1. Introduction
Oral cancer is one of the most frequent malignant tumors worldwide, with major predominance seen in the populations of Southeast Asia and India [1,2]. In India, the oral cavity is one of the five leading sites of cancer, and 90% of these tumors are squamous cell carcinoma (SCC) [3,4]. The high incidence of oral cancer in India is due to addiction to tobacco chewing and smoking. A variety of tobacco habits are prevalent in India and they differ from region to region [5,6].
Chronic inflammation and cancer are interrelated. Inflammation is a chief component in the modulation of the tumor microenvironment [7,8]. The initiation, development, invasion, and metastasis of the neoplastic process are accompanied by inflammation and immune response. Furthermore, the survival of a tumor cell is based on sustained cellular proliferation and suppression of apoptosis regulation. Recently, the hematological parameters that are routinely measured, such as red cell distribution width (RDW), white blood cell count (WBC), platelet count (PLTC), and lymphocyte/monocyte ratio (LMR), are gaining attention as diagnostic and prognostic markers for gastric cancer, pancreatic adenocarcinoma, and non-small-cell lung cancer [9]. Studies have reported that tumor development and progression is induced by inflammatory response mediated through pro-inflammatory cytokines and nuclear factor kappa B (NF-kβ), signal transduction and activation of transcription factor 3 (STAT3) pathways [10,11,12,13] (Figure 1).
Oral smokeless tobacco consumed in betel quid containing betel leaf, areca nut, calcium hydroxide (slaked lime), and tobacco is a major cause of oral squamous cell carcinoma in the Indian subcontinent, parts of Southeast Asia, China, and Taiwan [14]. Areca nut and tobacco has been declared a known human carcinogen by an IARC Expert Group [14,15]. In India, tobacco chewing accounts for nearly 50% of cancers of the oral cavity in men and over 90% in women [16].
Tobacco contains tobacco-specific nitrosamines (TSNs), namely, 4-(nitrosomethylamino)-1-(3-pyridyl)-1-butanone (NNK) and N’-nitrosonornicotine (NNN). Animal studies have also shown that NNK and NNN in the tobacco products cause tumors of the oral cavity. NNK, NNN, and their metabolites covalently bind with deoxyribonucleic acid (DNA) in the cells, forming DNA adducts. These adducts are responsible for critical mutations involved in DNA replication [17].
A study by Quanri Jin et al. investigated the effects of the tobacco components nicotine and its related carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) on survivin expression in normal human bronchial epithelial (NHBE) cells and examined the role of survivin in the malignant transformation of normal human bronchial epithelial (HBE) cells induced by these components. They observed that survivin messenger RNA (mRNA) expression was detected in 41% of bronchial brush specimens from heavy smokers. Nicotine and NNK increased survivin mRNA and protein expression levels in primary cultured NHBE cells and immortalized HBE cells. Nicotine and NNK stimulated the Akt–mammalian target of rapamycin (mTOR) pathway in NHBE cells, leading to increased de novo synthesis of survivin protein [18].
Another study by Piyali Dasgupta et al. reported that nicotine inhibits apoptosis induced by the chemotherapeutic drugs gemcitabine, cisplatin, and taxol by upregulating XIAP (X-linked inhibitor of apoptosis protein) and survivin; they further inferred that the induction of survivin protein in non-small-cell lung cancer cells was through the Akt pathway [19].
Nicotine is a natural tobacco alkaloid chemically known as 3-(1-methyl-2-pyrrolidinyl) pyridine identified in oral and lung cancer as evidenced from in vitro and in vivo models [20,21]. Nicotine is reported to have an inhibitory effect on apoptosis through the phosphorylation of antiapoptotic protein, inducing NF-kβ complexes and the Akt-dependent pathway in lung cancer cells, which are known to reduce the action of chemotherapeutic drugs by upregulating survivin expression [19,22,23,24] (Figure 1). Despite this, peripheral blood-based biomarkers of tissue-based survivin in tobacco chewers with OSCC have not been studied so far. Therefore, we attempted to evaluate the pre-treatment clinical value of hematological parameters from a routine blood test and observed the association of these parameters with tissue survivin levels in habitual tobacco chewers with OSCC.
Figure 1Role of inflammatory cells and survivin protein in tumorigenesis [11,12,13,23,24]. a. Tumor initiation: Inflammatory cells neutrophils, lymphocytes, and macrophages aid in tumor initiation through secretion of multiple cytokines and chemokines; release of reactive oxygen and nitrogen species damage the cellular DNA and cause genomic instability; inactivation of tumor-suppressor genes such as cyclin-dependent kinase inhibitor protein (INK4A) and the adenomatous polyposis coli gene (APC); and overexpression of growth factors and cytokines. b. Tumor progression: Cytokines release transcription factors such as nuclear factor kappa B subunit (NFkB), signal transducer and activator of transcription 3 (STAT3), activator protein 1 (AP 1); nicotine upregulates the expression of survivin by inducing NF-kβ complexes and through the Akt-dependent pathway brings about cell survival, inhibition of apoptosis, and progression of the tumor. c. Angiogenesis: Cytokines stimulate the production of hypoxia inducible factor alpha (HIFα) that activates and recruits endothelial cells; survivin induces the proliferation of endothelial cells and expression of vascular endothelial growth factor (VEFG). VEGF activates the PI3K and Akt pathways; nicotine is also known to activate the Akt pathway, all of which stimulate angiogenesis. d. Invasion and metastasis: Survivin enhances NFkB-dependent transcription of fibronectin and promotes tumor cell invasion and metastasis.
[Figure omitted. See PDF]
Survivin protein is the smallest member of the inhibitor of apoptosis protein (IAP) family, known to be involved in cell cycle regulation, inhibition of apoptosis, and microtubule stability [25]. It is a 16.5 kDa monomer protein with 142 amino acid residues coded by the Baculoviral IAP Repeat Containing 5 (BIRC5) gene located on human chromosome 17q25.3 that spans 14.7 kb at the telomeric end [26].
Survivin overexpression has been reported in human malignancies, such as breast (90.2%) [27,28], liver (87%) [29,30], bladder (57.8%) [31,32], stomach (68%) [33,34], oral (>75%) [35,36], and hematological malignancies (68%) [37], and its expression levels were observed to correlate with tumor stage or response to therapy [38]. The research findings suggested that survivin may serve as a biomarker in cancerous conditions. Our earlier research mentioned the quantitative estimation of tissue survivin and caspase 3 among the population addicted to tobacco chewing, in tobacco chewers with oral cancer [39].
The expression of survivin in a cell takes place in a cell cycle-regulated manner, and the peak levels of survivin are observed in the G2/M phase of the cell cycle [40,41,42]. In their study, Srivastava K et al. described the regulation of survivin expression to be transcriptionally controlled involving cell cycle-dependent elements (CDEs) and cell cycle homology regions (CHRs) located on the survivin gene promoter region [43]. Population-based studies on survivin expression by Nassar et al., Ryan BM et al., and Khan S et al. indicated survivin gene polymorphisms to be associated with human cancers [44,45,46]. In addition, -31G/C polymorphism was reported as a common mutation observed in cancer cell lines, resulting in the overexpression of survivin [47]. A study by Chan H Han et al. on survivin promoter polymorphisms (-1547 A/G,-644C/T,-625C/G,-241C/T and -31G/C) and their association with the age of onset of ovarian cancer observed that -625C/G was persistently involved in ovarian cancer compared to other polymorphisms [48]. The genetic variant -31G/C in the survivin promoter region has been identified as associated with the overexpression of survivin and increased risk for lung cancer and esophageal cancer [49,50]. The above studies were based on meta-analysis and the Restriction Fragment Length Polymorphism (RFLP) technique. Gene sequencing and nucleotide variants analysis, however, will help identify unique mutations and SNPs in the promoter regions in cancers in relation to the presence of causative factors.
A study by Xun C et al. on the mutation profile of oral squamous cell carcinoma cells reported that the C > T transition variant was the commonest mutation observed in the CpG dinucleotide region of the genes in tongue cancer cell lines [51]. They also analyzed mutations in a spectrum of 20 cancer genes and reported mutations in oral cancer were quite different from those in other tumors. Single nucleotide polymorphism (SNP) at the TP53 exon 4 codon 72 was observed as a risk factor for development of cancer, including OSCC, since variants in the coding regions of the genes can affect the expressed protein of the gene functionally [52]. A study by R. Ralhan et al. reported that the potentially malignant and cancerous lesions in the oral cavity harboring missense mutations of TP53 at codons 126,136, and 174 showed accumulation of p53 protein and its circulating antibodies [53]. However, as far as our knowledge on BIRC5/survivin is concerned and per the literature search, there are no studies available on the complete gene sequencing of the coding regions of the BIRC5 gene in tobacco chewers with OSCC.
The cumulative information on survivin’s role in carcinogenesis in relation to OSCC is limited, and the genetic evidence in humans is not available in association with oral cancer, particularly OSCC caused by tobacco. Therefore, we aimed to quantify the survivin protein and to sequence and analyze the BIRC5 gene sequence data to understand the molecular basis of the role of survivin in OSCC, which will be helpful in the future in community screening for the detection and management strategies of OSCC.
2. Materials and Methods
2.1. Patients
The study design was a single centric case control consisting of a total of 189 participants enrolled by the Dept. of Otorhinolaryngology and Head and Neck Surgery, R.L. Jalappa Hospital and Research Center, a rural referral tertiary care hospital attached to the Sri Devaraj Urs Medical College, Tamaka, Kolar, Karnataka, India. Individuals aged 30–65 years were included in the study and categorized into Group I (n = 63), habitual tobacco chewers with clinically proven OSCC cases; Group 2 (n = 63), habitual tobacco chewers without OSCC; and Group 3 (n = 63) healthy subjects as controls. The study was approved by the Central Ethics Committee of the University in a vide No. SDUAHER/KLR/CEC/33/2018-19 dated 14 May 2018. The inclusion criteria for subjects in the study were known habitual tobacco chewers with OSCC, habitual tobacco chewers without OSCC, and healthy controls with no history of addiction to tobacco or alcohol. Patients with a history of onco-surgery or neoadjuvant chemotherapy or with an immunodeficiency, recurrent or chronic ulcerative lesions of the oral cavity such as pemphigus/Behcet’s syndrome, or who had undergone radiotherapy, were excluded from the study.
2.2. Methods
2.2.1. Sample Collection
Buccal tissue specimens resected from the buccal mucosal from Group 1 OSCC cases were collected in a phosphate buffered saline (PBS) (pH 7.2–7.4). Tissue homogenate was prepared. After the participants rinsed their mouths thoroughly with distilled water, buccal cell scrapings were obtained from the Group 2 and Group 3 subjects with soft buccal brushes supplied from the Puregene Buccal Cell Kit from Qiagen, Germantown, MD, USA, as per the procedure described [54]. The cell viability and count were determined using trypan blue stain and counted using a hemocytometer.
2.2.2. Human Survivin Assay
The supernatant obtained from the buccal tissue homogenate in the above step was used for estimation of human survivin. The sandwich ELISA method was used as per the kit procedure (K12-5528, kinesis Dx, Los Angeles, CA, USA). The assay range of human survivin was 31.259 to 200 pg/mL.
2.2.3. Pretreatment Hematological Parameters
The retrospective pretreatment hematological secondary data of OSCC patients were obtained from the medical records section. The hematological parameters comprised the counts of total white blood cells (WBCs), neutrophils, lymphocytes, monocytes, platelets, red blood cells (RBCs), packed cell volume (PCV), and hemoglobin concentration using a cell counter (SYSMEX XN, Kobe, Japan). From this data the neutrophil/lymphocyte ratio (NLR), lymphocyte/monocyte ratio (LMR), and platelet lymphocyte ratio (PLR) were calculated and presented.
2.2.4. Evidence of Tissue Survivin Protein by Immunohistochemistry
The tissue content of survivin was determined by using 4 µm thickness sections from 10% formalin-fixed paraffin embedded tissues. Antigen retrieval was performed with citrate buffer pH 9 using a decloaker, primary mouse monoclonal antibodies against survivin (IHC 668, GenomeMe, GenomeMe Lab Inc., Richmond, BC, Canada), and a secondary antibody linked to horseradish peroxidase, which specifically binds to the primary antibody. Chromogenic substrate 3,3′ diaminobenzidine tetrahydrochloride (DAB) was then added and counterstained with hematoxylin. A strong expression of survivin in a colon adenocarcinoma specimen was used as positive control, and the colon adenocarcinoma specimen treated only with the secondary antibody was used as a negative control for determination of survivin by the immunohistochemistry technique.
2.2.5. BIRC5/Survivin Gene Analysis
Isolation and purification of DNA from tumor tissue and buccal cell scrapings from study group subjects were carried out as per the literature supplied by Qiagen Germany (DNeasy Blood and Tissue Kit Cat. No. 69504, Qiagen, Hilden, Germany). The purified DNA sample was quantified by a NanoDrop device (ND-1000 UV-VIS Spectrophotometer, Thermo Fisher Scientizfic, Waltham, MA, USA). Suitable forward and reverse primer pairs specific to the sequence of promoter and exons of the BIRC5 gene were designed using the Primer 3 tool for amplification and they were also validated by primer stats. The specificity of the selected primer pairs against the exon and promoter region was checked using Primer Blast and is presented in the Table 1.
