Glycyrrhizic acid protects against temporal lobe epilepsy in young rats by regulating neuronal ferroptosis through the miR-194-5p/PTGS2 axis

Abstract

Temporal lobe epilepsy (TLE) leads to extensive degradation of the quality of life of patients. Glycyrrhizic acid (GA) has been reported to exert neuroprotective effects on status epilepticus. Herein, the current study set out to explore the functional mechanism of GA in TLE young rats. Firstly, TLE young rat models were established using the lithium chloride and pilocarpine regimen and then subjected to treatment with different doses of GA, miR-194-5p-antagomir, or/and sh-prostaglandin-endoperoxide synthase 2 (PTGS2) to observe changes in iron content, glutathione and malondialdehyde levels, and GPX4 (glutathione peroxidase 4) and PTGS2 protein levels in the hippocampus. Neuronal injury and apoptosis were assessed through HE, Nissl, and TUNEL staining. Additionally, the expression patterns of miR-194-5p were detected. The binding site of miR-194-5p and PTGS2 was verified with a dual-luciferase assay. Briefly, different doses of GA (20, 40, and 60 mg/kg) reduced the epileptic score, frequency, and duration in TLE young rats, along with reductions in iron content, lipid peroxidation, neuronal injury, and apoptosis in the hippocampus. Silencing of miR-194-5p partly annulled the action of GA on inhibiting ferroptosis and attenuating neuronal injury in TLE young rats. Additionally, PTGS2 was validated as a target of miR-194-5p. GA inhibited ferroptosis and ameliorated neuronal injury in TLE young rats via the miR-194-5p/PTGS2 axis. Overall, our findings indicated that GA exerts protective effects on TLE young rats against neuronal injury by inhibiting ferroptosis through the miR-194-5p/PTGS2 axis.

INTRODUCTION

Epilepsy is a common disorder of the nervous system and is characterized by recurrent and unprovoked seizures.¹ The hard-done work of our peers has shown that neuronal loss represents a pathological factor with profound impacts on epileptic onset.² Frequent epileptic episodes can further contribute to neuronal injury and neuronal cell death.³ Meanwhile, the process of ferroptosis serves as a type of cell death with characteristics such as iron accumulation and excessive production of reactive oxygen species.⁴ Recent investigations have also noted the presence of ferroptosis in epileptic mouse models induced by pentylenetetrazole kindling and pilocarpine (Pilo), such that inhibition of ferroptosis led to attenuation of epilepsy by enhancing the antioxidant ability.⁵ Additionally, inhibition of ferroptosis has been proven to be beneficial for the improvement of cognitive impairment in rats with kainic acid-induced temporal lobe epilepsy (TLE),⁶ and further contributes to neuroprotection after post-traumatic epileptic seizure.⁷ Therefore, it's of utmost significance to explore epileptic pathogenesis in regard to ferroptosis, and search for novel therapeutic drugs for TLE management.

Glycyrrhizic acid (GA) is an essential component of the rhizome and root of glycyrrhiza glabra and, as Chinese herbal medicine, has a versatile profile due to its antiviral, immunomodulatory, and anti-cancer properties and anti-inflammatory activity.⁸ Interestingly, there is evidence to suggest that GA can alleviate pathological injury in the hippocampus of juvenile epileptic rats, facilitate mitochondrial autophagy, and further reduce oxidative stress by activating sirtuin3.⁹ Moreover, GA has been previously highlighted for its neuroprotective effects in rats with status epilepticus by inhibiting high mobility group protein B1 and maintaining the blood–brain barrier permeability.¹⁰ However, the regulatory mechanism by which GA functions in epilepsy requires further elucidation. Meanwhile, existing reports indicate that suppression of ferroptosis contributes to neuroprotection in epilepsy.¹¹ GA is has been documented to be effective against ferroptosis resistance.¹² What remains to be elucidated is whether GA can confer protection to young rats against TLE by reducing neuronal ferroptosis.

