1. Introduction
Escherichia coli encoding specific virulence factors can cause colibacillosis, which is a frequent disease in both swine and humans [1]. Because the morbidity and mortality rates are very high, colibacillosis in swine has a considerable economic impact on swine husbandry [2]. In addition, pathogenic E. coli causes hemorrhagic colitis and diarrhea in humans, as well as potentially fatal consequences, including hemolytic–uremic syndrome (HUS) [3].
To control and treat colibacillosis, antimicrobial drugs are routinely used [4]. In Korea, swine receive the majority of the antimicrobial agents sold (507 tons, 55%), followed by poultry (155 tons, 17%) and cattle (99 tons, 11%) [5]. As a result, isolates from swine have much greater levels of antimicrobial resistance than isolates from other animals [5]. Given that swine may spread antimicrobial resistance to humans, antimicrobial resistance surveillance is essential [6].
Generally, E. coli is a part of normal intestinal flora; however, E. coli encoding specific virulence factors (toxins and adhesin genes) is pathogenic [7]. Enterotoxigenic E. coli (ETEC) produces heat-labile (LT) and heat-stable (ST) toxins, with ST toxin further classified into STa and STb kinds, as well as enteroaggregative E. coli heat-stable enterotoxin 1 (EAST-1). Shiga toxin-producing E. coli (STEC), also known as verotoxin-producing E. coli, produces the systemic vascular damaging Shiga toxin (Stx) 2. [2,3]. To produce enterotoxins and cause diseases, pathogenic E. coli needs to attach to the intestines of pigs first. ETEC and STEC can also produce one or more of the following fimbriae: F4 (K88), F5 (K99), F6 (987P), F18, and F41 (F7) [2,3,6,7]. Fimbriae play a crucial function in intestinal mucosa and epithelial cell adhesion [2,3,6,7]. These virulence factors fluctuate in frequency over time and depend on the host [8,9]. Virulence genes such as enterotoxins (LT, STa, STb, and Stx) and/or adhesins are often found in both swine and human isolates. Swine serve as carriers for pathogenic E. coli transmission to humans via foods such as pork products, thereby causing human diseases [2]. It is necessary to examine the virulence traits of strains from various hosts and diseases to determine the risk of zoonotic infections [10].
Although numerous studies have concentrated on the antimicrobial resistance of E. coli, the majority of studies have focused on commensal E. coli. Little research has been conducted on the relationship between antibiotic resistance and E. coli virulence factors in swine and patients with diarrhea. Thus, we compared the virulence factors and antimicrobial resistance of the most common pathogenic E. coli strains in swine and patients with diarrhea in Korea. Knowledge of antimicrobial resistance and the distribution of virulence factors in E. coli is useful for designing treatment and prevention strategies and estimating the risk of human–swine cross infection.
2. Materials and Methods
2.1. E. coli Strains
According to a previous study, the 85 most prevalent pathogenic E. coli isolates from swine were employed in this study, especially those suffering from edema disease and post-weaning diarrhea [9]. Forty strains of ETEC, twenty-eight strains of STEC, and seventeen strains of ETEC/STEC were selected. For the isolation of these strains, intestinal and fecal samples were aseptically obtained and streaked on MacConkey agar (Becton Dickinson, Franklin Lakes, NJ, USA). Only pink colonies that appeared to be pure were identified as E. coli, and their identification was confirmed using a VITEK II system (bioMéreiux, Marcy I’Etoile, France). For further characterization, the examined isolates were stored in a 50% glycerol stock at −70 °C. One hundred and thirty-seven isolates from patients with diarrhea were provided by the National Culture Collection for Pathogens (NCCP, Republic of Korea), the Gyeongsang National University Hospital Branch of the NCCP (GNUH-NCCP, Republic of Korea), and the Kyungpook National University Hospital Branch of the NCCP (KNUH-NCCP, Republic of Korea).
2.2. Antimicrobial Susceptibility Test
According to the Clinical and Laboratory Standards Institute (CLSI) criteria, the following 20 antimicrobial agents were employed in this study: aminoglycosides (gentamicin, streptomycin, neomycin, kanamycin, and amikacin), a combination of beta-lactam/lactamase inhibitors (amoxicillin/clavulanic acid), 1st generation cephalosporins (cephalothin and cefazolin), 2nd generation cephalosporins (cefoxitin), 4th generation cephalosporins (cefepime), quinolones (nalidixic acid), fluoroquinolones (ciprofloxacin and norfloxacin), tetracyclines (tetracycline and doxycycline), aminopenicillin (ampicillin), folate pathway inhibitors (trimethoprim/sulfamethoxazole), phenols (chloramphenicol), polymyxins (colistin), and lincosamide (clindamycin) [11]. The antimicrobial discs used in this study were obtained from Becton-Dickinson. Antimicrobial susceptibility tests were performed according to CLSI guidelines and disk diffusion methods [12]. According to the Magiorakos criteria, isolates resistant to three or more antimicrobial subclasses were defined as multi-drug-resistant strains [13].
2.3. Multilocus Sequence Typing (MLST)
Macrogen (Seoul, Republic of Korea) was responsible for all procedures, including genomic deoxyribonucleic acid (DNA) extraction, polymerase chain reaction (PCR) amplification, Sanger sequencing, and assembly. InstaGene Matrix (Bio-Rad, Hercules, CA, USA) was used to extract the genomic DNA. The methodology for MLST involved the utilization of partial sequences from seven housekeeping genes (adk, fumC, gyrB, icd, mdh, purA, and recA), which had been previously described [8]. The primer sequences used for sequencing adk, fumC, gyrB, icd, mdh, purA, and recA are as follows: adk (forward: GCAATGCGTATCATTCTGCT; reverse: CAGATCAGCGCGAACTTCAG), fumC (forward: CCACCTCACTGATTCATGCG; reverse: CGGTGCACAGGTAATGACTG), gyrB (forward: CGGGTCACTGTAAAGAAATTAT; reverse: GTCCATGTAGGCGTTCAGGG), icd (forward: TACATTGAAGGTGATGGAATCG; reverse: GTCTTTAAACGCTCCTTCG G), mdh (forward: TCTGAGCCATATCCCTACTG; reverse: CGATAGATTTACGCTCTTC CA), purA (forward: CTGCTGTCTGAAGCATGTCC; reverse: CAGTTTAGTCAGGCAG AAGC), and recA (forward: AGCGTGAAGGTAAAACCTGTG; reverse: ACCTTTGTAGC TGTACCACG).