PCR Amplification of BIRC5 Gene
The BIRC5 promoter and exons of the gene were amplified using specific forward and reverse primers, as indicated in Table 1 at optimum PCR conditions. The total reaction volume of the PCR mix was 30 μL, using EmeraldAmp PCR master mix (Clontech Takara Cellartis Cat. no. RR310A). The components of the PCR mix were nuclease-free water 10 μL, Emerald master mix buffer 15.5 μL, forward primer 1.5 μL, reverse primer 1.5 μL, DNA template 1.5 μL. The amplification reactions were carried out in a thermo cycler with a sequence of initial denaturation at 95 °C for 5 min, 35 cycles of denaturation at 95 °C for 30 s, annealing temperature for 30 s, initial extension at 72 °C for 1 min, and final extension for 72 °C for 5 min. The reaction of the promoter and each exon allowed for extension of all amplicons.
Analysis of PCR Ampliconson Agarose Gel Electrophoresis
The aliquots (3 μL) of PCR amplicons of each exon and promoter region of the BIRC5 gene were applied to 2% agarose gel in Tris-acetate-ethyl-diamine tetra acetate (TAE) buffer along with 100 bp DNA ladder to check the right product size and its migration on horizontal gel electrophoresis. The electrophoresis was performed in TAE buffer at a voltage of 120 volts and a current of 140 milliamps for 45 min, The amplicons in the gel run were visualized using ethidium bromide stain in the BIOBEE UV Digital Gel documentation system. The amplicons were extracted from the agarose gel using the LivgenGel extraction kit (Livgen Cat. No. MP011). The PCR products were purified with GeneJET PCR Purification Kit from Thermo Fisher Scientific, Waltham, MA, USA.
BIRC5 Gene Sequencing and Sequence Analysis
The amplified promoter region and exons of the BIRC5 gene from representative samples were sequenced by Sanger’s dideoxy method using the Big Dye Terminator v3.1 cycle sequencing kit as per manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA) and analyzed using ABI-3500 Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA). The chromatograms were viewed and analyzed using FinchTv and Applied Biosystems DNA Sequencing Analysis Software version 5.1. The FASTA format of the nucleotide sequences were submitted to the National Center for Biotechnology Information Basic Local Alignment search tool for nucleotides (NCBI BLAST-N), the reference nucleotide sequence was also mined from NCBI (NC_000017.11). The BIRC5 gene exon and promoter variants were further analyzed using the bioinformatics tool PredictSNP2 (single nucleotide polymorphism), a unified integration platform for accurately evaluating single nucleotide variation or polymorphism and its effects by exploiting different characteristics of the variants in a distinct genomic region considering PredictSNP1 prediction output [55].
2.3. Statistical Analysis
The research results were statistically analyzed using a licensed version of SPSS Software version 22 (IBM, New York, NY, USA). The normality check was conducted using the Shapiro–Wilk test with skewness. Continuous data were represented as mean and standard deviation (SD). Univariate analysis of blood parameters with tumor stage (T1–T2) and (T3–T4), node involvement (N0 and N1–N3), and levels of survivin protein in tumor tissues was conducted using the independent t test; p < 0.05 was considered statistically significant. Selected blood parameters were included for the multiple linear regression model to determine their association with survivin protein levels in OSCC patients; p < 0.05 was considered statistically significant. Furthermore, in order to determine the prognostic importance of survivin in relation to WBC counts, NLR, LMR and PLR, the study group patients (Group 1) were subdivided into 2 sub-groups, such as a Group with high and a Group with low values of each hematologic marker on the basis of cut-off values selected from published data on cancer patients and were compared with the survivin levels. The cut-off values of the parameters were WBC = ≥7.9 × 109/L and <7.9 × 109/L, ANC = ≥4.9 × 109/L and <4.9 × 109/L, ALC = >1.980 × 109/L and ≤1.980 × 109/L, AMC = ≥0.50 × 109/L and <0.50 × 109/L, NLR = ≥2.39 and <2.39, LMR = >3.22 and ≤3.22, PLR = >110.6 and ≤110.6 [56,57,58]. BIRC5 gene sequence analysis data were tabulated in a Microsoft Excel sheet, and the data were presented under the headings: (a) single nucleotide variation, (b) number of subjects, (c) frequency of occurrence of variation in each group (expressed as a percentage (%)), and (d) average concentration of tissue survivin in each group.
3. Results
3.1. Patient Characteristic Details
The study participants came from a rural background with poor nutritional habits and lower socioeconomic status. However, the majority of the oral cancer patients visiting the hospital for treatment purposes had advanced disease. As per the American Joint Committee on Cancer Staging Manual, 18 patients (28.6%) were T4N1, 11 patients (17.5%) were T3N1, 05 patients (7.9%) were each T2N0, T2N1, and T3N0, 04 patients (6.3%) were T4N0, and 03 patients (4.8%) each with T2N2b, T3N2b, and T4N2a. All patients with oral cancer had Grade 1 well-differentiated squamous cell carcinoma.
3.2. Analysis of Tissue Survivin Data
The data obtained were tabulated as mean ± SD. There was a significant elevation of tissue survivin levels in OSCC patients (1670.9 ± 796.21 pg/mL) compared to the levels in buccal cell samples of habitual tobacco chewers (1096.02 ± 346.17) and healthy controls (397.5 ± 96.1 pg/mL), with p value < 0.001, as shown in Table 2.
3.3. Statistical Representation of Pretreatment Hematological Parameters
The baseline hematological parameters in OSCC patients (n = 63) from the secondary source of data are presented as mean and standard deviation (SD), wherein hemoglobin levels, red blood cell (RBC) counts, packed cell volume (PCV), mean corpuscular volume (MCV), mean corpuscular hemoglobin concentration (MCHC), red cell distribution (RDW), white blood cell (WBC) count, absolute neutrophil count (ANC), absolute lymphocyte count (ALC), absolute monocyte count (AMC), platelet count (PLT) values were presented and the neutrophil/lymphocyte ratio (NLR), platelet/lymphocyte ratio (PLR), and lymphocyte/monocyte ratio (LMR) were calculated as shown in Table 3. For the same parameters, a univariate analysis was conducted in relation to tissue survivin levels and presented as shown in Table 4 and evinced a platelet/lymphocyte ratio significance (p = 0.01) when correlated with tissue survivin levels; the same is shown in Figure 2.
Univariate analysis of hematology parameters with different stages of tumor development ranging from T1–T2 and T3–T4 and with involvement of lymph node N0 (noninvolvement of lymph node) and N1–N3 (involvement of lymph nodes). The analysis showed significance (p = 0.008) with RDW with respect to tumor stage and node involvement, as seen in Table 5.
Multiple linear regression analysis of the hematology parameter with tissue survivin showed significance with AMC (p = 0.045 *) and LMR (p = 0.025 *), as presented in Table 6 and Figure 3. An independent t test comparing the mean values of tissue survivin with hematological variables WBC, ANC, ALC, AMC, NLR, PLR, and LMR in oral squamous cell carcinoma patients showed significance with AMC, NLR, and LMR (p = 0.001), whereas other parameters were not significant, as shown in Table 7.
3.4. Demonstration of Survivin Protein by Immunohistochemistry Technique
Tissue samples from primary oral squamous cell carcinoma patients (n = 24) were collected from the Department of Otorhinolaryngology and Head and Neck Surgery. Normal buccal mucosa tissues (n = 5) were obtained from non-tobacco users during extraction of impacted molars upon obtaining informed consent. Tissue samples from primary OSCC and from normal buccal mucosa were fixed in formalin and embedded in paraffin blocks in the Pathology Laboratory of RL Jalappa Hospital and Research center, Tamaka, Kolar, and used for detection of survivin by immunohistochemical technique. The expressed tissue survivin protein was scored, based on the scoring criteria followed in a method described by Jane et al.; according to these criteria, less than 5% of the cell staining indicated 0 (negative staining), between 5% and 25% of cell staining indicated +1 (weak staining), 25–50% of the cell staining indicated +2 (moderate staining), and >50% of the cell staining indicated +3 (strong staining) [59]. Four samples (17%) showed +3 strong staining, eight samples (33%) demonstrated +2 moderate staining, ten samples (42%) showed +1 weak staining, and two samples (8%) showed negative staining for the survivin antigen. Furthermore, all the samples exhibited nuclear staining and three samples with strong staining for survivin exhibited both nuclear and cytoplasmic staining. Control samples showed 0–5% cells stained for survivin protein and they were scored as negative even though minimal staining in the cells was evidenced (Figure 4).
3.5. BIRC5 Gene Sequence Analysis
Forty samples were selected based on the levels of high tissue survivin concentrations from the study subjects of each group for promoter sequence analysis, specifically, 20 samples from OSCC patients, 10 buccal cell samples from habitual tobacco chewers without OSCC, and 10 buccal cell samples from healthy controls. These were screened with BIRC5 promoter region sequence analysis to identify known single nucleotide variations. Seventy samples were selected based the mean and +SD and mean and –SD of survivin concentrations for exons 1–5. Sequence analysis of BIRC5, specifically, 30 samples from OSCC patients, 20 buccal cell samples from habitual tobacco chewers without OSCC, and 20 buccal cell samples from healthy controls.
From the above samples we found from promoter and exons of BIRC5 sequence analysis data, the promoter region comprising 397 bp revealed a total of eight single nucleotide variants. Accordingly, the notable single nucleotide variants determined were the G → T variant in 35% of OSCC cases, 30% in habitual tobacco chewers without OSCC, and 30% in healthy subjects, whereas T → G variants were observed only in 5% of OSCC patients, a unique G → A variant was observed only in 30% of habitual tobacco chewers. A G → C variant was observed in 15% of OSCC patients and 30% of healthy controls, and the same was not seen in the habitual tobacco chewers group. However, A → T, C → T, C → G, and G → T variations were observed in all three groups and their frequency and percentage of occurrence are depicted in Table 8. The above promoter variants of the study subject were observed with an average tissue survivin level, and it was found that the G → T variant was observed with 2228.58 pg/mL in OSCC patients, 1104.12 pg/mL in habitual tobacco chewers, and 443.65 pg/mL in healthy subjects. The T → G variant was observed with 2082.88 pg/mL in OSCC patients, the G → C variant observed with 2194.29 pg/mL in OSCC patients and 437.12 pg/mL in healthy subjects (Table 8).
In the exon 1 region comprising 175 bp, two notable single nucleotide variants (C → A and G → C) were observed in exon 1 at 5′ untranslated region (UTR) in OSCC patients, tobacco chewers without OSCC, and healthy subjects; the C → A variant was observed in 33.33% of OSCC patients, 5% of tobacco chewers without OSCC, and 5% of healthy subjects. On the other hand, G → C was observed in 86.67% of OSCC patients, 50% of tobacco chewers without OSCC, and 45% of healthy subjects (Table 8). The average tissue survivin levels were found in the C → A variant with 1649.3 pg/mL in OSCC patients, 1197.3 pg/mL in habitual tobacco chewers without OSCC, and 457.82 pg/mL in healthy subjects. The G → C variant was noted with 1632.77 pg/mL in OSCC patients, 1045.56 pg/mL in tobacco chewers without OSCC, and 398.22 pg/mL in healthy subjects.
Four variants—G → T, C → G, T → G, C → T—were noted only in OSCC patients with 26.67%, 6.67%, 6.67% and 3.33%, respectively. The average tissue survivin levels observed were 2015.04 pg/mL in the G → T variant, 2110.49 pg/mL in the C → G variant, 2427.92 pg/mL in the T → G variant, and 1565.42 pg/mL in the C → T variant. The G → A variant was found in 4% (1400.68 pg/mL) of OSCC patients and in 10% (450.04 pg/mL) of the healthy subjects and was not found in habitual tobacco chewers.
In the exon 2 region comprising 110 bp, a total of four single nucleotide variants (G → C, G → A, C → T, A → C) were observed, of which each G → C and G → A variant was found in 3.33% (1074.94 pg/mL) of OSCC patients, and the same variants were present in 15% (432.24 pg/mL) and 10% (428.65 pg/mL), respectively, of healthy subjects. The C → T variant was present only in 5% (428.65 pg/mL) of healthy subjects, A → C was present in 5% (303.97 pg/mL) of habitual tobacco chewers, and 5% (432.24 pg/mL) of healthy subjects (Table 8).
In the exon 3 region comprising 69 bp, two nucleotide variants were observed in exon 3, of which C → T was found only in 10% (720.05 pg/mL) of habitual tobacco chewers without OSCC and the G → C variant was found only in 3.33% (2485.07 pg/mL) of OSCC patients (Table 8).
In the exon 4 region comprising 118 bp in the BIRC5 gene, 11 variants were observed, of which 6 variants (C → A, A → G, G → T, T → G, A → C, and G → A) were found in 3.33% (2370.77 pg/mL), 6.67 % (2272.69 pg/mL), 10% (1711.07 pg/mL), 3.33% (1850.2 pg/mL), 6.67% (1807.81 pg/mL), and 3.33% (1765.42 pg/mL), respectively, only in OSCC patients. The G → C and T → A variants were found only in 15% (1266.55 pg/mL) and 10% (1157.7 pg/mL), respectively, of tobacco chewers without OSCC, and G → C was found in 5% (422.81 pg/mL) and T → A in 5% (227.01 pg/mL) of healthy subjects. The C → T variant was present in 5% (422.81 pg/mL) of only healthy subjects. The A → T variant was present in all three groups, in 6.67% (1691.5 pg/mL) of OSCC patients, 5% (1415 pg/mL) of tobacco chewers without OSCC, and 10% (406.12 pg/mL) of healthy subjects. The T → C variant was present in 3.33% (1850.2 pg/mL) of OSCC patients and 10% (1310 pg/mL) of tobacco chewers without OSCC (Table 8).