MicroRNAs (miRNAs) are a group of small non-coding RNAs, and play critical roles in a plethora of biological processes such as immune response, cellular proliferation, apoptosis, and differentiation via the miRNA-mRNA interaction.¹³ In a very recent report, miR-29a was reported to be capable of modulating hippocampal neuronal death and inflammation after epilepsy.¹⁴ Intriguingly, isorhynchophylline was previously indicated to alleviate neuronal injury induced by ferroptosis after cerebral hemorrhage via regulation of miR-122-5p.¹⁵ Combined with a previous discovery that miR-194-5p is poorly-expressed in epileptic patients,^16,17 and the knowledge that over-expression of miR-194-5p can repress neuronal apoptosis induced by TLE,¹⁸ we herein postulated that both GA and miR-194-5p may play pivotal roles in the pathogenesis of epilepsy. Nevertheless, the interaction between GA and miR-194-5p and the related mechanisms in epilepsy is yet to be documented. Meanwhile, existing genetic networks suggest that prostaglandin-endoperoxide synthase 2 (PTGS2) function as the hub gene in the biology of ferroptosis.¹⁹ PTGS2 serves as a sensitive factor for ferroptosis resulting from the inactivation of glutathione peroxidase 4 (GPX4), which is a selenoprotein with a significant role in ferroptosis, and further possesses the ability to specifically catalyze glutathione (GSH) and convert lipid peroxides to lipid alcohols.¹⁹ Reports have also indicated that lipid peroxidation occurs and malondialdehyde (MDA) is formed once the accumulation of reactive oxygen species exceeds the redox content of GSH and GPX4, while MDA is known to wreak havoc on the plasma membrane.²⁰ Additionally, the decrease in the anti-oxidant function of GPX4 and GSH is one of the chief characteristics of ferroptosis.¹⁹ Lastly, miR-212-5p can attenuate neuronal ferroptosis after traumatic brain injury by targeting PTGS2.²¹ Hence, it is not unreasonable to propose that GA could regulate neuronal ferroptosis and protect young rats from TLE by regulating miR-194-5p to target PTGS2. Accordingly, the current study set out to investigate the functional mechanism by which GA modulates neuronal ferroptosis in TLE young rats, aiming to lay the theoretical foundation for the exploration of novel therapeutic strategies and targeted drugs for epilepsy.

MATERIALS AND METHODS Ethics statement

All animal experimental procedures and protocols were approved by the Medical Ethics Committee of The Second Affiliated Hospital of Harbin Medical University(Approval number: L2021009). Animal experimentation was carried out following the guidelines for the care and use of laboratory animals. Extensive efforts were undertaken to minimize both the number and suffering of animals used in this study.

Experimental animals

Healthy male Sprague–Dawley young rats (aged 24 days, weight range 54–58 g) were procured from Covance Pharmaceutical R&D (Shanghai) (SYXK [Shanghai] 2021–0001, Shanghai, China). The obtained rats were maintained at 20 ± 2°C with 50%–60% humidity, and allowed ad libitum access to food and water.

Establishment of TLE rat models

Young rat models of TLE were established using the lithium chloride (LiCl) and Pilo regimen. Following the initial intraperitoneal injection of 125 mg/kg LiCl, the young rats were intraperitoneally administered 20 mg/kg of Pilo after 18–20 h.⁹ An intraperitoneal administration of 1 mg/kg atropine was performed 30 min prior to Pilo administration to relieve the peripheral cholinergic effects. Following 30 min of continuous observation, the rats were graded in line with the Racine grading standard²² as follows: a score of 0, no seizure and other reactions; 1, rhythmic convulsions of the face and beard; 2, up-down swing and head rotation; 3, myoclonus and spasm of multiple limbs; 4, standing and falling due to loss of control; 5, generalized tonic–clonic seizure with running and jumping; 6, death of rat. Successful model establishment was defined when the seizure reached Grade 4 and lasted for 30 min or above. Following the onset of status epilepticus for 90 min, the rats were intraperitoneally administered 10 mg/kg of diazepam to control seizure intensity and reduce mortality. LiCl and Pilo were purchased from Sigma-Aldrich (St. Louis, MO, USA), and atropine and diazepam were procured from GenePharma (Shanghai, China).