The PCR reactions were carried out with 20 ng of genomic DNA as the template in a 30 μL reaction volume using Dr. MAX DNA polymerase (MGMED, Inc., Seoul, Republic of Korea). The amplification protocol involved the activation of Taq polymerase at 95 °C for 5 min, followed by 35 cycles at 95 °C for 30 s, 52 °C for 30 s, and 72 °C for 1 min, with a final extension step of 10 min at 72 °C. After amplification, the resulting PCR products were purified using a multiscreen filter plate (Millipore Corp., Burlington, MA, USA). A PRISM BigDye Terminator v3.1 cycle sequencing kit (Thermo Fisher Scientific, Waltham, MA, USA) was employed for the sequencing procedure. After incubation at 95 °C for 5 min and a subsequent 5 min cooling on ice, the mixture was analyzed using an ABI PRISM 3730XL DNA analyzer (Applied Biosystems, Waltham, MA, USA). We assigned sequence types (ST) through an online platform (
2.4. Statistical Analysis
For the statistical analysis of the differences in antimicrobial resistance and virulence factors of E. coli between swine and patients, the chi-square test was performed using SPSS (version 12.0; SPSS Inc., Chicago, IL, USA).
3. Results
3.1. Pathotypes and Virotypes (Combination of Colonization Factors and Toxin Genes)
Table 1 shows a comparison of pathotypes and virotypes of E. coli from swine and patients (Table 1). The most prevalent pathotypes in the swine were ETEC (40 isolates, 47.1%) and STEC (28 isolates, 32.9%). However, the most prevalent pathotype in the patients was STEC (31 isolates, 50.8%), followed by ETEC (14 isolates, 23.0%). In addition, various pathotypes were confirmed in the patients: enteroaggregative E. coli (EAEC), enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), STEC/EPEC, and STEC/EAEC. LT and ST toxin genes were found in ETEC isolates from both swine and patients. In STEC from patients, 23 isolates expressed the Stx1 gene, whereas Stx1 was not detected in any isolates from swine. In addition, STEC from patients had no detected colonization factors, whereas those from swine encoded the F18 and/or AIDA genes.
3.2. Antimicrobial Susceptibility Test
The results of antimicrobial susceptibility tests are described in Table 2. Resistance to gentamicin, neomycin, kanamycin, amikacin, nalidixic acid, ciprofloxacin, norfloxacin, tetracycline, doxycycline, trimethoprim/sulfamethoxazole, and chloramphenicol was significantly higher in swine isolates (51.8%, 51.8%, 89.4%, 75.3%, 70.6%, 41.2%, 32.9%, 87.1%, 80.0%, 56.5%, and 84.7%, respectively) than in the patient isolates (18.0%, 29.5%, 41.0%, 3.3%, 50.8%, 19.7%, 18.0%, 50.8%, 29.5%, 34.4%, and 34.4%, respectively). In contrast, amoxicillin/clavulanic acid (72.1%) resistance in patient isolates was significantly higher than that in swine isolates (36.5%). All isolates from swine were susceptible to cefepime, a fourth-generation cephalosporin, and two isolates (3.3%) from patients were resistant to cefepime.
3.3. Multidrug Resistance Rates
Figure 1 shows the results of the multidrug resistance analysis. Isolates from swine showed significantly lower non-multidrug resistance (0–2 antimicrobial resistance patterns; 4.7%) than isolates from patients (11.5%). In particular, 6–10 antimicrobial resistance patterns were significantly higher in isolates from swine (75.3%) than from patients (49.2%).
3.4. MLST
Figure 2 depicts a minimum spanning tree based on the MLST data, which includes branch distances. The number of divisions within each node was proportional to the number of ST-representing isolates. The black numerals in the circles indicate MLST sequence types. The red numbers on the line represent the absolute distances between the sequence types. Node diameters varied linearly with the number of ST-specific isolates. ST 1 (21 isolates, 31.8%) and ST 100 (21 isolates, 31.8%) were the most common STs found in the swine isolates. While the swine isolates included only 10 STs, the patient isolates contained 36 STs. ST 88 (11 isolates, 13.8%), ST 678 (6 isolates, 7.5%), and ST 10 (6 isolates, 7.5%) were the predominant STs among the patient isolates. Simultaneous detection of ST 100 (swine: 21 isolates; patients: 4 isolates), ST 1 (swine: 21 isolates, patients: 2 isolates), ST 10 (swine: 8 isolates; patients: 6 isolates), ST 641 (swine: 3 isolates, patients: 2 isolates), and ST 88 (swine: 2 isolates, patients: 11 isolates) occurred in both swine and patient samples. Furthermore, novel STs were found in five swine isolates, including ST New. In addition, ST 34–ST 218, ST 3744–ST 218, ST 10–ST 218, ST 90–ST 88, and ST New–ST 641 exhibited three absolute distances.
4. Discussion
In this study, we compared the virulence genes and antimicrobial resistance phenotypes of E. coli isolated from patients and swine with diarrhea. Colibacillosis symptoms differ based on the virulence factors encoded by the infective E. coli [14]. EPEC was reported as the most prevalent pathotype in patients in Korea in a previous study [15]; however, in the present study, we found that STEC was most prevalent, followed by ETEC. Until now, the reason for the temporal shifts in E. coli pathotypes has not been clarified; however, it is clear that the primary pathotypes were ETEC and STEC from EPEC. In this study, the majority of the swine isolates were confirmed to be STEC (28 isolates, 32.9%). Since STEC is an important zoonotic infection, careful treatment and prevention strategies for colibacillosis are needed [16]. Swine-to-human cross infection with STEC must be closely monitored because STEC can cause potentially life-threatening complications such as HUS [3,17].