In the exon 5 region comprising 2171 bp, nine variants (A → C, C → A, T → A, G → A, C → T, G → T, T → G, G → C, A → T) were observed in the exon 5 region of the BIRC5 gene, of which three variants, C → A in 3.33% (1850.2 pg/mL), G → T in 6.67 % (1542.09 pg/mL) and G → C in 3.33% (1850.2 pg/mL), were observed only in OSCC patients. Three variants, T → A, G → A and C → T, were observed in all the groups as shown in Table 8.
Exonic sequence analysis of the BIRC5 gene revealed a larger number of OSCC patient samples predominantly showing variations in the promoter region, 5′ untranslated region, and exon 1 region, which were predicted to be deleterious in nature; the exon variants observed were subjected to the PredictSNP1 tool to determine any alteration in the amino acid sequence in the survivin primary protein structure.
4. Discussion
The present study focused on determining the interrelation between tobacco consumption and the levels of survivin and its association with the hematological parameters of the participants. To the best of our knowledge, per the available literature, the current study is the first to evaluate the association of tissue survivin levels with pretreatment levels of the hematological parameters in chronic tobacco chewers with OSCC. Our study revealed that the hemoglobin concentration in all OSCC patients was below the normal cut-off range of 12–15 gm% in females and 17 gm% in males. Malnourishment seen in cancer patients results in anemia [60,61]. The increase in RBC count seen in cancer patients may be hypoxia-driven and related to inflammation in bone marrow tissue [62].
Studies have reported that the systemic inflammation triggered by cancer alters the number of circulating immune cells such as neutrophils and lymphocytes [56]. Moreover, the peripheral blood cell counts of cancer patients reflect tumor progression and were found to have a prognostic value, according to a number of published reports connecting hematological markers with cancer prognosis. Therefore, hematological parameters in the blood test serve as the criteria for differentiating cancer patients and healthy individuals [56,63,64].
Upon univariate analysis of the hematological parameters with tumor staging, nodal involvement, and tissue survivin protein concentration, we found that with regards to tumor staging, absolute lymphocyte count and absolute platelet count were found to be elevated among T1–T2 stage patients, compared to T3–T4 stage. With respect to node involvement, the RDW was found to be significantly high among N1–N3 patients compared to N0 individuals; the elevated RDW signifies inflammation and poor nutritional status in these patients. However, we did not find any other hematological parameter to be associated with tissue survivin protein levels. This was in contrast to a study by Yuzhen Luo et al. wherein a significant elevation in RDW in 127 cases of urothelial carcinoma of the bladder was seen compared to control subjects, but their results did not show any significance with respect to tumor stage or lymph node involvement. Upon multiple linear regression analysis, we found tissue survivin protein levels to be significantly associated with the absolute monocyte count and lymphocyte/monocyte ratio, and none of the other hematological parameters had any significant association with the tissue levels of survivin protein in OSCC patients [65].
On comparison of tissue survivin levels with hematological parameters, cut-off values having prognostic significance such as white cell count, absolute neutrophil count, absolute lymphocyte count, absolute monocyte count, neutrophil/lymphocyte ratio, lymphocyte/monocyte ratio, and platelet/lymphocyte ratio.
We observed that 38 (60%) OSCC patients had an absolute monocyte count of (≥0.500 × 109/L) significantly associated with increasing tissue survivin levels. The neutrophil/lymphocyte ratio was found to be significantly higher and associated with tissue survivin levels in 21 (33%) OSCC patients, and the lymphocyte/monocyte ratio was found to be significantly lower and associated with tissue survivin levels in 30 (48%) OSCC patients (Table 6). The above findings generated a clue about survivin influence on increasing the neutrophil/monocyte ratio and decreasing the lymphocyte/monocyte ratio, indicating its contribution to the poor prognosis in OSCC patients.
It is well established that host response plays a vital role in the determination of the biological behavior of tumors. Studies have recently reported an elevated neutrophil/lymphocyte ratio (NLR) to correlate with the aggressive biological behavior in various malignancies including head and neck tumors. Nakashima et al. reported that a higher NLR of >2.4 was associated with advanced OSCC and poor response to chemotherapy. Phulari et al. observed a mean NLR of 2.84 in OSCC compared to healthy controls and suggested NLR could be a surrogate marker for the aggressive behavior of oral squamous cell carcinoma [66,67]. Similarly, our study also observed a higher NLR of ≥2.91 in 50 (79%) oral squamous cell carcinoma patients with tumor stage T3–T4 and an NLR of ≥2.67 in 13 (26%) patients with tumor stages T1–T2, the higher NLR (≥2.91) indicated the tumor stage progress of OSCC. However, patients were not followed up to assess the treatment outcome on the NLR in OSCC.
The mechanism by which inhibitor of apoptosis protein survivin alters the neutrophil, lymphocyte, and monocyte counts is still unclear; however, several in vitro experimental studies on cell culture, using bone marrow cells from cancer patients, observed inflammatory cytokines to extend the survival of neutrophils by delaying apoptosis [68,69].
Survivin expression was found to be induced in terminally differentiated neutrophils by cytokines such as granulocyte/macrophage colony stimulating factor (GM-CSF) and granulocyte CSF (G-CSF), which prolong the neutrophil lifespan, suggesting the importance of survivin in blocking apoptosis in neutrophils in a cell cycle-independent manner [70]. The NLR compares the inflammatory response to the immune response of the host, the interplay of neutrophils and lymphocytes in tumor initiation and their indirect effect on the tissue survivin expression ultimately leading to tumor promotion, angiogenesis, and metastasis, as shown in Figure 1.
Research studies have demonstrated that a low lymphocyte/monocyte ratio is associated with a worse overall survival (OS) in patients with bladder cancer and pancreatic cancer [71,72]. Circulating monocytes infiltrate the tumor and differentiate into tumor-associated macrophages. Tumor-associated macrophages are known to suppress adaptive immunity through secretion of variety of chemokines and cytokines such as tumor necrosis factor-α, interleukin (IL)-1, IL-6, and IL-10 to promote tumor growth, angiogenesis, invasion, and migration [73,74]. This is shown to be associated with poor prognosis in cancers [75,76,77].
In their study, Tsai et al. observed a decreased lymphocyte count and an increase in peripheral monocytes and the neutrophil/lymphocyte ratio with the advancement of clinical stage in oral cancer patients and suggested that pretreatment peripheral monocyte count could serve as an independent predictor of worse prognosis in oral cancer patients [78]. In our study we observed that around 60% of the patients with OSCC had a significantly higher monocyte count than the cut-off value and this correlated with increasing tissue survivin levels, but we did not find any significant variation with respect to tumor staging or node involvement.
Lymphocytes play an important role in adaptive immune response. Through immune surveillance they have been found to eliminate early tumor cells by cytotoxic cell death and the production of cytokines. Studies have reported that infiltrating lymphocytes indicate the generation of an effective antitumor cellular immune response [79,80]. However, in established tumors the adaptive immune response is suppressed through pathways such as inhibition of dendritic cell differentiation and activation, and infiltration of regulatory T cells [81]. A low peripheral lymphocyte count thus indicates a poorer lymphocyte-mediated immune response to tumor and suggests poor prognosis [82,83]. Studies have reported the LMR as an independent prognostic factor in patients with bladder cancer, esophageal cancer, and malignant pleural mesothelioma [84,85,86,87,88,89]. A study by Fardeela BIN-ALEE et al. on the evaluation of lymphocyte apoptosis in patients with oral cancer reported the levels of helper (Th) cells that promote anti-tumor immune response to be significantly higher in oral cancer patients than in hepatic cancer patients. Furthermore, they found an increase in B cells and cytotoxic T cells to eliminate tumor cells by secreting cytokines such as TNF and IFNγ [90]. However, the percentage of Th cells was slightly lower in highly metastatic N3 tumors in OC patients, which may have escaped the T cell-mediated immune response mechanism by the adaptation of primary tumor antigens [91].
They also found a high level of (Bax) Bcl-2 associated X, a pro-apoptotic protein, and B-cell lymphoma-2 (Bcl-2), an anti-apoptotic protein ratio, in oral cancer stage IV patients. Tumor size, lymph node involvement, and the Bax/Bcl-2 ratio were also higher in advance-stage tumors, which suggested that Bax/Bcl-2 ratio levels are associated with OSCC aggressiveness [92]. In our study also, we observed that 43 (68%) of the OSCC patients had peripheral lymphocyte levels <1.980, though not statistically significant, which suggests a poor prognosis in these patients, and the majority of our patients had advanced tumors. However, ascertaining the poor prognosis in relation to the lowered peripheral lymphocyte count and impact of adaptive response demands follow-up of the patients, as it is a lacunae in the current study.
The intracellular expression of survivin as demonstrated by immunohistochemistry indicated that all the tissue samples of tobacco chewers with OSCC exhibited nuclear staining, and three of these samples with strong staining for survivin exhibited both nuclear and cytoplasmic staining. Study reports on the localization of survivin are controversial; a study by Chiao-Ying Lin et al. observed cytoplasmic expression of survivin in the areca nut chewing Taiwan population, and nuclear survivin expression was shown to be associated with poor prognosis in non-small-cell lung cancer and esophageal squamous cell cancer [93,94]. Studies have reported that cytoplasmic survivin regulates the action of caspases, and nuclear survivin is part of the CPC, related to cellular division [95,96]. In the current study we found a higher concentration of survivin and higher nuclear staining in tobacco chewers with OSCC compared to control samples. The finding in the study indicated tobacco as a contributing factor to increasing survivin concentration, and its predominant nuclear staining of survivin can be considered as a predictor factor for the malignant progression of the cells in habitual tobacco chewers with OSCC [39].
Furthermore, it has been reported in previous studies that the regulation of survivin expression occurs at multiple levels, which include transcription, translation, and posttranslational modification [97]. A group of transcription factors, such as Sp1, NF-kB, STAT3, E2F1, and Kruppel-like factor 5 (KLF5), have been demonstrated to bind with the survivin promoter and enhance survivin expression in tumors, whereas the p53, forkhead box O3 (FOXO3), and early growth response 1 transcription factor (Egr-1) inhibit expression of survivin in cells [97,98]. Beyond transcriptional and translational regulation, recent reports have revealed that survivin also undergoes various posttranslational modifications that include phosphorylation, acetylation, and ubiquitination. Phosphorylation is required for survivin stabilization, subcellular trafficking, and biological activation. Phosphorylation on Thr34 prevents ubiquitination-induced survivin destruction [99].
An in vitro study by Ming Li et al. demonstrated that the natural compound xanthohumol decreased survivin phosphorylation at Thr34 through inhibition of Akt-Wee1-CDK1 signaling, which in turn facilitated E3 ligase survivin ubiquitination and degradation in squamous cell carcinoma cells [100].
To date, per our knowledge and a literature survey, this is the first study on the BIRC5 gene polymorphism reporting in chronic tobacco and alcohol users with and without OSCC among the rural South Indian population. Currently, the relevant genetic data on exonic mutations of the BIRC5 gene and the biological effect of survivin function are limited; therefore, we made an attempt to discuss the BIRC5 gene polymorphism on the basis of a bioinformatics approach.
The BIRC5/survivin gene is functionally involved in the upregulation of the G2/M checkpoint of the cell cycle at the mitotic spindle apparatus. The BIRC5 gene plays a key role in preserving the transformation of normal cells into cancer cells. It also promotes the angiogenesis and proliferation of these cancer cells. Therefore, genetic variations in the survivin/BIRC5 gene may cause an unusual survivin expression and contribute to carcinogenesis through interference with the functional domains of survivin.
The promoter region of the BIRC5 gene contains the binding motif for cell cycle-dependent elements/cell cycle homology region (CDE/CHR). Several studies conducted in the past have mainly focused on the polymorphisms in the promoter region of the BIRC5 gene such as –31 G/C, a single nucleotide polymorphism at the promoter region (SNP: −31 G/C) that was shown to alter the binding sites for CDE/CHR, thus inducing survivin overexpression in these cancers. These polymorphisms were studied in breast cancer, prostate cancer, esophageal and colorectal cancer. The promoter polymorphism was found to be associated with increased risk for development of breast cancer [101,102,103,104]. However, there is paucity of studies that have evaluated the variations in the promoter region of the BIRC5 gene in OSCC patients. In our study we found that the T → G variation was found only in the OSCC patient samples, and this may be the reason for the twofold increased survivin levels in comparison to tobacco chewers and an increase in survivin levels of 4.5-fold in comparison to healthy subjects. A unique G → A variation observed in tobacco chewers alone predicted as deleterious by the prediction tools may be the reason for the twofold rise in survivin concentration in tobacco chewers in comparison to healthy controls. A → T, C → T, C → G, and G → T variations that were observed in all three groups may suggest that the subjects in the habitual tobacco chewers group and healthy subjects group possessing these mutations are at increased risk in the presence of epigenetic factors for developing OSCC. In our study the G → T variation was present at highest % in all three groups with the highest average concentration of survivin compared to the other variations observed in the promoter region. It is further evidenced from the immunohistochemistry staining of OSCC and healthy subjects (normal buccal mucosa) that 12 (50%) of the OSCC samples showed strong to moderate staining for survivin and 2 (40%) of the healthy buccal mucosa tissues showed 5% staining for survivin.