Animal grouping

The young rats were randomly allocated to the following seven groups (N = 12 rats): (1) the control group, (2) the TLE group, (3) the TLE + GA group (TLE young rats intraperitoneally administered with GA [dosages of 20, 40, and 60 mg/kg] 30 min after diazepam injection), (4) the TLE + GA + inhi-NC group (TLE young rats intraperitoneally administered with 60 mg/kg of GA 30 min after diazepam injection, and intracerebroventricularly administered with 50 μl antagomir-negative control [NC] [dosage of l nmoL/50 μl] using the stereotactic technique 4 h after diazepam injection), (5) the TLE + GA + miR-antagomiR group (TLE young rats intraperitoneally administered with 60 mg/kg of GA 30 min after diazepam injection, and intracerebroventricularly administered with 50 μl miR-antagomiR [dosage of l nmoL/50 μl] using the stereotactic technique 4 h after diazepam injection), (6) the TLE + GA + miR-antagomiR + sh-NC group (TLE young rats intraperitoneally administered with 60 mg/kg of GA 30 min after diazepam injection, and intracerebroventricularly administered with 50 μl miR-antagomiR [dosage of l nmoL/50 μl] and 15 μl 1 × 10⁹ TU/ml adenovirus-packaged sh-NC vector using the stereotactic technique 4 h after diazepam injection), and (7) the TLE + GA + miR-antagomiR + sh-PTGS2 group (TLE young rats intraperitoneally administered with 60 mg/kg of GA 30 min after diazepam injection, and intracerebroventricularly administered with 50 μl miR-antagomiR [dosage of l nmoL/50 μl] and 15 μl 1 × 10⁹ TU/ml adenovirus-packaged sh-PGTS2 vector using the stereotactic technique 4 h after diazepam injection). AntagomiR-NC/miR-antagomiR and mimic NC/miR-194-5p mimic were both purchased from RiboBio (Guangzhou, Guangdong, China). Adenovirus-packaged sh-NC and sh-PTGS2 were provided by GenePharma. Simultaneously, the young rats in the control group and the TLE group were injected with equal amounts of phosphate buffer saline (PBS). GA (purity ≥95.0%, Sigma-Aldrich) was dissolved in PBS.

Hippocampus sample preparation

After 5 days of animal grouping regimens, the young rats were euthanized under anesthesia, followed by perfusion of 4% paraformaldehyde into the heart until the trunk, limbs, and tail of young rats become stiff. The brain was removed quickly and then the hippocampus was immediately isolated on the ice. Subsequently, the hippocampus of six rats from each group was made into homogenate and stored at −80°C, and the hippocampus of the remaining six rats was fixed with 4% paraformaldehyde for 24 h and paraffin-sectioned for further histological staining.

Hematoxylin–eosin staining

The paraffin-embedded sections (5-μm thickness) were dewaxed using xylene, stained with hematoxylin and eosin (Solarbio, Beijing, China), dehydrated with absolute ethanol, and then sealed with neutral gum. Four non-overlapping visual fields were selected from each group and visualized under a BX51 optical microscope (Olympus, Tokyo, Japan).

Nissl staining

After conventional dewaxing, the sections were immersed in 0.1% cresyl violet stain solution (Solarbio) for 10 min, rinsed with distilled water for 5 min, and then differentiated with 1% hydrochloric alcohol for 8 s. Following dehydration, the sections were subsequently cleared with xylene and gradient ethanol, sealed, and visualized under a microscope for analysis. Images were captured using a BX51 optical microscope (Olympus) and analyzed with the Image-Pro Plus 6.0 software (Media Cybernetics, Rockville, MD, USA).

Terminal deoxynucleotidyl transferase-mediated biotin-16-dUTP nick-end labelling staining

Histological analysis of neuronal ferroptosis was performed by TUNEL staining. Following conventional dewaxing and dehydration, the sections were treated with protease K at room temperature for 1 h, rinsed three times with PBS, stained, and then sealed with TUNEL reaction kits (Beyotime, Shanghai, China) after the reaction. Subsequently, images of sections after TUNEL staining were obtained using an Olympus microscope (DP80, Olympus) with a ×40 objective. The number of TUNEL-positive cells in each visual field was counted using the Image-Pro Plus 6.0 software (Media Cybernetics).

Measurement of hippocampal lipid peroxidation and GSH

The hippocampal homogenate was centrifuged at 1000 × g for 10 min, and the supernatant was collected. Next, the content of MDA was measured with the help of specific colorimetric assay kits (A003-1-2, Nanjing Jiancheng Bioengineering Institute, Jiangsu, China) following the manufacturer's instructions. In principle, MDA reacts with thiobarbituric acid (TBA) to produce MDA-TBA adduct that can be detected at the wavelength of 532 nm using spectrophotometry. Additionally, the content of GSH was measured using GSH detection kits (A006-1-1, Nanjing Jiancheng) as per the provided instructions. Absorbance values at the wavelength of 420 nm were detected using a spectrophotometer.