Pathogenic E. coli must first attach to the intestine to create enterotoxins and cause illness [18]. Fimbriae are necessary for the first connection between the intestinal mucosa and epithelial cells [19]. F6 was the most common fimbriae in Korean swine in the late 1990s, but by the mid-2000s, it shifted to F5 [20,21]. However, no fimbrial adhesins were found in the patient isolates in this study, except for F4 and F18. F4 (29 isolates, 45.3%) and F18 (35 isolates, 54.7%) were the prevailing E. coli virotypes detected in the swine samples. Inactivated vaccinations targeting F4 and F18 have been utilized across Korea [22]. The use of these vaccines could result in antigenic variants and would explain why swine isolates also contain F4 and F18, in addition to fimbriae or non-fimbrial adhesins.
The Stx2 gene was found in both swine (45 isolates) and human (39 isolates) isolates. The Stx gene has been previously linked to edema in swine and HUS in humans [3,23,24]. The globotriosyl ceramide receptor for Stx2 is found in both swine and humans [25]. In addition, the LT and ST genes, which are known to be associated with diarrhea in swine and travelers’ diarrhea in humans, were found in both swine (LT: 42 isolates, ST: 43 isolates) and human isolates (LT: 11 isolates, ST: 13 isolates) [26]. Both enterotoxins raise extracellular chloride and bicarbonate levels, potentially causing osmotic diarrhea [27,28,29,30]. There were no common fimbrial adhesins in either swine or human isolates, except for F4 and F18. However, according to a recent study, LT may play an important role in improving bacterial adhesion. Thus, there is a possibility of cross infection with pathogenic E. coli between swine and patients [31].
Antimicrobial resistance was more common in swine isolates than in human isolates, which is in line with an earlier study [32,33]. This suggests that antimicrobial drugs are more frequently used in swine farming than in human medicine. Because antimicrobial use is not subject to tight control in Korea [34], non-specialists, such as livestock workers, may use antimicrobials indiscriminately, potentially increasing antimicrobial resistance. We found significantly higher resistance to several antimicrobials (aminoglycosides, quinolones, fluoroquinolones, tetracyclines, folate pathway inhibitors, and phenicols) in swine isolates than in patients. The highest rate of resistance was found in swine isolates, and resistance was found in drug classes approved for use in swine, indicating that pig antimicrobial usage may have contributed to the development of antimicrobial resistance in E. coli [35]. As these antimicrobial agents are used to treat human intestinal infections, lowering resistance to them is critical.
Fluoroquinolones are the most effective treatment for colibacillosis and have been routinely used in pig farms across the country [35,36]. As fluoroquinolones are useful in both human and animal medicine, they have been categorized as “critically important antimicrobial agents” by the World Health Organization and the World Organization for Animal Health [37]. A previous study found that Korean swine had high ciprofloxacin resistance (34.5%) [38], which is consistent with our findings. According to the results of this study, the resistance rate of swine isolates for ciprofloxacin was higher in Korea than in other advanced swine-farming countries (the Netherlands: 1.0%; Sweden: 0.0%; United States (US): 0.0%) where restrictions on the use of antimicrobials are tight [39,40]. This could be explained by the fact that fluoroquinolones are widely used for therapeutic and self-treatment purposes for livestock in Korea (quinolone sales: 44,380 kg). Furthermore, swine isolates had stronger resistance to ciprofloxacin (37.5% vs. 16.1% in patients) and norfloxacin (29.7% vs. 16.1%, respectively) than patient samples. Due to the possibility that fluoroquinolone resistance in swine could be transmitted to humans [41], it poses a public health risk, necessitating the development of an antimicrobial resistance reduction plan. Therefore, more control measures are required to limit ciprofloxacin resistance.
Aminoglycosides have been the principal choice for controlling colibacillosis since their introduction for clinical use in the mid-1990s, both in veterinary and human medicine [35,42]. In this study, there were higher rates of gentamicin resistance (51.8%) in Korea than in other advanced countries (US: 0.0%; Australia: 7.4%) [40,43]. Gentamicin is no longer used in the production of swine in advanced countries [43]; however, in Korea, gentamicin is still frequently used for the treatment of colibacillosis [5]. Korea has a high level of gentamicin resistance because of differences in antimicrobial agent use. Moreover, we found that swine isolates had significantly higher resistance to some aminoglycosides, including gentamicin, kanamycin, and amikacin, than patient isolates. Aminoglycosides are only used to treat severe infections in humans due to the risk of adverse effects such as sensorineural hearing loss and chronic kidney disease [44]. In contrast, aminoglycosides can be used to treat neonatal and post-weaning diarrhea in swine [44,45].
Treatment with aminoglycosides in swine can result in cross resistance to vital human antibiotics, such as amikacin, which is a serious health issue [43]. In this study, higher multidrug resistance (swine: 95.3%; patients: 88.8%) was observed in Korea than in other studies (in swine: the Netherlands: 34.2%, China: 84.2%, and Thailand: 84.6% [4,32,46]; and in humans: the Netherlands: 7.1%, China: 15.2%, and Thailand: 45.7% [14,46,47]). Compared to other Organization for Economic Co-operation and Development members, Korea uses antimicrobials in veterinary medicine at a rate of 33.2 defined daily doses (DDD) per 1000 people per day and in human medicine at a rate of 31.7 DDD per 1000 people per day (21.3 and 23.7 DDD per 1000 inhabitants per day, respectively) [48,49]. In addition to the potential impact of repeated exposure to therapeutic medicines leading to enhanced selective pressure, a cofactor such as the transfer of resistance genes and the spread of resistant isolates due to poor infection control could contribute to the rising prevalence of antimicrobial resistance among pathogens [16].
Antimicrobial resistance is closely linked to obstacles in treatment; thus, it is critical to manage antimicrobial resistance. In this study, we analyzed the virulence genes and antimicrobial resistance phenotypes of E. coli isolated from swine and patients suffering from diarrhea. The Stx2(e) gene, can cause serious diseases, including edema in swine and hemorrhagic colitis in humans, was found in both swine and human isolates. Antimicrobial resistance was much greater in swine isolates than in human isolates, particularly fluoroquinolones and aminoglycosides. These results could be valuable for the development of preventive and treatment strategies for enteric colibacillosis.