In the exon 1 region variants, in a combined output generated by the bioinformatics prediction tool PredictSNP, T → G, C → A, C → T, and C → G variants found in the 5′ untranslated region (5′UTR) regions were predicted to have a deleterious effect, whereas the other variants were predicted to be neutral. Of the four nucleotide variants in the exonic region, T → G, C → G, G → C and two G → T variants were found to be non-synonymous or missense mutations and one G → T variant was synonymous. The three missense mutations observed in the exon 1 region were found only in the OSCC patients, which was predicted to be deleterious and probably damaging at the second amino acid residue glycine replaced by valine (Gly2Val) (26% of OSCC patients) and the thirteenth amino acid residue phenylalanine replaced with cysteine (Phe13Cys) (6.67% of OSCC patients). The glycine to valine mutation in survivin structure was found to be in the mitochondrial targeting sequence of survivin protein (aa1-10); the mitochondrial targeting sequence imports the survivin protein to mitochondria through its protein-rich N terminus. This survivin is further released from the mitochondria into the cytosol in response to apoptotic stimuli, thus resulting in enhanced anti-apoptotic activity compared to cytoplasmic survivin, and the reason for this is not clear [105,106]. Studies have observed specifically in cancer cells survivin to be additionally detected in mitochondria [106].
In the exon 2 region, the variants observed were all nonsynonymous and of the combined output generated by PredictSNP, three were predicted to have a deleterious effect and two to have a functionally neutral effect. The probable damaging mutation was found in OSCC samples and healthy control samples at alanine replaced with valine at the 41 position of amino acid residue (Ala41Val) and aspartic acid replaced by histidine at the 72 amino acid residue (Asp72His) in the survivin protein structure, which is related to the BIR domain (aa 18–88). The BIR domain is involved in the mitosis of the proliferating cancer cells and in the microtubule dynamics during mitosis [107,108].
Two mutations were identified in the exon 3 region, of which one was a stopgain mutation and one a nonsynonymous mutation. The amino acid mutation was at the 93 position amino acid residue glycine replaced by arginine (Gly93Arg) in the survivin protein structure, and the mutation was predicted to have a benign effect on the protein function and be tolerated, and it was present only in the OSCC samples and was not identified in the tobacco chewers or healthy control group. The amino acid region in the protein structure was involved in dimerization (aa 90–102) of the survivin monomer to form homodimers assisted by the N terminal residue [109]. However, studies have shown survivin protein to reduce caspase activity in both monomeric and homodimeric states; hence, the variant has a neutral effect on the function of the survivin protein [110].
Eleven mutations were identified in the exon 4 region, of which three mutations were synonymous mutations, one was a stopgain mutation, and seven were nonsynonymous mutations. Of the seven nonsynonymous mutations, four mutations at arginine replaced by glycine at the 106 position (Arg106Gly), glutamine replaced with histidine at the 92 position (Gln92His), glutamic acid replaced with aspartic acid at the 107 position amino acid (Glu107Asp), alanine replaced by serine at the 109 position (Ala109Ser), and phenylalanine replaced with leucine at the 93 position amino acid residue (Phe93Leu) were predicted to be tolerated and benign. Two mutations at leucine replaced by phenylalanine at the 96 position amino acid residue (Leu96Phe), predicted to be deleterious and probably damaging, and mutation lysine replaced by isoleucine at the 112 position of amino acid residue (Lys112Ile) in the survivin protein structure were predicted to be tolerated and possibly damaging, respectively.
The mutation at Leu96Phe is in the nuclear export signal region (aa 96–104) and Lys112Ile amino acid is in the inner centromere protein (INCENP) interacting region in the survivin protein [111]. The NES region is critical in the nuclear export of survivin protein and is centrally placed in the survivin protein structure between the BIR domain and the C terminal helix. Survivin is transported out of the nucleus in an exportin-1-dependent manner [112,113]. A study by Temme et al. on newly isolated fibroblasts observed that the ectopically expressed survivin was nuclear but became progressively cytoplasmic with successive passages because of heat shock proteins 90 and phosphorylation at the T34 residue on survivin protein [114,115].
Enhanced INCENP interaction is critical during mitosis, where it forms the chromosomal passenger complex (CPC). The CPC is targeted by the survivin to the centromeres and enables the Aurora B kinase to phosphorylate various proteins that ensure proper alignment of chromosomes during cytokinesis. Experimentally, this region of survivin is shown to be a highly conserved region in eukaryote loss or deletion, which can result in prometaphase defects, cytokinesis failure, and increased apoptosis [116,117,118]. The deleterious mutation at 96 amino acid residue was identified only in OSCC samples; however, the mutation at 112 amino acid was found only in the habitual tobacco chewers.
In the exon 5 region of the BIRC5 gene sequence, we found 11 exonic mutations of which one was a stopgain mutation, 3 were synonymous mutations, and 7 were nonsynonymous mutations. Of the 7 missense mutations, the amino acid residue mutations at arginine replaced with tryptophan at the 86 position (Arg86Trp) and leucine replaced with glutamine at the 100 position (Leu100Gln) were predicted to have deleterious functional effect and be tolerated; glutamine replaced with arginine at the 132 position amino acid mutation (Gln132Arg) was not scored by prediction tools and was identified as an unknown variant. Methionine replaced with isoleucine at position 74 (Met74Ile) and arginine replaced with tryptophan at the 86 amino acid position (Arg86Trp) were in the BIR domain region of the protein, Leu100Gln in the NES region, and Gln132Arg in the microtubule binding region. Variants predicted in the 3′ untranslated region G → T, C → T, A → T, T → G, G → A might be involved in the expression and stability of survivin mRNA. The increased rate of incidence of oral cancer in the study area was strongly linked to epigenetic factors, namely, exposure at an early age to tobacco and alcohol, living in a gold mining area and fluoride-affected belt.
5. Conclusions
The study results confirmed that there is an increased concentration of survivin in OSCC tissues compared to other groups. Elevated survivin levels establish suppression of apoptosis in oral squamous cell carcinoma. The absolute monocyte count, LMR, and NLR were found to correlate with tissue survivin levels in OSCC and might serve as useful prognostic biomarkers and generate a link with survivin. Its role in altering the counts of systemic inflammatory cells might be an important implication in the onset of OSCC. The genetic variants identified in the BIRC5 gene of OSCC patients revealed G → T (35%) in the promoter region, the G → C (86.67%) variant in the 5′ untranslated region, in the exon 1 region C → A (33.33%), G → T (26.67%) variants were present in a large number of OSCC patients. The unique variants found only in OSCC patients were T → G in the promotor region; in the exon 3 region G → C; in the exon 4 region C → A, A → G, G → T, T → G, A → C, G → A; in the exon 5 region C → A, G → T, G → C. Observed mutations affecting survivin were Gly2Val, Phe13Cys, Asp72His, Gly93Arg, Leu96Phe, Arg106Gly, Ala109Ser, Met74Ile, and Gly132Arg. These were the important mutations implicated in the exertion of altered biological effect on survivin protein and its interaction with caspases in bringing about the inhibition of caspases in apoptosis during the transformation of normal cells into neoplastic oral squamous cells. These single nucleotide polymorphism/variants can cause an unusual expression of survivin protein and further induce carcinogenesis by interfering with various functional domains of the protein. They can thus be used as a genetic marker to screen for OSCC among tobacco chewers and predict the risk of developing OSCC among habitual tobacco chewers in the presence of these variants in the gene. In future, they may also help us to formulate or modify treatment accordingly, thereby improving the outcome for these patients. This was a preliminary study in the direction of identifying genetic markers in inhibitor of apoptosis protein gene BIRC5, specifically in the unexplored coding regions of the gene. However, a limitation is that the study should be conducted in larger cohort with a larger sample size to generate the underlying genetic evidence in OSCC.
6. Limitations of the Study
This was a single centric study; the enrolled cases were not followed up for the assessment of the prognostic role of survivin. Capturing survivin mRNA expression was not assayed in the tissues and buccal cells, which might support the information about survivin protein. Pretreatment hematology parameter counts were not included from habitual tobacco chewers and the control group for a pairwise comparison.
Conceptualization, S.T.Y., C.D.D., M.L.H.K.; data curation, S.T.Y., C.D.D.; formal analysis, S.T.Y., C.D.D.; investigation, methodology, S.T.Y., C.D.D., S.M.A.M., M.L.H.K.; project administration, S.T.Y., C.D.D.; resources, S.T.Y., C.D.D., S.M.A.M.; supervision, C.D.D., S.M.A.M., M.L.H.K.; validation, C.D.D., M.L.H.K., S.M.A.M.; visualization, C.D.D., S.M.A.M., M.L.H.K.; writing—original draft, S.T.Y., C.D.D.; writing—review and editing, S.T.Y., C.D.D., S.M.A.M., M.L.H.K. All authors have read and agreed to the published version of the manuscript.
The study was approved by Central Ethics Committee of Sri Devaraj Urs Academy of Higher Education and Research in a vide No. SDUAHER/KLR/CEC/33/2018-19 dated 14 May 2018. The study was conducted in accordance with the Declaration of Helsinki.
Informed consent was obtained from all subjects involved in the study.
The data presented in this study are available on request from the corresponding author.
The authors would like to thank Sri Devaraj Urs Academy of Higher Education and Research for extending the required support to carry out this research; we also extend thanks to the Department of Otorhinolaryngology, Pathology, Dentistry and Community Medicine for providing the patient samples and for the statistical analysis. Thanks to G. Shruthi, Mysuru.
The authors declare that there is no conflict of interest involved.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 2. Correlation of platelet/lymphocyte ratio with survivin levels in OSCC patients.
Enlarge this image.Figure 3. (a) No significant correlation of neutrophil/lymphocyte ratio with survivin levels, (b) significant correlation of lymphocyte/ monocyte ratio with survivin levels, (c) significant correlation of absolute monocyte count with survivin levels, (d) no significant correlation of absolute neutrophil count with survivin levels, (e) no significant correlation of absolute lymphocyte count with survivin levels, (f) no significant correlation of white blood cell count with survivin levels determined by multiple linear regression analysis in OSCC patients.
Enlarge this image.Figure 4. Photomicrographs of immunohistochemical staining for survivin in oral squamous cell carcinoma tissues (A–D) and normal buccal mucosa (E,F). Immunohistochemical staining shows positive staining in brown. Photographs captured with a digital camera at 100× and 400× magnification under identical conditions.
Details of primer pairs used for the amplification of the promoter and exons of the BIRC5 gene.
| Locus | Primer | Sequence | Product Size |
|---|---|---|---|
| Promoter | Forward | GCCTCTCAAAGTGTTGGGATTA | 343 bp |
| Reverse | GGGCCAGTTCTTGAATGTAGAG | ||
| Exon1 | Forward | CCGCCTCTACTCCCAGAA | 226 bp |
| Reverse | CGCAGCCCTCCAAGAAG | ||
| Exon2 | Forward | CTCCCTGCTTTGTCCCCAT | 341 bp |
| Reverse | GAGGTATCCGTTCACAACAGC | ||
| Exon3 | Forward | GCAGTTCTGGTAACGGTGATAG | 230 bp |
| Reverse | CCGTATTAGCCAAGATGGTCTC | ||
| Exon4 | Forward | ATGTCCACAGGGAGAGAGAA | 536 bp |
| Reverse | GAGAATCACTTGAACCCGAGAG | ||
| Exon5 | Forward (Internal Primer) | GAAGCGTCTGGCAGATAC | 1070 bp |
| Reverse | AGTCTAGGCGGTTGCACTT |
Mean ± standard deviation of survivin in study groups.
| Analytes | Groups | Mean ± SD | 95% Confidence Interval for Mean | p Value | |
|---|---|---|---|---|---|
| Lower Bound | Upper Bound | ||||
| Survivin (pg/mL) | Group 1 | 1670.9 ± 796.21 | 1466.94 | 1874.75 | <0.001 |
| Group 2 | 1096.02 ± 346.17 | 1008.11 | 1183.93 | ||
| Group 3 | 397.5 ± 96.1 | 373.29 | 421.69 | ||
Data on pretreatment hematological parameters in patients with OSCC.
| SL. No. | Blood Parameters | Mean ± SD (N = 63) |
|---|---|---|
| 1 | Hemoglobin (gm%) | 11.67 ± 1.68 |
| 2 | RBC (mil/cu.mm) | 4.47 ± 0.57 |
| 3 | Packed Cell Volume (%) | 36.14 ± 4.60 |
| 4 | Mean Corpuscular Volume (fl) | 80.85 ± 6.22 |
| 5 | Mean Corpuscular Hemoglobin Concentration (%) | 32.23 ± 1.51 |
| 6 | Red Cell Distribution Width (%) | 15.81 ± 3.04 |
| 7 | White Blood Cell count (thousands/cu.mm) | 7.67 ± 2.75 |
| 8 | Absolute Neutrophil Count × 109/L | 4.38 ± 2.18 |
| 9 | Absolute Lymphocyte Count × 109/L | 1.96 ± 1.02 |
| 10 | Absolute Monocyte Count × 109/L | 0.90 ± 1.76 |
| 11 | Platelet Count × 109/L | 341.1 ± 113.63 |
| 12 | Neutrophil/Lymphocyte ratio | 2.86 ± 2.34 |
| 13 | Platelet/Lymphocyte Ratio | 226.86 ± 144.98 |
| 14 | Lymphocyte/Monocyte Ratio | 3.12 ± 1.50 |
Univariate analysis of hematology parameters with survivin levels in OSCC patients.
| SL. No. | Survivin pg/mL | Univariate Analysis | |
|---|---|---|---|
| Pearson Correlation | Sig. (2-Tailed) | ||
| 1 | Hemoglobin | −0.014 | 0.91 |
| 2 | RBC | 0.023 | 0.86 |
| 3 | PCV | 0.075 | 0.56 |
| 4 | MCV | 0.077 | 0.55 |
| 5 | MCHC | −0.221 | 0.08 |
| 6 | RDW | 0.193 | 0.13 |
| 7 | WBC | −0.143 | 0.26 |
| 8 | ANC | −0.094 | 0.46 |
| 9 | ALC | −0.221 | 0.08 |
| 10 | AMC | −0.089 | 0.49 |
| 11 | PLT | 0.037 | 0.78 |
| 12 | NLR | 0.166 | 0.19 |
| 13 | PLR | 0.321 * | 0.01 * |
| 14 | LMR | −0.196 | 0.12 |
* p < 0.05 statistically significant.
