pp. 493-502. [DOI: https://dx.doi.org/10.1007/s10266-019-00475-x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31741103]
34. Kirschneck, C.; Batschkus, S.; Proff, P.; Köstler, J.; Spanier, G.; Schröder, A. Valid gene expression normalization by RT-qPCR in studies on hPDL fibroblasts with focus on orthodontic tooth movement and periodontitis. Sci. Rep.; 2017; 7, 14751. [DOI: https://dx.doi.org/10.1038/s41598-017-15281-0] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29116140]
35. Schröder, A.; Bauer, K.; Spanier, G.; Proff, P.; Wolf, M.; Kirschneck, C. Expression kinetics of human periodontal ligament fibroblasts in the early phases of orthodontic tooth movement. J. Orofac. Orthop.; 2018; 79, pp. 337-351. [DOI: https://dx.doi.org/10.1007/s00056-018-0145-1] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30019109]
36. Bikle, D.D. Vitamin D metabolism, mechanism of action, and clinical applications. Chem. Biol.; 2014; 21, pp. 319-329. [DOI: https://dx.doi.org/10.1016/j.chembiol.2013.12.016]
37. Nejentsev, S.; Godfrey, L.; Snook, H.; Rance, H.; Nutland, S.; Walker, N.M.; Lam, A.C.; Guja, C.; Tirgoviste, C.I.; Undlien, D.E. et al. Comparative high-resolution analysis of linkage disequilibrium and tag single nucleotide polymorphisms between populations in the vitamin D receptor gene. Hum. Mol. Genet.; 2004; 13, pp. 1633-1639. [DOI: https://dx.doi.org/10.1093/hmg/ddh169]
38. Jurutka, P.W.; Remus, L.S.; Whitfield, G.K.; Thompson, P.D.; Hsieh, J.C.; Zitzer, H.; Tavakkoli, P.; Galligan, M.A.; Dang, H.T.; Hausller, C.A. et al. The polymorphic N terminus in human vitamin D receptor isoforms influences transcriptional activity by modulating interaction with transcription factor IIB. Mol. Endocrinol.; 2000; 14, pp. 401-420. [DOI: https://dx.doi.org/10.1210/mend.14.3.0435]
39. Alimirah, F.; Peng, X.; Murillo, G.; Mehta, R.G. Functional significance of vitamin D receptor FokI polymorphism in human breast cancer cells. PLoS ONE; 2011; 6, e16024. [DOI: https://dx.doi.org/10.1371/journal.pone.0016024]
40. Gross, C.; Krishnan, A.V.; Malloy, P.J.; Eccleshall, T.R.; Zhao, X.Y.; Feldman, D. The vitamin D receptor gene start codon polymorphism: A functional analysis of FokI variants. J. Bone Miner. Res.; 1998; 13, pp. 1691-1699. [DOI: https://dx.doi.org/10.1359/jbmr.1998.13.11.1691]
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Schröder, Agnes 2 ; Spanier, Gerrit 3
; ThedeiJr, Geraldo 4 ; Maria Beatriz Carvalho Ribeiro de Oliveira 4
; Maria Angélica Hueb de Menezes-Oliveira 4 ; Proff, Peter 2 ; Kirschneck, Christian 2
1 Department of Orthodontics, University of Regensburg, 93047 Regensburg, Germany; Department of Biomaterials, University of Uberaba, Uberaba 38010-200, Brazil
2 Department of Orthodontics, University of Regensburg, 93047 Regensburg, Germany
3 Department of Maxillofacial Surgery, University of Regensburg, 93047 Regensburg, Germany
4 Department of Biomaterials, University of Uberaba, Uberaba 38010-200, Brazil