1. Introduction
The growth, development, and yield of crops are seriously affected by various environmental stresses, such as drought, salt, osmotic, heat, cold, UV radiation, heavy metals, pathogenic bacteria, etc. Drought and salinity are two primary abiotic stresses affecting crop yields globally [1]. They also cause secondary salinization of greenhouse soil, limiting the growth of horticultural crops [2]. The suitable prevention strategy is cultivating high-yield and abiotic stress-resistant crops aided by molecular genetics. Molecular genetics is important in determining pivotal genes and regulatory modules involved in salt and drought tolerance and adaptability of stress-tolerant crop plants [3,4]. Plants activate physiological, morphological, and biochemical processes in response to the changing environment [5,6]. Abiotic stresses enhance the accumulation of reactive oxygen species (ROS) and H2O2 (hydrogen peroxide) in peroxisomes, mitochondria, chloroplasts, and other organelles. ROS production is very common in plants under different stress conditions [7]. ROS causes oxidative stress in plant cells, damaging lipids, metabolites, proteins, and nucleic acids, thus affecting multiple biological processes [8]. Proteases rapidly degrade the damaged proteins through proteolysis, which is necessary to regulate stress-signaling molecules by clearing misfolded or unwanted proteins. The cysteine proteases (CPs) play important roles in the proteolysis process of higher plants [9].
Cysteine proteases are an indispensable plant protease family which plays dynamic roles in plant growth and development through proteolysis [10]. Salinity stress increases ROS accumulation and the resulting damaged proteins in cells. Therefore, degrading these proteins is essential for improved plant growth and development during salt stress. Plant proteases participate in salt stress responses, and cysteine proteases play considerable roles in degrading oxidized proteins and regulating ROS contents [11]. The transcriptional level of RD21a and RD19a cysteine proteases were increased under salt and dehydration stress [12]. The mRNA levels of the Cyp15a gene were increased in peas (Pisum sativum) in response to high salt stress [13]. Furthermore, the SPCP2 gene altered the salt and drought stress tolerance of sweet potatoes [14]. Thus, cysteine proteases regulate physiological processes and the signaling pathway of salt stress responses. Hence, identifying the various stress-related proteases and their function may provide more information for increasing the stress resistance and yield potentials of crops.
Our previous study showed the PLCPs family in pepper (Capsicum annuum L.) is divided into SAG12, RD21, XCP, CEP, XBCP3, THI, RD19, ALP, and CTB subfamilies. CaCP15 is a member of the SAG12 (senescence-associated gene 12) subfamily, the largest and richly functional. AtSAG12 is involved in nitrogen remobilization of seed filling and yields [15]. SAG12 is closely associated with senescence and results in high hexose contents in senescent Arabidopsis leaves [16,17,18,19]. NtSAG12 is responsible for amino acid remobilization in tobacco, while OsSAG12 protease negatively regulates stress-induced cell death in rice [20,21].
This study explored how CaCP15 regulates salt and osmotic stress. We first analyzed the molecular characteristic of CaCP15 and investigated its transcriptional level under abiotic and biotic stress. Virus-induced gene silencing (VIGS) of CaCP15 increased salt and osmotic tolerance in pepper; however, CaCP15 overexpression reduced the salt and osmotic tolerance in pepper. CaCP15-overexpressing pepper scavenged ROS via the antioxidant enzymes, and altered the transcriptional levels of the stress-related genes under salt and osmotic stress. Collectively, these results implied that CaCP15 potentially induced salt and osmotic tolerance by co-regulating the antioxidant defense enzymes in pepper.
2. Material and Methods
2.1. Plant Material and Treatments
The seedlings of pepper cultivar B12 were grown under 25/21 °C 16/8 h day/night in a growth chamber with 60% of relative humidity. After growing the 6–8 true leaves stage, the seedlings were subjected to different stress-inducing treatments (100 mM abscisic acid (ABA), 1 mM methyl jasmonate (MeJA), 5 mM salicylic acid (SA), 1 mM ethylene (ETH), 300 mM sodium chloride (NaCl), 300 mM mannitol, 40 °C, 4 °C, and 100 mM hydrogen peroxide (H2O2))[22]. The second to fourth true leaves were sampled at 0, 3, 6, 12, 24, and 48 h. The qRT-PCR was conducted for the tissue-specific analysis of CaCP15 using roots, stems, young leaves, mature leaves, old leaves, flower buds, flowers, and fruits (green and red fruits) [22]. For the fungal pathogen stress, the stem base of the plants was inoculated with Phytophthora capsici (P. capsici) mycelia-containing agar discs, and the plants were placed in an artificial climate chamber at 28 °C, with 16/8 h light/dark photoperiod and relative humidity of 80%. Leaf samples were collected at intervals of 0, 3, 6, 12, 24, 48, 72, and 96 h.