Univariate analysis of hematology parameters with stage of tumor and lymph node involvement.
| Variables | T. Staging | N | Mean | SD | t Value | p Value | Node Involvement | N | Mean | SD | t Value | p Value |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Hb | T1–T2 | 13 | 12 | 1.50 | 0.762 | 0.449 | N0 | 14 | 11.79 | 1.63 | 0.296 | 0.769 |
| T3–T4 | 50 | 11.6 | 1.7 | N1–N3 | 49 | 11.64 | 1.70 | |||||
| RBC | T1–T2 | 13 | 4.53 | 0.42 | 0.455 | 0.651 | N0 | 14 | 4.34 | 0.67 | −0.952 | 0.345 |
| T3–T4 | 50 | 4.45 | 0.61 | N1–N3 | 49 | 4.51 | 0.54 | |||||
| PCV | T1–T2 | 13 | 36.76 | 3.76 | 0.542 | 0.590 | N0 | 14 | 35.84 | 4.41 | −0.281 | 0.779 |
| T3–T4 | 50 | 35.98 | 4.81 | N1–N3 | 49 | 36.23 | 4.69 | |||||
| MCV | T1–T2 | 13 | 81.05 | 7.39 | 0.129 | 0.898 | N0 | 14 | 82.25 | 4.14 | 0.957 | 0.342 |
| T3–T4 | 50 | 80.79 | 5.96 | N1–N3 | 49 | 80.45 | 6.68 | |||||
| MCHC | T1–T2 | 13 | 32.82 | 1.92 | 1.610 | 0.113 | N0 | 14 | 32.43 | 2.01 | 0.554 | 0.581 |
| (T3–T4 | 50 | 32.08 | 1.37 | N1–N3 | 49 | 32.17 | 1.36 | |||||
| RDW | T1–T2 | 13 | 13.86 | 2.26 | −2.723 | 0.008 * | N0 | 14 | 14.13 | 1.43 | −2.436 | 0.018 * |
| T3–T4 | 50 | 16.31 | 3.03 | N1–N3 | 49 | 16.29 | 3.21 | |||||
| WBC | T1–T2 | 13 | 9.35 | 3.50 | 2.588 | 0.012 | N0 | 14 | 8.10 | 2.33 | 0.656 | 0.514 |
| T3–T4 | 50 | 7.23 | 2.37 | N1–N3 | 49 | 7.55 | 2.87 | |||||
| ABN | T1–T2 | 13 | 5.20 | 1.82 | 1.538 | 0.129 | N0 | 14 | 4.79 | 1.85 | 0.786 | 0.435 |
| T3–T4 | 50 | 4.17 | 2.23 | N1–N3 | 49 | 4.27 | 2.27 | |||||
| ABL | T1–T2 | 13 | 2.68 | 1.62 | 3.063 | 0.003 | N0 | 14 | 2.00 | 0.70 | 0.190 | 0.850 |
| T3–T4 | 50 | 1.77 | 0.70 | N1–N3 | 49 | 1.94 | 1.09 | |||||
| ABM | T1–T2 | 13 | 2.20 | 3.68 | 1.608 | 0.134 | N0 | 14 | 0.64 | 0.22 | −0.610 | 0.544 |
| T3–T4 | 50 | 0.56 | 0.17 | N1–N3 | 49 | 0.97 | 1.99 | |||||
| PLT | T1–T2 | 13 | 413.23 | 151.28 | 2.063 | 0.057 | N0 | 14 | 315.77 | 153.06 | −0.945 | 0.348 |
| T3–T4 | 50 | 322.36 | 94.83 | N1–N3 | 49 | 348.35 | 100.45 | |||||
| NLR | T1–T2 | 13 | 2.67 | 1.57 | −0.328 | 0.744 | N0 | 14 | 2.69 | 1.60 | −0.301 | 0.764 |
| T3–T4 | 50 | 2.91 | 2.52 | N1–N3 | 49 | 2.91 | 2.53 | |||||
| PLR | T1–T2 | 13 | 235.70 | 174.41 | 0.245 | 0.807 | N0 | 14 | 175.80 | 101.72 | −1.883 | 0.069 |
| T3–T4 | 50 | 224.56 | 138.28 | N1–N3 | 49 | 241.45 | 152.88 | |||||
| LMR | T1–T2 | 13 | 2.64 | 1.60 | −1.313 | 0.194 | N0 | 14 | 3.30 | 1.07 | 0.497 | 0.621 |
| T3–T4 | 50 | 3.25 | 1.45 | N1–N3 | 49 | 3.07 | 1.60 |
* p < 0.05 statistically significant.
Multiple linear regression model of hematology parameters with tissue survivin levels.
| Dependent Variable: Survivin | Hematology Parameters | Unstandardized Coefficients | Standardized Coefficients | t Value | p Value | |
| B | Std. Error | Beta | ||||
|---|---|---|---|---|---|---|
| (Constant) | 12,981.379 | 12,985.118 | 1.000 | 0.324 | ||
| Hb | −175.851 | 221.050 | −0.677 | −0.796 | 0.431 | |
| RBC | 681.616 | 645.181 | 0.897 | 1.056 | 0.297 | |
| PCV | 17.702 | 100.027 | 0.187 | 0.177 | 0.860 | |
| MCV | −88.496 | 132.679 | −1.266 | −0.667 | 0.509 | |
| MCHC | −471.015 | 329.721 | −1.637 | −1.429 | 0.161 | |
| RDW | 43.961 | 26.720 | 0.307 | 1.645 | 0.108 | |
| WBC | −205.654 | 547.736 | −1.300 | −0.375 | 0.709 | |
| ANC | 312.950 | 545.156 | 1.570 | 0.574 | 0.569 | |
| ALC | 1160.188 | 722.812 | 2.711 | 1.605 | 0.117 | |
| AMC | −3955.307 | 1909.181 | −16.024 | −2.072 | 0.045 * | |
| PLT | 1.075 | 1.364 | 0.281 | 0.788 | 0.435 | |
| NLR | 226.494 | 133.105 | 1.221 | 1.702 | 0.097 | |
| PLR | −5.289 | 2.704 | −1.765 | −1.956 | 0.058 | |
| LMR | 608.382 | 260.746 | 2.089 | 2.333 | 0.025 * | |
* p < 0.05 statistically significant.
Independent t test comparing the mean values of tissue survivin with hematological variables in OSCC Patients.
| Parameters | Cut-off Values | N | Mean ± Std. Deviation | t Value | p Value |
|---|---|---|---|---|---|
| WBC × 109/L | ≥7.9 | 26 | 2039.54 ± 394.83 | 1.080 | 0.284 |
| <7.9 | 37 | 1919.57 ± 459.11 | |||
| Absolute NeutrophilCount × 109/L | ≥4.9 | 21 | 2067.33 ± 411.62 | 1.276 | 0.207 |
| <4.9 | 42 | 1919.95 ± 442.07 | |||
| Absolute LymphocyteCount × 109/L | >1.980 | 20 | 2020.30 ± 404.10 | −0.635 | 0.528 |
| ≤1.980 | 43 | 1945.26 ± 450.54 | |||
| Absolute MonocyteCount × 109/L | ≥0.50 | 38 | 2116.92 ± 380.76 | 3.645 | 0.001 * |
| <0.50 | 25 | 1744.36 ± 420.71 | |||
| NLR | ≥2.39 | 21 | 2241.19 ± 203.90 | 3.896 | 0.001 * |
| <2.39 | 42 | 1833.02 ± 456.42 | |||
| LMR | >3.22 | 33 | 1717.55 ± 434.75 | 6.044 | 0.001 * |
| ≤3.22 | 30 | 2245.77 ± 209.46 | |||
| PLR | >110.6 | 47 | 2007.19 ± 395.99 | −1.197 | 0.236 |
| ≤110.6 | 16 | 1857.13 ± 530.60 |
* p < 0.05 statistically significant.
BIRC5 gene single nucleotide polymorphism/variants based on the analysis of sequence data using the bioinformatics prediction tool PredictSNP2.
| Promoter | Group 1 (n = 20) | Group 2 (n = 10) | Group 3 (n = 10) | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Nucleotide |
Frequency | % | Tissue Survivin |
Frequency | % | Tissue Survivin |
Frequency | % | Tissue Survivin |
| G → T | 7 | 35 | 2228.58 | 3 | 30 | 1104.12 | 3 | 30 | 443.65 |
| G → C | 3 | 15 | 2194.29 | - | - | - | 1 | 10 | 437.12 |
| A → T | 3 | 15 | 2139,39 | 1 | 10 | 1197.3 | 2 | 20 | 428.48 |
| C → T | 2 | 10 | 2204.96 | 5 | 50 | 1104.12 | 3 | 30 | 427.24 |
| C → G | 1 | 5 | 2008.01 | 2 | 20 | 1053.68 | 2 | 20 | 428.48 |
| A → G | - | - | - | 1 | 10 | 1197.3 | 1 | 10 | 424.75 |
| G → A | - | - | - | 3 | 30 | 1053.68 | - | - | - |
| T → G | 1 | 5 | 2082.88 | - | - | - | - | - | - |
| EXON 1 | Group 1 (n = 30) | Group 2 (n = 20) | Group 3 (n = 20) | ||||||
| Nucleotide Variants | Frequency | % |
Tissue Survivin
|
Frequency | % |
Tissue Survivin
|
Frequency | % | Tissue Survivin (average pg/mL) |
| G → A | 4 | 13.33 | 1400.68 | - | - | - | 2 | 10 | 116.35 |
| C → A | 10 | 33.33 | 1649.3 | 1 | 5 | 1197.3 | 1 | 5 | 180.97 |
| A → C | 3 | 10 | 1412.43 | - | - | - | - | - | - |
| G → C | 26 | 86.67 | 1632.77 | 10 | 50 | 1045.56 | 9 | 45 | 398.22 |
| G → T | 8 | 26.67 | 2015.04 | - | - | - | - | - | - |
| C → G | 2 | 6.67 | 2110.49 | - | - | - | - | - | - |
| T → G | 2 | 6.67 | 2427.92 | - | - | - | - | - | - |
| C → T | 1 | 3.33 | 1565.42 | - | - | - | - | - | - |
| EXON 2 | Group 1 (n = 30) | Group 2 (n = 20) | Group 3 (n = 20) | ||||||
| Nucleotide Variants | Frequency | % | Tissue Survivin (Average pg/mL) | Frequency | % |
Tissue Survivin
|
Frequency | % |
Tissue Survivin
|
| A → C | - | - | - | 1 | 5 | 303.97 | 1 | 5 | 432.24 |
| G → C | 1 | 3.33 | 1074.94 | - | - | 3 | 15 | 432.24 | |
| C → T | - | - | - | - | - | 1 | 5 | 428.65 | |
| G → A | 1 | 3.33 | 1074.94 | - | - | 2 | 10 | 428.65 | |
| EXON 3 | Group 1 (n = 30) | Group 2 (n = 20) | Group 3 (n = 20) | ||||||
| Nucleotide Variants | Frequency | % |
Tissue Survivin
|
Frequency | % | Tissue Survivin (Average pg/mL) | Frequency | % |
Tissue Survivin
|
| C → T | - | - | - | 2 | 10 | 720.05 | - | - | - |
| G → C | 1 | 3.33 | 2485.07 | - | - | - | - | - | |
| EXON 4 | Group 1 (n = 30) | Group 2 (n = 20) | Group 3 (n = 20) | ||||||
| Nucleotide Variants | Frequency | % |
Tissue survivin
|
Frequency | % |
Tissue survivin
|
Frequency | % |
Tissue survivin
|
| G → C | - | - | - | 3 | 15 | 1266.55 | 1 | 5 | 422.81 |
| C → T | - | - | - | - | - | 1 | 5 | 422.81 | |
| T → C | 1 | 3.33 | 1850.2 | 2 | 10 | 1310 | - | - | |
| A → T | 2 | 6.67 | 1691.5 | 1 | 5 | 1415 | 2 | 10 | 406.12 |
| C → A | 1 | 3.33 | 2370.77 | - | - | - | - | - | - |
| A → G | 2 | 6.67 | 2272.69 | - | - | - | - | - | - |
| G → T | 3 | 10 | 1711.07 | - | - | - | - | - | - |
| T → G | 1 | 3.33 | 1850.2 | - | - | - | - | - | - |
| A → C | 2 | 6.67 | 1807.81 | - | - | - | - | - | - |
| G → A | 1 | 3.33 | 1765.42 | - | - | - | - | - | - |
| T → A | - | - | - | 2 | 10 | 1157.7 | 1 | 5 | 227.01 |
| EXON 5 | Group 1 (n = 30) | Group 2 (n = 20) | Group 3 (n = 20) | ||||||
| Nucleotide Variants | Frequency | % |
Tissue survivin
|
Frequency | % |
Tissue survivin
|
Frequency | % |
Tissue survivin
|
| A → C | - | - | - | - | - | - | 1 | 5 | 422.81 |
| C → A | 1 | 3.33 | 1850.2 | - | - | - | - | - | - |
| T → A | 4 | 13.33 | 1856.94 | 2 | 10 | 1021.89 | 2 | 10 | 421.03 |
| G → A | 2 | 6.67 | 1542.09 | 1 | 5 | 628.77 | 1 | 5 | 391.69 |
| C → T | 1 | 3.33 | 1244.67 | 1 | 5 | 712.23 | 2 | 10 | 327.18 |
| G → T | 2 | 6.67 | 1542.09 | - | - | - | - | - | - |
| T → G | - | - | - | 1 | 5 | 1415 | - | - | - |
| G → C | 1 | 3.33 | 1850.2 | - | - | - | - | - | - |
| A → T | 1 | 3.33 | 1244.67 | - | - | - | 1 | 5 | 441.29 |
Overall Mean ± SD (n = 63) Tissue Survivin (pg/mL) Group 1 = 1670.9 ± 796.21, Group 2 = 1096.02 ± 346.17, Group 3 = 397.5 ± 96.1.