Measurement of iron content

In accordance with the manufacturer's protocols, iron content in the hippocampus of young rats was measured with the help of iron detection kits (ab83366, Abcam, Cambridge, MA, USA).

Reverse transcription-quantitative polymerase chain reaction

Total RNA content was extracted from the hippocampal tissues of young rats using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and reverse-transcribed into cDNA with the help of PrimeScript RT kits (TaKaRa, Dalian, China) as per the manufacturer's instructions. RT-qPCR was carried out using SYBR®Premix Ex TaqTMI kits (TaKaRa) on an ABI PRISM®7300 system, with U6 serving as the internal reference of miR-194-5p. Measurement data were quantified using the 2^−ΔΔCt method. Primer sequences are illustrated in Table 1.

TABLE 1 Primer sequences

Gene	Forward 5′-3′	Reverse 5′-3′
miR-194-5p	GCGGCGGTGTAACAGAACTCC	ATCCAGTGCAGGGTCCGAGG
U6	GTGGACCGCACAAGCTCGCT	TTGTTGAACGGCACTGTGTATAGCA

Abbreviation: miR, microRNA.

Western blot assay

Total protein content was extracted from the hippocampal tissues of young rats, followed by determination of protein concentration. Next, the protein samples were separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. Following 1 h of blockade with protein blocking buffer, the membranes were incubated with the primary antibodies GPX4 (ab125066, dilution ratio of 1:1000, Abcam) and PTGS2 (ab179800, dilution ratio of 1:1000, Abcam) overnight. On the following day, after washing, the membranes were incubated with goat anti-rabbit IgG (immunoglobulin G) H&L (horseradish peroxidase) (ab97051, dilution ratio of 1:10000, Abcam) for 1 h at room temperature, and developed using the ECL-Plus reagent (Millipore, Billerica, MA, USA). Gray value quantification of each band in Western blot images was performed using the Image Pro Plus 6.0 software with β-actin (ab8227, dilution ratio of 1:1000, Abcam) serving as the internal reference.

Dual-luciferase reporter assay

Luciferase activity was measured with the help of dual-luciferase reporter assay kits (Beyotime) under the manufacturer's instructions. First, the potential binding site of miR-194-5p and PTGS2 was predicted using the TargetScan version 7.2 database (http://www.targetscan.org/),²³ and the complementary binding sequences and mutant (MUT) sequences of miR-194-5p and PTGS2 were amplified based on the prediction results, and subsequently cloned onto the pmir-GLO luciferase vectors (Promega, Madison, WI, USA) to construct the wild-type (WT) plasmid PTGS2-WT and corresponding mutant plasmid PTGS2-MUT. Next, miR-194-5p mimic or mimic NC and corresponding plasmids were co-transfected into H293T cells (Xuran Biotechnology, Shanghai, China) using the Lipofectamine 2000 reagent (Invitrogen). After 48 h of transfection, the luciferase activity was measured.

Statistical analysis

Data analysis and plotting were processed using the SPSS 21.0 (IBM Corp., Armonk, NY, USA) and GraphPad Prism 8.01 (GraphPad Software Inc., San Diego, CA, USA) software. The Shapiro–Wilk test was utilized to confirm normal data distribution. Measurement data were presented as mean ± standard deviation. Comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA), followed by Tukey's multiple comparisons test. A value of p < 0.05 was regarded statistically significant.

RESULTS GA inhibited TLE behaviors in young rats

Firstly, young rat models of TLE were established using the LiCl and Pilo regimen, followed by behavioral observation. Relative to the control group, the TLE group presented with grade 4 epileptic behaviors including limb seizures, postural instability, and falling, which indicated the successful establishment of TLE models. Subsequently, the rats were intraperitoneally injected with GA at different dosages (20, 40, and 60 mg/kg). The TLE group presented with lower epileptic scores, frequency, and duration than the control group after treatment with different doses of GA (all p < 0.01, Figure 1A–C), which underscored the protective effects of GA on seizure onset in young rats. Additionally, GA at the dosage of 60 mg/kg exhibited the best effects. Therefore, GA at the dosage of 60 mg/kg was adopted for subsequent experimentation.