2.2. RNA Isolation and qRT-PCR Analysis
Total RNA was extracted from tissues and leaves of pepper plants under different stress treatments using Trizol (Invitrogen, Carlsbad, CA, USA) method. Complementary DNA (cDNA) was synthesized using the PrimeScript™Kit (TaKaRa, Tokyo, Japan) reagent. The cDNA concentration was measured using a NanoDrop instrument (UNano 1000F, Hangzhou, China) and normalized to 50 ng/ul. The qRT-PCR tests were performed using SYBR®Premix Ex Taq™II (TaKaRa) reagents, and capsaicin ubiquitin-coupled protein gene (CaUBI3) (accession number: AY486137.1) was used as the reference gene. The experiment was conducted in triplicate, and the relative expression levels of genes were calculated using the 2−ΔΔCt comparison threshold method. The primer sequences are shown in Table 1.
2.3. Bioinformatics Analysis of CaCP15
The full-length cDNA of CaCP15 was amplified via PCR using specific primers. We analyzed the molecular weight (MW) and isoelectric point (pI) of CaCP15 protein using the pI/MW program. Multiple sequence alignments and phylogenetic tree analysis were performed using DNAMAN (Lynnon Biosoft, Quebec, Canada) and MEGA5.0. Moreover, the secondary structure and three-dimensional (3D) models of CaCP15 were predicted by SOPMA SECONDARY STRUCTURE PREDICTION METHOD (
2.4. VIGS and Transient Overexpression Assay of CaCP15
The fragments of the CaCP15 gene were cloned from pepper line B12 and inserted into the pTRV2 vector, as previously described, and CaPDS (phytoene desaturase in pepper, accession number: LOC107861625) served as the positive control [24]. After four weeks, the transcriptional level of CaCP15 was measured in pTRV2: CaCP15 and pTRV2 plants. CaCP15-silenced and control plants were treated with NaCl and mannitol (300 mM) for the stress experiment.
Agrobacterium GV3101 cells harboring pSN1301-GUS-CaCP15 or pSN1301-GUS-00 (used as a control) were infiltrated into the leaves of pepper plants at the eight-leaves stage for salt and osmotic assays [22,25].
2.5. Physiological Parameters Measurements
Total chlorophyll and malondialdehyde (MDA) contents were measured as previously described [26,27]. The H2O2 and proline contents were determined according to the modified method by Wang et al. [28]. The activities of the antioxidant enzymes (mutase and peroxidase) in pepper leaves were measured as described by Beauchamp et al. and Ranieri et al. [29,30].
2.6. Statistical Analysis
SPSS 22.0 software was used to analyze the data (p < 0.05). The histograms were generated using SigmaPlot 14.0. The analyzed data were presented as the means ± standard deviation (SD).
3. Results
3.1. Identification and Characterization of the CaCP15 Gene
CaCP15 (LOC107859299) contained a complete open reading fragment (ORF) of 1032 bp, containing 343 amino acids with a theoretical MW of 37.98 kDa and a calculated pI of 5.44. The CaCP15 was distributed on chromosome 2 (chr2) and predicted to localize in the vacuoles. One intron was found between the nucleotide sites 531–852 (Figure 1a). CaCP15 had eleven consensus motifs (Figure 1b), and the N terminus of CaCP15 contained a transmembrane helix (position F5–T24). Inhibitor 129 (H38-F95) and peptidase_C1 (V128-T342), highly conserved domains, were found in CaCP15 amino acid sequences (Figure 1c). The secondary structure of CaCP15 mainly contained 34.99% of α helices, 15.16% of strands, 6.41% of β turns, and 43.44% of random coils. Thus, the random coil occupied the largest proportion of secondary structures, followed by α helices and extended strands. Moreover, the tertiary structure of CaCP15 was generated using homologous modeling. The 3D models of CaCP15 were based on template c6u7dA (PDB header: plant protein, Chain:A; PDB Molecule:fbsb; PDBTitle: recombinant stem bromelain precursor) (Figure 1d). The composition and location of the secondary structure of the protein were observed distinctly.