References
1. Parkin, D.M.; Pisan, P.; Ferlay, J. Global cancer statistics. Am. Cancer Soc.; 1999; 49, pp. 33-64. [DOI: https://dx.doi.org/10.3322/canjclin.49.1.33]
2. Daftary, D.K.; Murti, P.R.; Bhonsle, R.B.; Gupta, P.C.; Mehta, F.S.; Pindborg, J.J. Risk factors and risk markers for oral cancer in high incidence areas of the world. Oral Cancer Cambridge; Johnson, N.W. Cambridge University Press: Cambridge, UK, 1991; Volume 2, pp. 29-63.
3. Gupta, P.C.; Nandakumar, A. Oral cancer scene in India. Oral Dis.; 1999; 5, pp. 1-2. [DOI: https://dx.doi.org/10.1111/j.1601-0825.1999.tb00055.x]
4. Das, B.R.; Nagpal, J.K. Understanding the biology of oral cancer. Med. Sci. Monit.; 2002; 8, pp. 258-267.
5. Gupta, P.C. Mouth cancer in India: A new epidemic?–Data analysis report. J. Indian Med. Assoc.; 1999; 97, pp. 370-373.
6. Murthy, N.S.; Mathew, A. Cancer epidemiology, preventionand control. Curr. Sci.; 2004; 86, pp. 518-527.
7. Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell; 2011; 144, pp. 646-674. [DOI: https://dx.doi.org/10.1016/j.cell.2011.02.013]
8. Lorente, D.; Mateo, J.; Templeton, A.J.; Zafeiriou, Z.; Bianchini, D.; Ferraldeschi, R. Baseline neutrophil lymphocyte ratio (NLR) is associated with survival and response to treatment with second-line chemotherapy for advanced prostate cancer independent of baseline steroid use. Ann. Oncol.; 2015; 26, pp. 750-755. [DOI: https://dx.doi.org/10.1093/annonc/mdu587]
9. Reed, J.C. The survivin saga goes in vivo. J. Clin. Investig.; 2001; 108, pp. 965-969. [DOI: https://dx.doi.org/10.1172/JCI14123]
10. Yoshimura, A. Signal transduction of inflammatory cytokines and tumor development. Cancer Sci.; 2006; 97, pp. 439-447. [DOI: https://dx.doi.org/10.1111/j.1349-7006.2006.00197.x]
11. Cooper, C.S.; Foster, C.S. Concepts of epigenetics in prostate cancer development. Br. J. Cancer; 2009; 100, pp. 240-245. [DOI: https://dx.doi.org/10.1038/sj.bjc.6604771]
12. Chen, X.; Xu, H.; Yuan, P.; Fang, F.; Huss, M.; Vega, V.B. Integration of external signaling pathways with the core transcriptional network in embryonic stem cells. Cell; 2008; 133, pp. 1106-1117. [DOI: https://dx.doi.org/10.1016/j.cell.2008.04.043]
13. Karin, M. Nuclear factor-kappaB in cancer development and progression. Nature; 2006; 441, pp. 431-436. [DOI: https://dx.doi.org/10.1038/nature04870]
14. Gupta, P.C.; Murti, P.R.; Bhonsle, R.B. Epidemiology of cancer by tobacco products and the significance of TSNA. Crit. Rev. Toxicol.; 1996; 26, pp. 183-198. [DOI: https://dx.doi.org/10.3109/10408449609017930]
15. Znaor, A.; Brennan, P.; Gajalakshmi, V.; Mathew, A.; Shanta, V.; Varghese, C.; Boffetta, P. Independent and combined effects of tobacco smoking, chewing and alcohol drinking on the risk of oral, pharyngeal and esophageal cancers in Indian men. Int. J. Cancer; 2003; 105, pp. 681-686. [DOI: https://dx.doi.org/10.1002/ijc.11114]
16. Balaram, P.; Sridhar, H.; Rajkumar, T.; Vaccarella, S.; Herrero, R.; Nandakumar, A.; Ravichandran, K.; Ramdas, K.; Sankaranarayanan, R.; Gajalakshmi, V. et al. Oral cancer in southern India: The influence of smoking, drinking, paan-chewing and oral hygiene. Int. J. Cancer; 2002; 98, pp. 440-445. [DOI: https://dx.doi.org/10.1002/ijc.10200]
17. Warnakulasuriya, K.A.; Johnson, N.W.; Linklater, K.M.; Bell, J. Cancer of mouth, pharynx and nasopharynx in Asian and Chinese immigrants resident in Thames regions. Oral. Oncol.; 1999; 35, pp. 471-475. [DOI: https://dx.doi.org/10.1016/S1368-8375(99)00019-6]
18. Quanri, J.; David, G.M.; Li, M.; Waun, K.H.; Lee, H.-Y. Survivin expression in normal human bronchial epithelial cells: An early and critical step in tumorigenesis induced by tobacco exposure. Carcinogenesis; 2008; 29, pp. 1614-1622.
19. Dasgupta, P.; Kinkade, R.; Joshi, B.; DeCook, C.; Haura, E.; Chellappan, S. Nicotine inhibits apoptosis induced bychemotherapeutic drugs by up-regulating XIAP and survivin. Proc. Natl. Acad. Sci. USA; 2006; 103, pp. 6332-6337. [DOI: https://dx.doi.org/10.1073/pnas.0509313103]
20. Dhirendra, N.S.; Rizwan, S.A.; Prakash, C.G. Smokeless tobacco-associated cancers: A systematic review and meta-analysis of Indian studies. Int. J. Cancer; 2016; 138, pp. 1368-1379.
21. Guangyan, M.; Jiayi, W.; Zhiyan, L.; Hanxu, Z.; Shuang, Z.; Qian, X.; Yimin, C. Association between smokeless tobacco use and oral cavity cancer risk in women compared with men: A systematic review and meta-analysis. BMC Cancer; 2021; 21, 960.
22. Sanner, T.; Grimsrud, T.K. Nicotine: Carcinogenicity and effects on response to cancer treatment—A review. Front. Oncol.; 2015; 5, 196. [DOI: https://dx.doi.org/10.3389/fonc.2015.00196]
23. Fernandez, J.G.; Rodríguez, D.A.; Valenzuela, M.; Calderon, C.; Urzúa, U.; Munroe, D.; Wright, M.C. Survivin expression promotes VEGF-induced tumor angiogenesis via PI3K/Akt enhanced β-catenin/ Tcf-Lef dependent transcription. Molecular Cancer; 2014; 13, 209. [DOI: https://dx.doi.org/10.1186/1476-4598-13-209]
24. Hu, H.; Shikama, Y.; Matsuoka, I.; Kimura, J. Terminally differentiated neutrophils predominantly express Survivin-2α, a dominant-negative isoform of Survivin. J. Leukoc. Biol.; 2008; 83, pp. 393-400. [DOI: https://dx.doi.org/10.1189/jlb.0507282]
25. Altieri, D.C. Survivin, versatile modulation of cell division and apoptosis in cancer. Oncogene; 2003; 22, pp. 8581-8589. [DOI: https://dx.doi.org/10.1038/sj.onc.1207113]
26. Ambrosini, G.; Adida, C.; Altieri, D.C. A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat. Med.; 1997; 3, pp. 917-921. [DOI: https://dx.doi.org/10.1038/nm0897-917]
27. Tanaka, K.; Iwamoto, S.; Gon, G.; Nohara, T.; Iwamoto, M.; Tanigawa, N. Expression of survivin and its relationship to loss of apoptosis in breast carcinomas. Clin. Cancer Res.; 2000; 6, pp. 127-134.
28. Nasu, S.; Yagihashi, A.; Izawa, A.; Saito, K.; Asanuma, K.; Nakamura, M. Survivin mRNA expression in patients with breast cancer. Anticancer Res.; 2002; 22, pp. 1839-1843.
29. Ito, T.; Shiraki, K.; Sugimoto, K.; Yamanaka, T.; Fujikawa, K.; Ito, M. Survivin promotes cell proliferation in human hepatocellular carcinoma. Hepatology; 2000; 31, pp. 1080-1085. [DOI: https://dx.doi.org/10.1053/he.2000.6496]
30. Cohen, C.; Lohmann, C.M.; Cotsonis, G.; Lawson, D.; Santoianni, R. Survivin expression in ovarian carcinoma: Correlation with apoptotic markers and prognosis. Mod. Pathol.; 2003; 16, pp. 574-583. [DOI: https://dx.doi.org/10.1097/01.MP.0000073868.31297.B0]
31. Lehner, R.; Lucia, M.S.; Jarboe, E.A.; Orlicky, D.; Shroyer, A.L.; McGregor, J.A. Immunohistochemical localization of the IAP protein survivin in bladder mucosa and transitional cell carcinoma. Appl. Immunohistochem. Mol. Morphol.; 2002; 10, pp. 134-138. [DOI: https://dx.doi.org/10.1097/00129039-200206000-00007]
32. Monzo, M.; Rosell, R.; Felip, E.; Astudillo, J.; Sanchez, J.J.; Maestre, J. A novel anti-apoptosis gene: Re-expression of survivin messenger RNA as a prognosis marker in non-small-cell lung cancers. J. Clin. Oncol.; 1999; 17, pp. 2100-2104. [DOI: https://dx.doi.org/10.1200/JCO.1999.17.7.2100]
33. Yu, J.; Leung, W.K.; Ebert, M.P.; Ng, E.K.; Go, M.Y.; Wang, H.B. Increased expression of survivin in gastric cancer patients and in first degree relatives. Br. J. Cancer; 2002; 87, pp. 91-97. [DOI: https://dx.doi.org/10.1038/sj.bjc.6600421]
34. Lu, C.D.; Altieri, D.C.; Tanigawa, N. Expression of a novel anti apoptosis gene, survivin, correlated with tumor cell apoptosis andp53 accumulation in gastric carcinomas. Cancer Res.; 1998; 58, pp. 1808-1812.