FIGURE 1. GA inhibited TLE behaviors in young rats. (A–C) Effects of GA on seizure score, frequency, and duration in TLE young rats were examined. N = 12. Data were illustrated as mean ± standard deviation. Comparisons among multiple groups were analyzed using one-way ANOVA, followed by Tukey's multiple comparisons test. **p [less than] 0.01.

GA attenuated neuronal injury in TLE young rats by suppressing ferroptosis

To investigate whether GA ameliorates neuronal injury in TLE young rats by inhibiting ferroptosis, TLE young rats were intraperitoneally injected with 60 mg/kg of GA prior to measurement of iron content in the hippocampus. The iron content was markedly increased in the hippocampus of TLE young rats (p < 0.01), while being significantly decreased after GA treatment (p < 0.01, Figure 2A). Ferroptosis is known to be associated with oxidative stress.²⁴ Accordingly, hippocampus lipid peroxidation was assessed by detecting the GPX4 protein expression pattern using a Western blot assay, and GSH levels, and MDA content with the help of ELISA kits. As illustrated in Figure 2B–D, the TLE group presented with massive lipid peroxidation, manifested as decreased GPX4 and GSH levels, and increased MDA content in the hippocampus area (p < 0.01), while the same were partially reversed after GA treatment (all p < 0.01). Subsequently, HE and Nissl staining were adopted to visualize the structural damage and survival of hippocampal neurons in rats. The hippocampal neurons of normal young rats appeared to be round with clear nuclear membranes and in alignment, while the hippocampal neurons of TLE young rats were deformed with unclear nuclear membranes and misalignment, while the survival rate of hippocampal neurons was decreased, and lastly, the hippocampal neurons were normalized with normal round shape and clear nuclear membranes, and further exhibited increased survival rate after GA treatment (Figure 2E,F). The results of TUNEL staining illustrated abundant brown cells with nuclear pyknosis in the hippocampus of TLE young rats, whereas decreased TUNEL-positive cells and normal cellular morphology and structure were noted after GA treatment (p < 0.01, Figure 2G). Together, the abovementioned findings indicated that GA reduced lipid peroxidation and mitigated neuronal injury in TLE young rats by inhibiting ferroptosis.

FIGURE 2. GA attenuated neuronal injury in TLE young rats by suppressing ferroptosis. TLE young rats were intraperitoneally administered with 60 mg/kg GA. (A) Iron content in the hippocampus of young rats was measured using the iron detection kit; (B) Protein expression of GPX4 in the hippocampus of young rats was determined by Western blot; (C,D) GSH level and MDA content in hippocampus of young rats were determined using ELISA kits; (E) Neuronal injury in the hippocampus of young rats was observed by HE staining; (F) Survival condition of hippocampal neurons in young rats was observed by Nissl staining; G: Neuronal apoptosis in the hippocampus of young rats was assessed by TUNEL staining. N = 6. Data were illustrated as mean ± standard deviation. Comparisons among multiple groups were analyzed using one-way ANOVA, followed by Tukey's multiple comparisons test. ** p [less than] 0.01.

Down-regulation of miR-194-5p partially annulled the suppression of GA on neuronal injury in TLE young rats

Accumulating evidence has shown that miR-194-5p is poorly-expressed in patients with epilepsy,^16,17 whereas over-expression of miR-194-5p can repress TLE-provoked neuronal apoptosis.¹⁸ Accordingly, we measured the expression patterns of miR-194-5p in the hippocampus of young rats by RT-qPCR, which manifested significantly decreased miR-194-5p expression levels in TLE young rats compared to those in young rats from the control group (p < 0.01), whereas miR-194-5p expression levels were elevated in the TLE + GA group compared to those in the TLE group (p < 0.01, Figure 3A). Overall, these findings demonstrated that miR-194-5p was weakly-expressed in young rats with TLE, while GA treatment could facilitate the expression of miR-194-5p.

FIGURE 3. miR-194-5p downregulation partially annulled the suppression of GA on neuronal injury in TLE young rats. Young rats were intracerebroventricularly injected with 50 μl miR-antagomir after intraperitoneal GA (60 mg/kg) treatment to downregulate miR-194-5p. (A) Expression of miR-194-5p in the hippocampus of young rats was determined by RT-qPCR; (B) Iron content in the hippocampus of young rats was determined using the iron detection kit; (C) Protein expression of GPX4 in the hippocampus of young rats was determined by Western blot; (D,E) GSH level and MDA content in hippocampus of young rats were determined using ELISA kits; (F) Neuronal injury in the hippocampus of young rats was assessed by HE staining; (G) Neuronal survival in the hippocampus of young rats was observed by Nissl staining; (H) Neuronal apoptosis in the hippocampus of young rats was assessed by TUNEL staining. N = 6. Data were illustrated as mean ± standard deviation. Comparisons among multiple groups were analyzed using one-way ANOVA, followed by Tukey's multiple comparisons test. **p [less than] 0.01.