The utilization of MLST enables the establishment of phylogenetic connections among profound lineages, which presents an additional perspective on population structure [50]. The swine isolates examined in this investigation exhibited a limited number of STs (10 STs), whereas the patient isolates displayed a broader range of STs (36 STs). The primary STs found in swine were ST 1 (21 isolates, 31.8%) and ST 100 (21 isolates, 31.8%). This implies a comparable etiology of enteric colibacillosis in swine. The findings of this study are consistent with those of prior investigations that established ST 1 and ST 100 isolates as the dominant ETEC subtypes and identified them as significant swine pathogens in various countries, including the US, Canada, Germany, and Thailand (
5. Conclusions
The presence of similar STs in swine and humans implies a potential risk of zoonotic disease emergence and cross-species transmission [55], as well as the possibility of transfer of antimicrobial resistance between the two populations in Korea.
Conception and study design: W.-K.L. (Wan-Kyu Lee); data acquisition: W.-K.L. (Woo-Kon Lee), M.J., K.-H.D. and K.S.; data analysis and/or interpretation: K.-H.D., K.S., W.-K.L. (Woo-Kon Lee) and M.J.; drafting and/or revision of the manuscript: K.-H.D., K.S. and W.-K.L. (Wan-Kyu Lee). All authors have read and agreed to the published version of the manuscript.
Not applicable.
Informed consent was obtained from all subjects involved in the study.
The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.
The pathogen resources from human for this study were provided by the National Collection for Pathogens.
The authors declare no conflict of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 1. Multidrug resistance of E. coli from diarrheic pigs and patients in Korea. Antimicrobial subclasses defined by the Clinical and Laboratory Standards Institute (CLSI) are used.
Enlarge this image.Figure 2. Minimum spanning tree based on sequence type of E. coli from pigs and patients. The divisions within each node are equal to the number of isolates belonging to the sequence type it represents. Black numbers in the circles indicate the MLST sequence type. Red numbers indicate the absolute distance between each sequence type. The node sizes vary linearly with the number of isolates of a given sequencing types.
Pathotypes and virotypes of Escherichia coli from diarrheic pigs and patients in Korea.
| Pathotype |
No. (%) of Pathogenic E. coli Isolates | Chi-Square |
Degrees of |
p-Value | ||
|---|---|---|---|---|---|---|
| Swine |
Patients |
Total |
||||
| ETEC * | 40 (47.1%) | 14 (23.0%) | 54 (37.0%) | 12.695 | 1 | 0.000 |
| F4:LT:STb:EAST1 * | 30 (75.0%) | - | 30 (55.6%) | 120.000 | 1 | 0.000 |
| ST * | - | 5 (35.7%) | 5 (9.3%) | 43.902 | 1 | 0.000 |
| F4:paa:LT:STb:EAST1 * | 1 (2.5%) | 3 (21.4%) | 4 (7.4%) | 15.341 | 1 | 0.000 |
| LT * | - | 3 (21.4%) | 3 (5.6%) | 23.464 | 1 | 0.000 |
| LT:ST * | - | 3 (21.4%) | 3 (5.6%) | 23.464 | 1 | 0.000 |
| F18:AIDA * | 2 (5.0%) | - | 2 (3.7%) | 5.128 | 1 | 0.024 |
| F4:F18:LT:STa:STb:EAST1 * | 2 (5.0%) | - | 2 (3.7%) | 5.128 | 1 | 0.024 |
| AIDA:STb:EAST1 | 1 (2.5%) | - | 1 (1.9%) | 3.046 | 1 | 0.081 |
| F18:LT:STa:STb:EAST1 | 1 (2.5%) | - | 1 (1.9%) | 3.046 | 1 | 0.081 |
| F18:paa:AIDA:STb:EAST1 | 1 (2.5%) | - | 1 (1.9%) | 3.046 | 1 | 0.081 |
| F5:paa | 1 (2.5%) | - | 1 (1.9%) | 3.046 | 1 | 0.081 |
| STEC * | 28 (32.9%) | 31 (50.8%) | 59 (40.4%) | 6.650 | 1 | 0.010 |
| F18:AIDA:stx 2e * | 14 (50.0%) | - | 14 (23.7%) | 66.667 | 1 | 0.000 |
| stx1:stx 2 * | - | 12 (38.7%) | 12 (20.3%) | 48.447 | 1 | 0.000 |
| stx1 * | - | 11 (35.5%) | 11 (18.6%) | 43.902 | 1 | 0.000 |
| stx2 * | - | 8 (25.8%) | 8 (13.6%) | 29.885 | 1 | 0.000 |
| F18:stx2:stx2e * | 7 (25.0%) | - | 7 (11.9%) | 28.571 | 1 | 0.000 |
| F18:stx2e * | 4 (14.3%) | - | 4 (6.8%) | 15.054 | 1 | 0.000 |
| F18:AIDA:stx2:stx2e * | 3 (10.7%) | - | 3 (5.1%) | 11.640 | 1 | 0.001 |
| EAEC * | - | 3 (4.9%) | 3 (2.1%) | 5.128 | 1 | 0.024 |
| aggR * | - | 3 (100.0%) | 3 (100.0%) | 200.000 | 1 | 0.000 |
| EIEC | - | 1 (1.6%) | 1 (0.7%) | 2.020 | 1 | 0.155 |
| ipaH * | - | 1 (100.0%) | 1 (100.0%) | 200.000 | 1 | 0.000 |
| EPEC | - | 1 (1.6%) | 1 (0.7%) | 2.020 | 1 | 0.155 |
| eae * | - | 1 (100.0%) | 1 (100.0%) | 200.000 | 1 | 0.000 |
| ETEC/STEC * | 17 (20.0%) | 2 (3.3%) | 19 (13.0%) | 14.198 | 1 | 0.000 |
| F18:LT:STa:stx2e * | 5 (29.4%) | - | 5 (26.3%) | 35.294 | 1 | 0.000 |
| F18:st × 2:stx2e:EAST1 * | 5 (29.4%) | - | 5 (26.3%) | 35.294 | 1 | 0.000 |
| F18:LT:stx2e * | 3 (17.6%) | - | 3 (15.8%) | 19.780 | 1 | 0.000 |
| F18:paa:STa:stx2e * | 2 (11.8%) | - | 2 (10.5%) | 12.766 | 1 | 0.000 |
| F18:stx2e:EAST1 * | 2 (11.8%) | - | 2 (10.5%) | 12.766 | 1 | 0.000 |
| F18:paa:LT:STa:stx2:stx2e * | - | 1 (50.0%) | 1 (5.3%) | 66.667 | 1 | 0.000 |
| F18:paa:LT:STb:st × 2:stx2e:EAST1 * | - | 1 (50.0%) | 1 (5.3%) | 66.667 | 1 | 0.000 |
| STEC/EPEC * | - | 3 (4.9%) | 3 (2.1%) | 5.128 | 1 | 0.024 |
| stx1:eae * | - | 3 (100.0%) | 3 (100.0%) | 200.000 | 1 | 0.000 |
| STEC/EAEC * | - | 3 (4.9%) | 3 (2.1%) | 5.128 | 1 | 0.024 |
| stx2:aggR * | - | 3 (100.0%) | 3 (100.0%) | 200.000 | 1 | 0.000 |
| Undetected * | - | 3 (4.9%) | 3 (2.1%) | 5.128 | 1 | 0.000 |
* Significant difference between origins of isolates (p < 0.05).