35. Khan, Z.; Tiwari, R.P.; Mulherkar, R.; Sah, N.K.; Prasad, G.B.; Shrivastava, B.R. Detection of survivin and p53 in human oral cancer: Correlation with clinicopathologic findings. Head Neck; 2009; 31, pp. 1039-1348. [DOI: https://dx.doi.org/10.1002/hed.21071]
36. Lauxen, I.; Oliveira, M.G.; Rados, P.V.; Lingen, M.W.; Nor, J.F.; Sant’ana Filho, M. Immunoprofiling of oral squamous cell carcinomas reveals high p63 and survivin expression. Oral. Dis.; 2014; 20, pp. 76-80. [DOI: https://dx.doi.org/10.1111/odi.12136]
37. Mori, A.; Wada, H.; Nishimura, Y.; Okamoto, T.; Takemoto, Y.; Kakishita, E. Expression of the antiapoptosis gene survivin in human leukemia. Int. J. Hematol.; 2002; 75, pp. 161-165. [DOI: https://dx.doi.org/10.1007/BF02982021]
38. Kato, J.; Kuwabara, Y.; Mitani, M.; Shinoda, N.; Sato, A.; Toyama, T.; Mitsui, A.; Nishiwaki, T.; Moriyama, S.; Kudo, J. et al. Expression of survivin in esophageal cancer: Correlation with the prognosis and response to chemotherapy. Int. J. Cancer; 2001; 95, pp. 305-310. [DOI: https://dx.doi.org/10.1002/1097-0215(20010320)95:2<92::AID-IJC1016>3.0.CO;2-9]
39. Yesupatham, S.T.; Dayanand, C.D.; Azeem Mohiyuddin, S.M. Cellular Concentration of Survivin and Caspase 3 in Habitual Tobacco Chewers with and without Oral Squamous Cell Carcinoma in South Indian Rural Population—A Case Control Study. Diagnostics; 2022; 12, 2249. [DOI: https://dx.doi.org/10.3390/diagnostics12092249]
40. Dai, D.; Liang, Y.; Xie, Z. Survivin deficiency induces apoptosis and cell cycle arrest in HepG2 hepatocellular carcinoma cells. Oncol. Rep.; 2012; 27, pp. 621-627. [DOI: https://dx.doi.org/10.3892/or.2011.1544]
41. Rosa, J.; Canovas, P.; Islam, A.; Altieri, D.C.; Doxsey, S.J. Survivin modulates micro-tubule dynamics and nucleation throughout the cell cycle. Mol. Biol. Cell; 2006; 17, pp. 1483-1493. [DOI: https://dx.doi.org/10.1091/mbc.e05-08-0723]
42. Khan, Z.; Khan, A.A.; Yadav, H.; Prasad, G.B.; Bisen, P.S. Survivin, a molecular target for therapeutic interventions in Squamous cell carcinoma. Cell. Mol. Biol. Lett.; 2017; 22, 8. [DOI: https://dx.doi.org/10.1186/s11658-017-0038-0]
43. Srivastava, K.; Srivastava, A.; Mittal, B. Survivin promoter -31G/C (rs9904341) polymorphism and cancer susceptibility: A meta-analysis. Mol. Biol. Rep.; 2012; 39, pp. 1509-1516. [DOI: https://dx.doi.org/10.1007/s11033-011-0889-9]
44. Nassar, A.; Sexton, D.; Cotsonis, G.; Cohen, C. Survivin expression in breast carcinoma: Correlation with apoptosis and prognosis. Appl. Immunohistochem. Mol. Morphol.; 2008; 16, pp. 221-226. [DOI: https://dx.doi.org/10.1097/PAI.0b013e3180c317bc]
45. Ryan, B.M.; Konecny, G.E.; Kahlert, S. Survivin expression in breast cancer predicts clinical outcome and is associated with HER2, VEGF, urokinase plasminogen activator and PAI-1. Ann. Oncol.; 2006; 17, pp. 597-604. [DOI: https://dx.doi.org/10.1093/annonc/mdj121]
46. Khan, S.; Bennit, H.F.; Turay, D. Early diagnostic value of survivin and its alternative splice variants in breast cancer. BMC Cancer; 2014; 14, 176. [DOI: https://dx.doi.org/10.1186/1471-2407-14-176]
47. Jha, K.; Shukla, M.; Pandey, M. Survivin expression and targeting in breast cancer. Surg. Oncol.; 2012; 21, pp. 125-131. [DOI: https://dx.doi.org/10.1016/j.suronc.2011.01.001]
48. Han, C.H.; Wei, Q.; Lu, K.K.; Liu, Z.; Mills, G.B.; Wang, L.E. Polymorphisms in the survivin promoter are associated with age of onset of ovarian cancer. Int. J. Clin. Exp. Med.; 2009; 2, pp. 289-299.
49. Guo, G.; Zhang, Q.; Yu, Z. Correlation between survivin genetic polymorphisms and lung cancer susceptibility. Int. J. Clin. Exp. Pathol.; 2015; 8, pp. 7426-7430.
50. Upadhyay, R.; Khurana, R.; Kumar, S.; Ghoshal, U.C.; Mittal, B. Role of survivin gene promoter polymorphism (-31G > C) in susceptibility and survival of esophageal cancer in northern India. Ann. Surg. Oncol.; 2011; 18, pp. 880-887. [DOI: https://dx.doi.org/10.1245/s10434-010-1371-y]
51. Xun, C.; Wei, Z.; Shangwu, C.; Dongsheng, Y. Mutation profiles of oral squamous cell carcinoma cells. Adv. Oral Maxillofac. Surg.; 2021; 2, 100026.
52. Sand, L.; Jalouli, M.; Jalouli, J.; Sapkota, D.; Ibrahim, S. P53 Codon 72 polymorphism in oral exfoliated cells in a sudanese population. In Vivo; 2012; 26, pp. 59-62.
53. Ralhan, R.; Agarwal, S.; Nath, N.; Mathur, M.; Wasylyk, A.S. Correlation between p53 mutations and circulating antibodies in betel and tobacco-consuming North Indian population. Oral Oncol.; 2001; 37, pp. 243-250. [DOI: https://dx.doi.org/10.1016/S1368-8375(00)00092-0]
54. Mulot, C.; Stücker, I.; Clavel, J.; Beaune, P.; Loriot, M.A. Collection of human genomic DNA from buccal cells for genetics studies: Comparison between cytobrush, mouthwash, and treated card. J. Biomed. Biotechnol.; 2005; 3, pp. 291-296. [DOI: https://dx.doi.org/10.1155/JBB.2005.291]
55. Bendl, J.; Musil, M.; Stourac, J.; Zendulka, J.; Damborsky, J.; Brezovsky, J. PredictSNP2: A Unified Platform for Accurately Evaluating SNP Effects by Exploiting the Different Characteristics of Variants in Distinct Genomic Regions. PLoS Comput. Biol.; 2016; 12, e1004962. [DOI: https://dx.doi.org/10.1371/journal.pcbi.1004962]
56. Saurabh, B.; Balasubramaniam, G.; Prabhashankar, M.; Aanchal, J. Role of Monocyte Count and Neutrophil-to-Lymphocyte Ratio in Survival of Oral Cancer Patients. Int. Arch. Otorhinolaryngol.; 2017; 21, pp. 21-27.
57. Satoshi, K.; Akihiro, H.; Hiromitsu, H.; Takatsugu, M.; Tomohiro, S.; Tomohiko, K.; Satoshi, F. Pretreatment lymphocyte-to-monocyte ratio as an independent prognostic factor for head and neck cancer. Head Neck; 2016; 39, pp. 247-253.
58. Wu, Y.; Chang, K.; Ho, T. Comparative prognostic value of different preoperative complete blood count cell ratios in patients with oral cavity cancer treated with surgery and postoperative radiotherapy. Cancer Med.; 2021; 10, pp. 1975-1988. [DOI: https://dx.doi.org/10.1002/cam4.3738]
59. Jane, C.; Nerurkar, A.V.; Shirsat, N.V.R.; Deshpande, B.; Amrapurkar, A.D.; Karjodkar, F.R. Increased survivin expression in high-grade oral squamous cell carcinoma: A study in Indian tobacco chewers. J. Oral. Pathol. Med.; 2006; 35, pp. 595-601. [DOI: https://dx.doi.org/10.1111/j.1600-0714.2006.00473.x]
60. Caro, J.J.; Salas, M.; Ward, A. Anemia as an independent prognostic factor for survival in patients with cancer: A systemic, quantitative review. Cancer; 2001; 91, pp. 2214-2221. [DOI: https://dx.doi.org/10.1002/1097-0142(20010615)91:12<2214::AID-CNCR1251>3.0.CO;2-P]
61. Chen, M.H.; Chang, P.M.; Chen, P.M.; Tzeng, C.H.; Chu, P.Y.; Chang, S.Y. Prognostic Significance of a Pretreatment Hematologic Profile in Patients with Head and Neck Cancer. J. Cancer Res. Clin. Oncol.; 2009; 135, pp. 1783-1790. [DOI: https://dx.doi.org/10.1007/s00432-009-0625-1]
62. Alameddine, R.S.; Hamieh, L.; Shamseddine, A. From Sprouting Angiogenesis to Erythrocytes Generation by Cancer Stem Cells: Evolving Concepts in Tumor Microcirculation. BioMed Res. Int.; 2014; 2014, 986768. [DOI: https://dx.doi.org/10.1155/2014/986768]
63. Huang, S.H.; Waldron, J.N.; Milosevic, M.; Shen, X.; Ringash, J.; Su, J. Prognostic Value of Pretreatment Circulating Neutrophils, Monocytes, and Lymphocytes in Oropharyngeal Cancer Stratified by Human Papillomavirus Status. Cancer; 2015; 121, pp. 545-555. [DOI: https://dx.doi.org/10.1002/cncr.29100]
64. Hsueh, C.; Tao, L.; Zhang, M.; Cao, W.; Gong, H.; Zhou, J. The Prognostic Value of Preoperative Neutrophils, Platelets, Lymphocytes, Monocytes and Calculated Ratios in Patients with Laryngeal Squamous Cell Cancer. Oncotarget; 2017; 8, pp. 60514-60527. [DOI: https://dx.doi.org/10.18632/oncotarget.16234]
65. Yuzhen, L.; Xiang, S.; Wenchao, L.; Lijun, M.; Zheng, Y.; Xiaohong, L.; Liuqun, Q.; Wuning, M. Evaluation of the clinical value of hematological parameters in patients with urothelial carcinoma of the bladder. Medicine; 2018; 97, 14.
66. Nakashima, H.; Matsuoka, Y.; Yoshida, R.; Nagata, M.; Hirosue, A.; Kawahara, K. Pre-treatment neutrophil to lymphocyte ratio predicts the chemoradiotherapy outcome and survival in patients with oral squamous cell carcinoma: A retrospective study. BMC Cancer; 2016; 16, 41. [DOI: https://dx.doi.org/10.1186/s12885-016-2079-6]
67. Phulari, R.G.; Rathore, R.S.; Shah, A.K.; Agnani, S.S. Neutrophil: Lymphocyte ratio and oral squamous cell carcinoma: A preliminary study. J. Oral. Maxillofac. Pathol.; 2019; 23, pp. 78-81.
68. Lee, A.; Whyte, M.K.; Haslett, C. Inhibition of apoptosis andprolongation of neutrophil functional longevity by inflammatory mediators. J. Leukoc. Biol.; 1993; 54, pp. 283-288. [DOI: https://dx.doi.org/10.1002/jlb.54.4.283]
69. Brach, M.A.; DeVos, S.; Gruss, H.J.; Herrmann, F. Prolongationof survival of human polymorphonuclear neutrophils by granulocyte-macrophage colony-stimulating factor is caused by inhibition of programmedcell death. Blood; 1992; 80, pp. 2920-2924. [DOI: https://dx.doi.org/10.1182/blood.V80.11.2920.2920]
70. Altznauer, F.; Martinelli, S.; Yousefi, S.; Thurig, C.; Schmid, I.; Conway, E.M.; Schoni, M.H.; Vogt, P.; Mueller, C.; Fey, M.F. et al. Inflammation-associated cell cycle-independent block of apoptosis by survivin in terminally differentiated neutrophils. J. Exp. Med.; 2004; 199, pp. 1343-1354. [DOI: https://dx.doi.org/10.1084/jem.20032033]
71. Temraz, S.; Mukherji, D.; Farhat, Z.A.; Nasr, R.; Charafeddine, M.; Shahait, M.; Wehbe, M.R.; Ghaida, R.A.; Gheida, I.A.; Shamseddine, A. Preoperative lymphocyte-to-monocyte ratio predicts clinical outcome in patients undergoing radical cystectomy for transitional cell carcinoma of the bladder: A retrospective analysis. BMC Urol.; 2014; 76, pp. 14-19. [DOI: https://dx.doi.org/10.1186/1471-2490-14-76]
72. Stotz, M.; Szkandera, J.; Stojakovic, T.; Seidel, J.; Samonigg, H.; Kornprat, P.; Schaberl-Moser, R.; Seggewies, F.; Hoefler, G.; Gerger, A. et al. The lymphocyte to monocyte ratio in peripheral blood represents a novel prognostic marker in patients with pancreatic cancer. Clin. Chem. Lab. Med.; 2015; 53, pp. 499-506. [DOI: https://dx.doi.org/10.1515/cclm-2014-0447]
73. Mantovani, A.; Bottazzi, B.; Colotta, F.; Sozzani, S.; Ruco, L. The origin and function of tumor-associated macrophages. Immunol. Today; 1992; 13, pp. 265-270. [DOI: https://dx.doi.org/10.1016/0167-5699(92)90008-U]
74. Condeelis, J.; Pollard, J.W. Macrophages: Obligate partners for tumor cell migration, invasion, and metastasis. Cell; 2006; 124, pp. 263-266. [DOI: https://dx.doi.org/10.1016/j.cell.2006.01.007]
75. Pollard, J.W. Tumour-educated macrophages promote tumour progressionand metastasis. Nat. Rev. Cancer; 2004; 4, pp. 71-78. [DOI: https://dx.doi.org/10.1038/nrc1256]
76. Dirkx, A.E.; Oude Egbrink, M.G.; Wagstaff, J.; Griffioen, A.W. Monocyte/macrophage infiltration in tumors: Modulators of angiogenesis. J. Leukoc. Biol.; 2006; 80, pp. 1183-1196. [DOI: https://dx.doi.org/10.1189/jlb.0905495]
77. Lewis, C.E.; Pollard, J.W. Distinct role of macrophages in different tumor microenvironments. Cancer Res.; 2006; 66, pp. 605-612. [DOI: https://dx.doi.org/10.1158/0008-5472.CAN-05-4005]
78. Tsai, Y.D.; Wang, C.P.; Chen, C.Y.; Lin, L.W.; Hwang, T.Z.; Lu, L.F.; Hsu, H.F.; Chung, F.M.; Lee, Y.J.; Houng, J.Y. Pretreatment circulating monocyte count associated with poor prognosis in patients with oral cavity cancer. Head Neck; 2014; 36, pp. 947-953. [DOI: https://dx.doi.org/10.1002/hed.23400]
79. Duzlu, M.; Karamert, R.; Tutar, H.; Şahin, M.; Turkcan, A.; Yılmaz, M. Diagnostic role of neutrophil-lymphocyte ratio in oral cavity cancers. Niger. J. Clin. Pract.; 2018; 21, pp. 49-53.