To further elucidate whether GA attenuates neuronal injury in TLE young rats by inhibiting ferroptosis via miR-194-5p, the rats were intracerebroventricularly injected with 50 μl miR-antagomir after GA treatment to down-regulate the expression of miR-194-5p. Subsequent results of RT-qPCR illustrated decreased miR-194-5p expression levels in the rat hippocampus of the TLE + GA + miR-antagomir group compared to those in the TLE + GA + antagomir NC group (p < 0.01, Figure 3A), which was indicative of successful down-regulation of miR-194-5p. Moreover, the GA-decreased iron content in the hippocampus of TLE young rats was partially-abolished following down-regulation of miR-194-5p (p < 0.01, Figure 3B). Further results of Western blot assay and ELISA revealed that the effect of GA on decreasing hippocampus lipid peroxidation was also reversed to some extent after down-regulation of miR-194-5p (all p < 0.01, Figure 3C–E). Meanwhile, HE and Nissl staining results demonstrated that down-regulation of miR-194-5p partially inverted the effects of GA on inhibiting neuronal injury and facilitating neuronal survival in TLE young rats (Figure 3F,G). Lastly, the results of TUNEL staining exhibited that down-regulation of miR-194-5p partially negated the inhibitory effect of GA on apoptosis of hippocampal neurons in young rats (p < 0.01, Figure 3H). Altogether, the abovementioned findings highlighted that down-regulation of miR-194-5p could partially reverse the effect of GA on alleviating neuronal injury in TLE young rats via inhibition of ferroptosis.

miR-194-5p targeted PTGS2

To further explore the functional mechanism of miR-194-5p in neuronal injury in TLE young rats, we predicted the target genes of miR-194-5p using the TargetScan online database and came across a potential binding site of miR-194-5p and PTGS2 (Figure 4A). PTGS2 is known to be highly expressed in patients with epilepsy.²⁴ Moreover, PTGS2 can further serve as a sensitive factor of ferroptosis resulting from GPX4 inactivation.²⁵ The results of dual-luciferase assay showed that over-expression of miR-194-5p significantly decreased the luciferase activity of PTGS2-3′UTR-WT (p < 0.01), without influencing the luciferase activity of PTGS2-3′UTR-MUT (p > 0.05, Figure 4B). Furthermore, Western blot assay results illustrated increased PTGS2 expression levels in the TLE group compared to those in the control group (p < 0.01), and decreased PTGS2 expression levels after GA treatment (p < 0.01), whereas down-regulation of miR-194-5p reversed the suppression of GA on PTGS2 expression levels (p < 0.01, Figure 4C). Collectively, the abovementioned findings indicated that miR-194-5p targeted PTGS2.

FIGURE 4. miR-194-5p targeted PTGS2. (A) The potential binding site of miR-194-5p and PTGS2 was predicted on TargetScan; (B) Binding relationship between miR-194-5p and PTGS2 was verified by dual-luciferase assay; (C) Protein expression of PTGS2 in young rats was determined by Western blot. N = 6. Data were illustrated as mean ± standard deviation. Comparisons among multiple groups were analyzed using one-way ANOVA, followed by Tukey's multiple comparisons test. **p [less than] 0.01.

GA attenuated neuronal injury in TLE young rats by inhibiting ferroptosis via the miR-194-5p/PTGS2 axis

Lastly, to examine whether PTGS2 participates in GA-mediated alleviation of neuronal injury in TLE young rats, young rats were intraperitoneally injected with 15 μl adenovirus vectors carrying sh-PTGS2 following combined treatment of GA and miR-antagomir to down-regulate the expression of PTGS2. Subsequent results of Western blot assay significantly decreased PTGS2 expression levels in the TLE + GA + miR-antagomir + sh-PTGS2 group compared to those in the TLE + GA + miR-antagomir + sh-NC group (p < 0.01, Figure 5A), indicating that PTGS2 expression was successfully down-regulated.