Antimicrobial resistance of Escherichia coli from diarrheic pigs and patients.
| Antimicrobial Agent 1 | No. (%) of Resistant Isolates | Chi-Square |
Degrees of |
p-Value | |||
|---|---|---|---|---|---|---|---|
| Swine |
Patients |
Total |
|||||
| Aminoglycosides | GM * | 44 (51.8%) | 11 (18.0%) | 55 (37.7%) | 25.407 | 1 | 0.000 |
| S | 59 (69.4%) | 36 (59.0%) | 95 (65.1%) | 2.170 | 1 | 0.104 | |
| N * | 44 (51.8%) | 18 (29.5%) | 62 (42.5%) | 10.004 | 1 | 0.002 | |
| K * | 76 (89.4%) | 25 (41.0%) | 101 (69.2%) | 50.637 | 1 | 0.000 | |
| AN * | 64 (75.3%) | 2 (3.3%) | 66 (45.2%) | 108.953 | 1 | 0.000 | |
|
β-lactam/
|
AMC * | 31 (36.5%) | 44 (72.1%) | 75 (51.4%) | 24.700 | 1 | 0.000 |
| Cephalosporin 1 | CF | 35 (41.2%) | 26 (42.6%) | 61 (41.8%) | 0.082 | 1 | 0.774 |
| CZ | 29 (34.1%) | 16 (26.2%) | 45 (30.8%) | 1.524 | 1 | 0.217 | |
| Cephalosporin 2 | FOX | 25 (29.4%) | 12 (19.7%) | 37 (25.3%) | 2.667 | 1 | 0.139 |
| Cephalosporin 4 | FEP | 0 (0.0%) | 2 (3.3%) | 2 (1.4%) | 3.046 | 1 | 0.081 |
| Quinolone | NA * | 60 (70.6%) | 31 (50.8%) | 91 (62.3%) | 8.407 | 1 | 0.004 |
| Fluoroquinolone | CIP * | 35 (41.2%) | 12 (19.7%) | 47 (32.2%) | 10.402 | 1 | 0.001 |
| NOR * | 28 (32.9%) | 11 (18.0%) | 39 (26.7%) | 5.922 | 1 | 0.015 | |
| Tetracyclines | TE * | 74 (87.1%) | 31 (50.8%) | 105 (71.9%) | 30.295 | 1 | 0.000 |
| DOX * | 68 (80.0%) | 18 (29.5%) | 86 (58.9%) | 50.505 | 1 | 0.000 | |
| Aminopenicillin | AMP | 74 (87.1%) | 47 (77.0%) | 121 (82.9%) | 3.388 | 1 | 0.066 |
| Folate pathway inhibitors | SXT * | 48 (56.5%) | 21 (34.4%) | 69 (47.3%) | 10.666 | 1 | 0.001 |
| Phenicols | C * | 72 (84.7%) | 21 (34.4%) | 93 (63.7%) | 53.968 | 1 | 0.000 |
| Polymyxins | CL | 1 (1.2%) | 0 (0.0%) | 1 (0.7%) | 1.005 | 1 | 0.316 |
| Lincosamide | CC | 85 (100.0%) | 61 (100.0%) | 146 (100.0%) | Not available | Not available | Not available |
1 GM: gentamicin; S: streptomycin; N: neomycin; CF: cephalothin; CZ: cefazolin; FEP: cefepime; FOX: cefoxitin; NA: nalidixic acid; CIP: ciprofloxacin; NOR: norfloxacin; AMP: ampicillin; AMC: amoxicillin/clavulanic acid; SXT: trimethoprim/sulfamethoxazole; C: chloramphenicol; CL: colistin; TE: tetracycline. * Significant difference between origins of isolates (p < 0.05).
References
1. Rhouma, M.; Beaudry, F.; Thériault, W.; Bergeron, N.; Laurent-Lewandowski, S.; Fairbrother, J.M.; Letellier, A. Impacts of colistin sulfate on fecal Escherichia coli resistance and on growth. Safepork Posters; 2005; pp. 361-365.
2. Do, K.-H.; Byun, J.-W.; Lee, W.-K. Antimicrobial resistance, adhesin and toxin genes of porcine pathogenic Escherichia coli following the ban on antibiotics as the growth promoters in feed. Pak. Vet. J.; 2021; 41, pp. 519-523.
3. Joseph, A.; Cointe, A.; Mariani Kurkdjian, P.; Rafat, C.; Hertig, A. Shiga toxin-associated hemolytic uremic syndrome: A narrative review. Toxins; 2020; 12, 67. [DOI: https://dx.doi.org/10.3390/toxins12020067] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31973203]
4. European Food Safety AuthorityEuropean Centre for Disease Prevention and Control. The European Union Summary Report on antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2018/2019. EFSA J.; 2021; 19, e06490.