80. Mantovani, A.; Allavena, P.; Sica, A.; Balkwill, F. Cancer-related inflammation. Nature; 2008; 454, pp. 436-444. [DOI: https://dx.doi.org/10.1038/nature07205]
81. Rabinowich, H.; Cohen, R.; Bruderman, I.; Steiner, Z.; Klajman, A. Functional analysis of mononuclear cells infiltrating into tumors:lysis of autologous human tumor cells by cultured infiltrating lymphocytes. Cancer Res.; 1987; 47, pp. 173-177.
82. Cho, H.; Hur, H.W.; Kim, S.W. Pre-treatment neutrophil to lymphocyte ratio is elevated in epithelial ovarian cancer and predicts survival after treatment. Cancer Immunol. Immunother.; 2009; 58, 2346. [DOI: https://dx.doi.org/10.1007/s00262-008-0516-3]
83. Yamanaka, T.; Matsumoto, S.; Teramukai, S.; Ishiwata, R.; Nagai, Y.; Fukushima, M. The baseline ratio of neutrophils to lymphocytes is associated with patient prognosis in advanced gastric cancer. Oncology; 2007; 73, pp. 215-220. [DOI: https://dx.doi.org/10.1159/000127412]
84. Deng, Q.; He, B.; Liu, X. Prognostic value of pre-operative inflammatoryresponse biomarkers in gastric cancer patients and the construction of a predictive model. J. Transl. Med.; 2015; 13, 66. [DOI: https://dx.doi.org/10.1186/s12967-015-0409-0]
85. Han, L.H.; Jia, Y.B.; Song, Q.X.; Wang, J.B.; Wang, N.N.; Cheng, Y.F. Prognostic significance of preoperative lymphocyte-monocyte ratio in patients withresectable esophageal squamous cell carcinoma. Asian Pac. J. Cancer Prev.; 2015; 16, pp. 2245-2250. [DOI: https://dx.doi.org/10.7314/APJCP.2015.16.6.2245]
86. Neal, C.P.; Cairns, V.; Jones, M.J. Prognostic performance of inflammation-based prognostic indices in patients with resectable colorectalliver metastases. Med. Oncol.; 2015; 32, pp. 144-147. [DOI: https://dx.doi.org/10.1007/s12032-015-0590-2]
87. Yamagishi, T.; Fujimoto, N.; Nishi, H. Prognostic significance of the lymphocyte-to-monocyte ratio in patients with malignant pleural mesothelioma. Lung Cancer; 2015; 90, pp. 111-117. [DOI: https://dx.doi.org/10.1016/j.lungcan.2015.07.014]
88. Ying, H.Q.; Deng, Q.W.; He, B.S. The prognostic value of preoperativeNLR, d-NLR, PLR and LMR for predicting clinical outcome in surgical colorectal cancer patients. Med. Oncol.; 2014; 31, pp. 305-309. [DOI: https://dx.doi.org/10.1007/s12032-014-0305-0]
89. Zhang, G.M.; Zhu, Y.; Luo, L. Preoperative lymphocyte-monocyte andplatelet-lymphocyte ratios as predictors of overall survival in patients withbladder cancer undergoing radical cystectomy. Tumour. Biol.; 2015; 36, pp. 8537-8543. [DOI: https://dx.doi.org/10.1007/s13277-015-3613-x]
90. Borst, J.; Ahrends, T.; Babala, N.; Melief, C.J.; Kastenmuller, W. CD4+ T cell help in cancer immunology and immunotherapy. Nat. Rev. Immunol.; 2018; 18, pp. 635-647. [DOI: https://dx.doi.org/10.1038/s41577-018-0044-0]
91. Kumagai, K.; Hamada, Y.; Gotoh, A.; Kobayashi, H.; Kawaguchi, K.; Horie, A. Evidence for the changes of antitumor immune response during lymph node metastasis in head and neck squamous cell carcinoma. Oral. Surg. Oral. Med. Oral. Pathol. Oral. Radiol. Endod.; 2010; 110, pp. 341-350. [DOI: https://dx.doi.org/10.1016/j.tripleo.2010.03.030]
92. Bin-Alee, F.; Arayataweegool, A.; Buranapraditkun, S.; Mahattanasakul, P.; Tangjaturonrasme, N.; Mutirangura, A.; Kitkumthorn, N. Evaluation of lymphocyte apoptosis in patients with oral cancer. Appl. Oral. Sci.; 2020; 28, E20200124. [DOI: https://dx.doi.org/10.1590/1678-7757-2020-0124]
93. Lu, B.; Gonzalez, A.; Massion, P.P. Nuclear survivin as a biomarker for non-small-cell lung cancer. Br. J. Cancer; 2004; 91, pp. 537-540. [DOI: https://dx.doi.org/10.1038/sj.bjc.6602027]
94. Grabowski, P.; Kuhnel, T.; Muhr-Wilkenshoff, F. Prognostic value of nuclear survivin expression in oesophageal squamous cell carcinoma. Br. J. Cancer.; 2003; 88, pp. 115-159. [DOI: https://dx.doi.org/10.1038/sj.bjc.6600696]
95. Tonini, G.; Vicenzi, B.; Santini, D.; Scarpa, D.; Vasaturo, T.; Malacrino, C.; Coppola, R. Nuclear and cytoplasmic expression of survivin in 67 surgically resected pancreatic cancer patients. Br. J. Cancer; 2005; 92, pp. 2225-2232. [DOI: https://dx.doi.org/10.1038/sj.bjc.6602632]
96. Poomsawat, S.; Punyasingh, J.; Vejchapipat, P. Overexpression of survivin and caspase 3 in oral carcinogenesis. Appl. Immunohistochem. Mol. Morphol.; 2014; 22, pp. 65-71. [DOI: https://dx.doi.org/10.1097/PAI.0b013e31828a0d0c]
97. Wheatley, S.P.; Altieri, D.C. Survivin at a glance. J. Cell Sci.; 2019; 132, jcs223826. [DOI: https://dx.doi.org/10.1242/jcs.223826]
98. Boidot, R.; Vegran, F.; Lizard-Nacol, S. Transcriptional regulation of the survivin gene. Mol. Biol. Rep.; 2014; 41, pp. 233-240. [DOI: https://dx.doi.org/10.1007/s11033-013-2856-0]
99. Aspe, J.R.; Wall, N.R. Survivin-T34A: Molecular mechanism and therapeutic potential. Onco. Targets. Ther.; 2010; 3, pp. 247-254.
100. Li, M.; Gao, F.; Yu, X.; Zhao, Q.; Zhou, L.; Liu, W.; Li, W. Promotion of ubiquitination-dependent survivin destruction contributes to xanthohumol-mediated tumor suppression and overcomes radioresistance in human oral squamous cell carcinoma. J. Exp. Clin. Cancer Res.; 2020; 39, 88. [DOI: https://dx.doi.org/10.1186/s13046-020-01593-z]
101. Yazdani, N.; Sayahpour, F.A.; Haghpanah, V. Survivin gene polymorphism association with papillary thyroid carcinoma. Pathol. Res. Pract.; 2012; 208, pp. 100-103. [DOI: https://dx.doi.org/10.1016/j.prp.2011.12.009]
102. Chen, J.; Cui, X.; Zhou, H. Functional promoter -31G/C variant of survivin gene predict prostate cancer susceptibility among Chinese: A case control study. BMC Cancer; 2013; 13, 356. [DOI: https://dx.doi.org/10.1186/1471-2407-13-356]
103. Yang, X.; Xiong, G.; Chen, X. Survivin expression in esophageal cancer: Correlation with p53 mutations and promoter polymorphism. Dis Esophagus.; 2009; 22, pp. 223-230. [DOI: https://dx.doi.org/10.1111/j.1442-2050.2008.00885.x]
104. Li, X.B.; Li, S.N.; Yang, Z.H.; Cao, L.; Duan, F.L.; Sun, X.W. Polymorphisms of survivin and its protein expression are associated with colorectal cancer susceptibility in Chinese population. DNA Cell Biol.; 2013; 32, pp. 236-242. [DOI: https://dx.doi.org/10.1089/dna.2012.1912]
105. Dunajova, L.; Cash, E.; Markus, R.; Rochette, S.; Townley, A.R.; Wheatley, S.P. The N-terminus of survivin is a mitochondrial-targeting sequence and Src regulator. J. Cell Sci.; 2016; 129, pp. 2707-2712. [DOI: https://dx.doi.org/10.1242/jcs.183277]
106. Dohi, T.; Beltrami, E.; Wall, N.R.; Plescia, J.; Altieri, D.C. Mitochondrial survivin inhibits apoptosis and promotes tumorigenesis. J. Clin. Investig.; 2004; 114, pp. 1117-1127. [DOI: https://dx.doi.org/10.1172/JCI200422222]
107. Xia, F.; Canovas, P.M.; Guadagno, T.M.; Altieri, D.C. A survivin-ran complex regulates spindle formation in tumor cells. Mol. Cell Biol.; 2008; 28, pp. 5299-5311. [DOI: https://dx.doi.org/10.1128/MCB.02039-07]
108. Song, Z.; Liu, S.; He, H.; Hoti, N.; Wang, Y.; Feng, S.; Wu, M. A single amino acid change (Asp53-Ala53) converts survivin from anti-apoptotic to pro-apoptotic. Mol. Biol. Cell; 2004; 15, pp. 1287-1296. [DOI: https://dx.doi.org/10.1091/mbc.e03-07-0512]
109. Verdecia, M.A.; Bowman, M.E.; Lu, K.P.; Hunter, T.; Noel, J.P. Structure of the human anti-apoptotic protein survivin reveals a dimeric arrangement. Nat. Struct. Biol.; 2000; 7, pp. 602-608. [DOI: https://dx.doi.org/10.1038/77929]
110. Pavlyukov, M.S.; Antipova, N.V.; Balashova, M.V.; Vinogradova, T.V.; Kopantzev, E.P.; Shakhparonov, M.I. Survivin monomer plays an essential role in apoptosis regulation. J. Biol. Chem.; 2011; 286, pp. 23296-23307. [DOI: https://dx.doi.org/10.1074/jbc.M111.237586]
111. Jeyaprakash, A.A.; Basquin, C.; Jayachandran, U.; Conti, E. Structural basis for the recognition of phosphorylated histone H3 by the Survivin subunit of the chromosomal passenger complex. Structure; 2011; 19, pp. 1625-1634. [DOI: https://dx.doi.org/10.1016/j.str.2011.09.002]
112. Stauber, R.H.; Rabenhorst, U.; Rekik, A.; Engels, K.; Bier, C.; Knauer, S.K. Nucleocytoplasmic shuttling and the biological activity of mouse survivin are regulated by an active nuclear export signal. Traffic; 2007; 7, pp. 1461-1472. [DOI: https://dx.doi.org/10.1111/j.1600-0854.2006.00486.x]
113. Colnaghi, R.; Connell, C.M.; Barrett, R.M.A.; Wheatley, S.P. Separating the anti-apoptotic and mitotic roles of survivin. J. Biol. Chem.; 2006; 281, pp. 33450-33456. [DOI: https://dx.doi.org/10.1074/jbc.C600164200]
114. Temme, A.; Diestelkoetter-Bachert, P.; Schmitz, M.; Morgenroth, A.; Weigle, B.; Rieger, M.A.; Kiessling, A.; Rieber, E.P. Increased p21ras activity in human fibroblasts transduced with survivin enhances cell proliferation. Biochem. Biophys. Res. Commun.; 2005; 327, pp. 765-773. [DOI: https://dx.doi.org/10.1016/j.bbrc.2004.12.075]
115. Al-Khalaf, H.H.; Aboussekhra, A. Survivin expression increases during aging and enhances the resistance of aged human fibroblasts to genotoxic stress. Age; 2013; 35, pp. 549-562. [DOI: https://dx.doi.org/10.1007/s11357-011-9378-2]
116. Lens, S.M.A.; Wolthuis, R.M.; Klompmaker, R.; Kauw, J.; Agami, R.; Brummelkamp, T.; Kops, G.; Medema, R.H. Survivin is required for a sustained spindle checkpoint arrest in response to lack of tension. EMBOJ; 2003; 22, pp. 2934-2947. [DOI: https://dx.doi.org/10.1093/emboj/cdg307]
117. Carvalho, A.; Carmena, M.; Sambade, C.; Earnshaw, W.C.; Wheatley, S.P. Survivin is required for stable checkpoint activation in response to loss of spindle tension in HeLa cells. J. Cell Sci.; 2003; 116, pp. 2987-2998. [DOI: https://dx.doi.org/10.1242/jcs.00612]
118. Rajagopalan, S.; Balasubramanian, M.K. Schizosaccharomyces pombe Bir1p, a nuclear protein that localizes to kinetochores and the spindle midzone, is essential for chromosome condensation and spindle elongation during mitosis. Genetics; 2002; 160, pp. 445-456. [DOI: https://dx.doi.org/10.1093/genetics/160.2.445]
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.