FIGURE 5. GA attenuated neuronal injury in TLE young rats by inhibiting ferroptosis via the miR-194-5p/PTGS2 axis. Young rats were intracerebroventricularly injected with 15 μl adenovirus containing sh-PTGS2 after treatment with GA (60 mg/kg) and miR-antagomir. (A) Protein expression of PTGS2 in young rats was determined by Western blot; (B) Iron content in the hippocampus of young rats was measured using the iron detection kit; (C) Protein expression of GPX4 in young rats was determined by Western blot; (D,E) GSH level and MDA content were measured using ELISA kits; (F) Neuronal injury in the hippocampus of young rats was observed by HE staining; (G) Neuronal survival in the hippocampus of young rats was observed by Nissl staining; (H) Neuronal apoptosis in the hippocampus of young rats was assessed by TUNEL staining. N = 6. Data were illustrated as mean ± standard deviation. Comparisons among multiple groups were analyzed using one-way ANOVA, followed by Tukey's multiple comparisons test. **p [less than] 0.01.

Thereafter, we measured the iron content in the hippocampus of TLE young rats and revealed that down-regulation of PTGS2 partially nullified the promotive effect of miR-194-5p down-regulation on hippocampal iron content (p < 0.01, Figure 5B). As illustrated by the results of Western blot assay and ELISA in Figure 5C–E, down-regulation of PTGS2 also partially annulled the encouraging effect of miR-194-5p down-regulation on hippocampal lipid peroxidation (all p < 0.01). Meanwhile, HE and Nissl staining results demonstrated the reversal effect of PTGS2 down-regulation on exacerbated neuronal injury and decreased neuronal survival in TLE young rats induced by miR-194-5p down-regulation (Figure 5F,G). Moreover, the results of TUNEL staining illustrated that down-regulation of PTGS2 counteracted the promotive effect of miR-194-5p down-regulation on neuronal apoptosis in the hippocampus of TLE young rats to some extent (p < 0.01, Figure 5H). Collectively, the abovementioned findings highlighted that GA ameliorated neuronal injury in TLE young rats by suppressing ferroptosis via the miR-194-5p/PTGS2 axis.

DISCUSSION

TLE represents the leading epilepsy syndrome and causes impairment of cognitive, psychiatric, and behavioral functions.²⁶ There is much evidence to suggest that the process of ferroptosis can manipulate nerve cell death in epilepsy.²⁷ Interestingly, GA, a component of the rhizome and root of glycyrrhiza glabra, can relieve hippocampal pathological injury in juvenile epileptic rats.⁹ Herein, findings obtained in the current study indicate that GA alleviates neuronal injury in TLE young rats by inhibiting ferroptosis through the miR-194-5p/PTGS2 axis.

Nowadays, TLE-associated mechanisms are widely-investigated with the help of TLE models established using the LiCl and Pilo regimen.^28,29 Similarly, we first established young rat models of TLE via injections of LiCl and Pilo. Following the successful establishment of the TLE young rat models, these rats were subjected to treatment with GA at different dose levels. The study performed by Paudel YN et al. indicated that GA exerts therapeutic activities against epileptic seizures.³⁰ Our findings demonstrated that GA treatment at any dose level led to significant reductions in the score, frequency, and duration of epileptic seizures in TLE young rats, and exhibited the best efficacy at the dosage of 60 mg/kg. A prior study suggested that GA is absorbed into the blood, which then crosses the blood–brain barrier (BBB) to reach the brain and exert its protective effects, which is a possible explanation for our findings.²³ Additionally, evidence has come to light indicating the presence of ferroptosis in the hippocampus after TLE.⁶ Moreover, GA can elicit strong neuroprotective effects in rodent models of vascular dementia via inhibition of oxidative stress and diminishing the release of cytochrome-c.³⁰ Wang Y et al. highlighted that GA can attenuate the degree of ferroptosis in acute liver failure through the inhibition of oxidative stress.¹² These findings and evidence make it plausible to suggest that GA inhibits ferroptosis in TLE, thereby retarding the progression of TLE. To further validate the same, we determined the levels of ferroptotic indicators in TLE young rats prior to and after GA treatment. GSH and MDA are well-established biomarkers of ferroptosis, while GPX4 is regarded as an important regulatory factor in the occurrence of ferroptosis.³¹ Unsurprisingly, TLE young rats presented with enhanced lipid peroxidation, along with increased GPX4 and MDA content and decreased GSH levels. On the other hand, TLE young rats presented decreased lipid peroxidation, diminished GPX4 and MDA content and relatively enhanced GSH levels after GA treatment. In addition, GA treatment led to the reversal of the TLE-triggered changes in the shape and nuclear membranes of hippocampal neurons, and further reduced the number of apoptotic neurons and facilitated neuronal survival in TLE young rats. Altogether, these findings and evidence indicate that GA may exert protective effects and reduce neuronal ferroptosis in TLE young rats via inhibition of oxidative stress.