5. Animal and Plant Quarantine Agency (APQA). Antimicrobial Use and Antimicrobial Resistance Monitoring in Animals and Animal Products; Animal and Plant Quarantine Agency (APQA): Gimcheon, Republic of Korea, 2019.
6. Szmolka, A.; Nagy, B. Multidrug resistant commensal Escherichia coli in animals and its impact for public health. Front. Microbiol.; 2013; 4, 258. [DOI: https://dx.doi.org/10.3389/fmicb.2013.00258]
7. Iguchi, A.; Iyoda, S.; Seto, K.; Morita-Ishihara, T.; Scheutz, F.; Ohnishi, M. Pathogenic, E. coli Working Group in Japan Escherichia coli O-genotyping PCR: A comprehensive and practical platform for molecular O serogrouping. J. Clin. Microbiol.; 2015; 53, pp. 2427-2432.
8. Bai, X.; Hu, B.; Xu, Y.; Sun, H.; Zhao, A.; Ba, P.; Fu, S.; Fan, R.; Jin, Y.; Wang, H. et al. Molecular and phylogenetic characterization of non-O157 Shiga Toxin-producing Escherichia coli strains in China. Front. Cell Infect. Microbiol.; 2016; 6, 143. [DOI: https://dx.doi.org/10.3389/fcimb.2016.00143]
9. Do, K.H.; Byun, J.W.; Lee, W.K. Prevalence of O-serogroups, virulence genes, and F18 antigenic variants in Escherichia coli isolated from weaned piglets with diarrhea in Korea during 2008–2016. J. Vet. Sci.; 2019; 20, pp. 43-50. [DOI: https://dx.doi.org/10.4142/jvs.2019.20.1.43]
10. Jaureguy, F.; Landraud, L.; Passet, V.; Diancourt, L.; Frapy, E.; Guigon, G.; Carbonnelle, E.; Laortholary, O.; Clermont, O.; Denamur, E. et al. Phylogenetic and genomic diversity of human bacteremic Escherichia coli strains. BMC Genom.; 2008; 9, 560. [DOI: https://dx.doi.org/10.1186/1471-2164-9-560]
11. CLSI. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fourth Informational Supplement; M100-S24 CLSI: Wayne, PA, USA, 2020.
12. Bauer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol.; 1966; 45, pp. 493-496. [DOI: https://dx.doi.org/10.1093/ajcp/45.4_ts.493]
13. Magiorakos, A.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B. et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect.; 2011; 18, pp. 268-281. [DOI: https://dx.doi.org/10.1111/j.1469-0691.2011.03570.x]
14. Paul, N. Review Virulence nature of Escherichia coli in neonatal swine. Online J. Anim. Feed Res.; 2015; 5, pp. 169-174.
15. Sinwat, N.; Angkittitrakul, S.; Coulson, K.F.; Pilapil, F.M.I.R.; Meunsene, D.; Chuanchuen, R. High prevalence and molecular characteristics of multidrug-resistant Salmonella in pigs, pork and humans in Thailand and Laos provinces. J. Med. Microbiol.; 2016; 65, pp. 1182-1193. [DOI: https://dx.doi.org/10.1099/jmm.0.000339] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27542886]
16. Boerlin, P.; McEwen, S.A.; Boerlin-Petzold, F.; Wilson, J.B.; Johnson, R.P.; Gyles, C.L. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J. Clin. Microbiol.; 1999; 37, pp. 497-503. [DOI: https://dx.doi.org/10.1128/JCM.37.3.497-503.1999]
17. Lee, J.H.; Cho, H.T.; Kim, Y.H.; Kang, H.J.; Cha, I.H. Isolation of enteropathogenic Escherichia coli, thermophilic Campylobacter and Salmonelleae from scouring piglets. Korean J. Vet. Res.; 1988; 28, pp. 67-73.
18. Do, K.-H.; Byun, J.-W.; Lee, W.-K. Serogroups, virulence genes and antimicrobial resistance of F4+ and F18+ Escherichia coli isolated from weaned piglets. Pak. Vet. J.; 2019; 39, pp. 266-270. [DOI: https://dx.doi.org/10.29261/pakvetj/2019.021] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32704333]
19. Duan, Q.; Nandre, R.; Zhou, M.; Zhu, G. Type I fimbriae mediate in vitro adherence of porcine F18ac+ enterotoxigenic Escherichia coli (ETEC). Ann. Microbiol.; 2017; 67, pp. 793-799. [DOI: https://dx.doi.org/10.1007/s13213-017-1305-z]
20. Kwon, D.; Choi, C.; Jung, T.; Chung, H.K.; Kim, J.P.; Bae, S.S.; Cho, W.S.; Kim, J.; Chae, C. Genotypic prevalence of the fimbrial adhesins (F4, F5, F6, F41 and F18) and toxins (LT, STa, STb and Sbc2e) in Escherichia coli isolated from postweaning pigs with diarrhoea or oedema disease in Korea. Vet. Rec.; 2002; 150, pp. 35-37. [DOI: https://dx.doi.org/10.1136/vr.150.2.35] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11829064]
21. Lee, S.I.; Rayamahji, N.; Lee, W.J.; Cha, S.B.; Shin, M.K.; Roh, Y.M.; Yoo, H.S. Genotypes, antibiogram, and pulsed-field gel electrophoresis profiles of Escherichia coli strains from piglets in Korea. J. Vet. Diagn. Investig.; 2009; 21, pp. 510-516. [DOI: https://dx.doi.org/10.1177/104063870902100413]
22. Do, K.H.; Park, H.E.; Byun, J.W.; Lee, W.K. Virulence and antimicrobial resistance profiles of Escherichia coli encoding mcr gene from diarrhoeic weaned piglets in Korea during 2007–2016. J. Glob. Antimicrob. Resist.; 2020; 20, pp. 324-327. [DOI: https://dx.doi.org/10.1016/j.jgar.2019.09.010]
23. Jung, J.; Kim, H.; Jo, A.; Kim, J.; Lee, W.; Byun, J. Enrichment media for Stx2e production in Shiga toxin-producing Escherichia coli. J. Biomed. Transl. Res.; 2017; 18, pp. 103-107. [DOI: https://dx.doi.org/10.12729/jbtr.2017.18.3.103]
24. Lee, J.B.; Han, D.; Lee, H.T.; Wi, S.M.; Park, J.H.; Jo, J.W.; Cho, Y.J.; Hahn, T.W.; Lee, S.; Kang, B. et al. Pathogenic and phylogenetic characteristics of non-O157 Shiga toxin-producing Escherichia coli isolates from retail meats in South Korea. J. Vet. Sci.; 2018; 19, pp. 251-259. [DOI: https://dx.doi.org/10.4142/jvs.2018.19.2.251] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29284205]
25. Waddell, T.E.; Lingwood, C.A.; Gyles, C.L. Interaction of verotoxin 2e with pig intestine. Infect. Immun.; 1966; 64, pp. 1714-1719. [DOI: https://dx.doi.org/10.1128/iai.64.5.1714-1719.1996] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/8613382]
26. Neut, C. Carriage of multidrug-resistant bacteria in healthy people: Recognition of several risk groups. Antibiotics; 2021; 10, 1163. [DOI: https://dx.doi.org/10.3390/antibiotics10101163]
27. Luppi, A. Swine enteric colibacillosis: Diagnosis, therapy and antimicrobial resistance. Porc. Health Manag.; 2017; 3, 16. [DOI: https://dx.doi.org/10.1186/s40813-017-0063-4]
28. Niewerth, U.; Frey, A.; Voss, T.; Le Bouguénec, C.; Baljer, G.; Franke, S.; Schmidt, M.A. The AIDA autotransporter System Is Associated with F18 and Stx2e in Escherichia coli Isolates from Pigs Diagnosed with edema Disease and Postweaning diarrhea. Clin. Diagn. Lab. Immunol.; 2001; 8, pp. 143-149. [DOI: https://dx.doi.org/10.1128/CDLI.8.1.143-149.2001] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11139209]
29. Zhang, W.; Zhao, M.; Ruesch, L.; Omot, A.; Francis, D. Prevalence of virulence genes in Escherichia coli strains recently isolated from young pigs with diarrhea in the US. Vet. Microbiol.; 2007; 123, pp. 145-152. [DOI: https://dx.doi.org/10.1016/j.vetmic.2007.02.018] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17368762]
30. Zhao, L.; Chen, X.; Xu, X.; Song, G.; Liu, X. Analysis of the AIDA-I gene sequence and prevalence in Escherichia coli isolates from pigs with post-weaning diarrhoea and oedema disease. Vet. J.; 2009; 180, pp. 124-129. [DOI: https://dx.doi.org/10.1016/j.tvjl.2007.10.021] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18077196]
31. Duan, Q.; Xia, P.; Nandre, R.; Zhang, W.; Zhu, G. Review of newly identified functions associated with the heat-labile toxin of enterotoxigenic Escherichia coli. Front. Cell Infect. Microbiol.; 2019; 9, 292. [DOI: https://dx.doi.org/10.3389/fcimb.2019.00292]
32. Pungpian, C.; Sinwat, N.; Angkititrakul, S.; Prathan, R.; Chuanchuen, R. Presence and Transfer of antimicrobial Resistance Determinants in Escherichia coli in Pigs, Pork, and Humans in Thailand and Lao PDR Border Provinces. Microb. Drug Resist.; 2021; 27, pp. 571-584. [DOI: https://dx.doi.org/10.1089/mdr.2019.0438]
33. Brilhante, M.; Perreten, V.; Donà, V. Multidrug resistance and multivirulence plasmids in enterotoxigenic and hybrid Shiga toxin-producing/enterotoxigenic Escherichia coli isolated from diarrheic pigs in Switzerland. Vet. J.; 2019; 244, pp. 60-68. [DOI: https://dx.doi.org/10.1016/j.tvjl.2018.12.015] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30825896]
34. Do, K.H.; Byun, J.W.; Lee, W.K. Virulence genes and antimicrobial resistance of pathogenic Escherichia coli isolated from diarrheic weaned piglets in Korea. J. Anim. Sci. Technol.; 2020; 62, pp. 543-552. [DOI: https://dx.doi.org/10.5187/jast.2020.62.4.543] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32803186]
35. Schroeder, C.M.; Zhao, C.; DebRoy, C.; Torcolini, J.; Zhao, S.; White, D.G.; Wagner, D.D.; McDermott, P.F.; Walker, R.D.; Meng, J. Antimicrobial resistance of Escherichia coli O157 isolated from humans, cattle, swine, and food. Appl. Environ. Microbiol.; 2002; 68, pp. 576-581. [DOI: https://dx.doi.org/10.1128/AEM.68.2.576-581.2002] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11823193]
36. Davies, R.; Wales, A. Antimicrobial resistance on farms: A review including biosecurity and the potential role of disinfectants in resistance selection. Compr. Rev. Food Sci. Food Saf.; 2019; 18, pp. 753-774. [DOI: https://dx.doi.org/10.1111/1541-4337.12438]
37. FAO. Joint FAO/WHO/OIE expert meeting on critically important antimicrobials. Proceedings of the FAO/WHO/OIE Expert Meeting FAO Headquarters; Rome, Italy, 26–30 November 2007.