Another significant finding of our study is the miRNA involvement in the abovementioned process. One such miRNA, namely miR-194-5p, has been documented to be dysregulated in patients with drug-resistant epilepsy.³² Interestingly, GA has been established to participate in a plethora of disorders via regulation of miRNAs,^33,34 yet whether GA is capable of regulating miR-194-5p and exerts its effects on TLE remains to be elucidated. During subsequent experiments, we uncovered that miR-194-5p expression levels were decreased in TLE young rats, while GA treatment led to the opposing trends. To further elucidate the effects of miR-194-5p on TLE young rats, we down-regulated the expression of miR-194-5p in TLE young rats after GA treatment, and uncovered a reversal of GA-mediated trends in hippocampal iron content, lipid peroxidation, neuronal injury, and apoptosis. Additionally, the study performed by Li X et al. highlighted that exosomal miR-194 exerts its neuroprotective effects against neuronal injury induced by oxygen–glucose deprivation/reoxygenation.³⁵ Similarly, Wan et al. reported that miR-194-5p over-expression mitigates pathological neuronal injury in rats with intracerebral hemorrhage.³⁶ Consistent with these results, our findings manifested that down-regulation of miR-194-5p could partially annul the effects of GA on alleviating neuronal injury in TLE young rats.

Furthermore, we explored the downstream mechanism of miR-194-5p in TLE. Niu X et al. previously hypothesized that miR-194-5p decelerates TLE development by targeting IGF1R.¹⁸ Moreover, given that evidence for PTGS2 involvement in epilepsy,⁷ we predicted the binding site of miR-194-5p and PTGS2, and validated PTGS2 as the target of miR-194-5p with the help of a dual-luciferase assay. Prior studies have documented that PTGS2 is highly-expressed in Pilo-triggered seizures.⁵ Similarly, we came across elevated expression levels of PTGS2 in TLE young rats prior to GA treatment and lowered expression levels of PTGS2 after GA treatment, whereas PTGS2 expression levels were restored following down-regulation of miR-194-5p. To further appreciate the role of PTGS2 in TLE, we down-regulated PTGS2 in TLE young rats, followed by combined treatment with GA and miR-antagomir. To the best of our knowledge, PTGS2 is capable of functioning as a ferroptosis biomarker.³⁷ Down-regulation of PTGS2 partly inverted the elevations in hippocampal iron content and lipid peroxidation, and further exacerbated neuronal apoptosis and injury induced via down-regulation of miR-194-5p in TLE young rats. The latter findings are particularly in accordance with the anti-apoptotic effects of other miRNAs such as miR-103 and miR-212-5p in Alzheimer's disease and traumatic brain injury via targeting PTGS2.^21,38 Altogether, these findings and evidence indicate that GA could alleviate neuronal injury in the hippocampus of TLE young rats by suppressing ferroptosis via the miR-194-5p/PTGS2 axis.

Collectively, the findings uncovered in our study highlighted that GA attenuated neuronal injury in TLE young rats through the inhibition of ferroptosis via modulation of the miR-194-5p/PTGS2 axis. However, our study presents its own set of limitations. Admittedly, our study merely indicated the protective role of GA in neuronal injury of TLE young rats by suppressing ferroptosis through the miR/194-5p/PTGS2 axis. Follow-up analyses are warranted to further elucidate whether there are any other target genes of miR-194-5p that could influence neuronal injury in TLE young rats, and whether miR-194-5p can function as a biomarker in the early screening of neuronal injury in TLE young rats. To well support the hypothesis and justify the conclusions, the use of other sequences of sh-PTGS2 with better silencing efficiency should also be considered in future studies. Addressing these gaps in future studies may lead us a step closer to TLE physiopathology, offering translational opportunities to improve its prevention, diagnosis, and patient care.

CONFLICT OF INTEREST

All authors declare no conflict of interest.