38. Hu, Y.S.; Shin, S.; Park, Y.H.; Park, K.T. Prevalence and mechanism of fluoroquinolone resistance in Escherichia coli isolated from swine feces in Korea. J. Food Prot.; 2017; 80, pp. 1145-1151. [DOI: https://dx.doi.org/10.4315/0362-028X.JFP-16-502]
39. Van Den Bogaard, A.E.J.M.; London, N.; Stobberingh, E.E. Antimicrobial resistance in pig faecal samples from the Netherlands (five abattoirs) and Sweden. J. Antimicrob. Chemother.; 2000; 45, pp. 663-671. [DOI: https://dx.doi.org/10.1093/jac/45.5.663]
40. Sayah, R.S.; Kaneene, J.B.; Johnson, Y.; Miller, R. Patterns of antimicrobial resistance observed in Escherichia coli isolates obtained from domestic- and wild-animal fecal samples, human Septage, and surface water. Appl. Environ. Microbiol.; 2005; 71, pp. 1394-1404. [DOI: https://dx.doi.org/10.1128/AEM.71.3.1394-1404.2005]
41. Barton, M.D. Impact of antibiotic use in the swine industry. Curr. Opin. Microbiol.; 2014; 19, pp. 9-15. [DOI: https://dx.doi.org/10.1016/j.mib.2014.05.017]
42. Zarrilli, R.; Tripodi, M.F.; Di Popolo, A.; Fortunato, R.; Bagattini, M.; Crispino, M.; Florio, A.; Triassi, M.; Utili, R. Molecular epidemiology of high-level aminoglycoside-resistant enterococci isolated from patients in a university hospital in southern Italy. J. Antimicrob. Chemother.; 2005; 56, pp. 827-835. [DOI: https://dx.doi.org/10.1093/jac/dki347]
43. van Breda, L.K.; Dhungyel, O.P.; Ward, M.P. Antibiotic resistant Escherichia coli in southeastern Australian pig herds and implications for surveillance. Zoonoses Publ. Health; 2018; 65, pp. e1-e7. [DOI: https://dx.doi.org/10.1111/zph.12402]
44. Jackson, C.R.; Fedorka-Cray, P.J.; Barrett, J.B.; Ladely, S.R. High-level aminoglycoside resistant enterococci isolated from swine. Epidemiol. Infect.; 2005; 133, pp. 367-371. [DOI: https://dx.doi.org/10.1017/S0950268804003395]
45. Aarestrup, F.M.; Oliver Duran, C.; Burch, D.G.S. Antimicrobial resistance in swine production. Anim. Health Res. Rev.; 2008; 9, pp. 135-148. [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18983723]
46. Pan, Y.; Hu, B.; Bai, X.; Yang, X.; Cao, L.; Liu, Q.; Sun, H.; Li, J.; Zhang, J.; Dong, J. et al. Antimicrobial resistance of non-O157 Shiga toxin-producing Escherichia coli isolated from humans and domestic animals. Antibiotics; 2021; 10, 74. [DOI: https://dx.doi.org/10.3390/antibiotics10010074]
47. Johnson, T.J.; Logue, C.M.; Johnson, J.R.; Kuskowski, M.A.; Sherwood, J.S.; Barnes, H.J.; DebRoy, C.; Wannemuehler, Y.M.; Obata-Yasuoka, M.; Spanjaard, L. et al. Associations between multidrug resistance, plasmid content, and virulence potential among extraintestinal pathogenic and commensal Escherichia coli from humans and poultry. Foodborne Pathog. Dis.; 2012; 9, pp. 37-46. [DOI: https://dx.doi.org/10.1089/fpd.2011.0961] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21988401]
48. Korea Institute for Health and Social Affairs. Drug Use Evaluation; Korea Institute for Health and Social Affairs: Seoul, Republic of Korea, 2000.
49. Organization for Economic Co-operation and Development. Antimicrobial Resistance. OECD. Available online: http://www.oecd.org/els/health-systems/antimicrobial-resistance.htm (accessed on 19 October 2022).
50. Chattaway, M.A.; Day, M.; Mtwale, J.; White, E.; Rogers, J.; Day, M.; Powell, D.; Ahmad, M.; Harris, R.; Talukder, K.A. et al. Clonality, virulence and antimicrobial resistance of enteroaggregative Escherichia coli from Mirzapur, Bangladesh. J. Med. Microbiol.; 2017; 66, pp. 1429-1435. [DOI: https://dx.doi.org/10.1099/jmm.0.000594] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28945190]
51. Yu, F.; Chen, X.; Zheng, S.; Han, D.; Wang, Y.; Wang, R.; Wang, B.; Chen, Y. Prevalence and genetic diversity of human diarrheagenic Escherichia coli isolates by multilocus sequence typing. Int. J. Infect. Dis.; 2018; 67, pp. 7-13. [DOI: https://dx.doi.org/10.1016/j.ijid.2017.11.025] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29183841]
52. Savin, M.; Bierbaum, G.; Kreyenschmidt, J.; Schmithausen, R.M.; Sib, E.; Schmoger, S.; Kasbohrer, A.; Hammerl, J.A. Clinically relevant Escherichia coli isolates from process waters and wastewater of poultry and pig slaughterhouses in Germany. Microorganisms; 2021; 9, 698. [DOI: https://dx.doi.org/10.3390/microorganisms9040698]
53. Crémet, L.; Caroff, N.; Giraudeau, C.; Dauvergne, S.; Lepelletier, D.; Reynaud, A.; Corvec, S. Occurrence of ST23 complex phylogroup a Escherichia coli isolates producing extended-spectrum AmpC β-lactamase in a French hospital. Antimicrob. Agents Chemother.; 2010; 54, pp. 2216-2218. [DOI: https://dx.doi.org/10.1128/AAC.01580-09] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20145079]
54. Nicolas-Chanoine, M.H.; Blanco, J.; Leflon-Guibout, V.; Demarty, R.; Alonso, M.P.; Caniça, M.M.; Park, Y.J.; Lavigne, J.P.; Pitout, J.; Johnson, J.R. Intercontinental emergence of Escherichia coli clone O25:H4-ST131 producing CTX-M-15. J. Antimicrob. Chemother.; 2008; 61, pp. 273-281. [DOI: https://dx.doi.org/10.1093/jac/dkm464] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18077311]
55. Yang, C.; Shao, W.; Wei, L.; Chen, L.; Zhu, A.; Pan, Z. Subtyping Salmonella isolated from pet dogs with multilocus sequence typing (MLST) and clustered regularly interspaced short palindromic repeats (CRISPRs). AMB Express; 2021; 11, 60. [DOI: https://dx.doi.org/10.1186/s13568-021-01221-9]
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Woo-Kon, Lee 2
; Wan-Kyu, Lee 3 1 College of Veterinary Medicine, Chungbuk National University, Cheongju 28644, Republic of Korea
2 Department of Microbiology, College of Medicine, Gyeongsang National University, Jinju 52727, Republic of Korea
3 College of Veterinary Medicine, Chungbuk National University, Cheongju 28644, Republic of Korea; GutBiomeTech, Co., Ltd., Cheongju 28644, Republic of Korea