3.2. Multi-Sequence Alignment and Phylogenetic Analysis of CaCP15
We previously predicted that CaCP15 belongs to the SAG12 subfamily, containing two highly conserved interspersed ERFNIN motif (position E54–N73) and GCNGG motif (G189–G193). CaCP15 protein contained four conserved CP catalytic triads; Cys (C149), His (H285), Glu residue (Q146), and Asn (N307). Sequence alignment of the CPs from different plants showed high homology (Figure 2). These included NtCP (similarity 76.20%, accession number: XP_016449747.1), SlCP (80.64%, NP_001233949.2), EgCP (56.05%, XP_010912725.1), DcCP (52.29%, XP_017246374.1), HbCP (54.15%, XP_021635714.1), PtCP (54.60%, XP_002316833.3), AtCP (52.79%, NP_566920.1), SiCP (54.02%, XP_011086005.1), OsCP (49.41%, XP_015619461.1), ZmCP (47.23%, XP_020395776.1). A phylogenetic tree showed the evolutionary relationship between the CaCP15 and the other CPs (Figure 3). CaCP15, SlCP, StCP, NtCP, AtCP, and EgCP clustered in the same clade, while, ZmCP, OsCP, CsCP, PtCP, HbCP, SiCP, and DcCP formed a different cluster. CaCP15 was closely related to SlCP and StCP, suggesting they may have a similar function.
3.3. Promoter Analysis of CaCP15
The cis-acting regulatory elements of the CaCP15 promoter were identified to characterize the transcriptional regulation of CaCP15 (Figure 4). The result revealed the existence of some putative cis-acting regulatory elements modulating stress response and defense-related genes in the promoter region. These elements contained one TC-rich repeats (defense and stress responsiveness), one GT-1 cis-element (salt-stress response), one MYB (drought- stress related), two MYC (drought-stress related), one Myb (regulated anthocyanin pigment), one ABRE (abscisic acid responsiveness), three ARE (auxin responsiveness), and one WUN motif (wound-responsive). Moreover, we identified 19 CAAT-box (promoter and enhancer regions) and some light-responsive elements (One GATA-box, one GA motif, one Box4, and two P-box). In addition, more than half of all putative cis-elements occurred between −1000 to −1 bp within the promoter sequence.
3.4. Expression Analysis of CaCP15 in Pepper
To explore the potential functions of CaCP15, we analyzed the expression profiles of CaCP15 in various pepper tissues under various stresses by qRT-PCR (Figure 5 and Figure 6 and [22]). The results showed that CaCP15 was detected in various tissues. Compared with the roots, the expression level of CaCP15 in the stems was 8-fold higher, suggesting that CaCP15 may be involved in stem development (Figure 5a, [22]). The expression of CaCP15 varied in different leaf development stages. Compared with the roots, CaCP15 was highly expressed in young and mature leaves than that old leaves (Figure 5a). ABA, ETH, SA, and MeJA were respectively sprayed on the leaves of B12 pepper plants at the six-leaf stage leaves. We found that CaCP15 was upregulated to varying degrees under different exogenous hormone treatments. ABA slightly decreased the transcription level of CaCP15 within 6 h of the treatment, but the CaCP15 transcripts later increased, reaching the peak at 12 h. Interestingly, CaCP15 was drastically downregulated in the ABA-treated plants at 24 h compared with the control (0 h) (Figure 5b). ETH and SA gradually upregulated CaCP15 within 12 h of the treatment, resulting in 7.5- and 4.8-fold increments in the CaCP15 transcripts, respectively, compared to the control. However, the CaCP15 transcript levels declined rapidly at 48 h (Figure 5c,d). The MeJA treatment slightly downregulated CaCP15 expression at 3 h and 12 h, reaching the lowest point within the first 3 h, after which CaCP15 expression was increased, reaching the peak (5-fold) at 48 h post-treatment (Figure 5e). The results indicated that the CaCP15 gene could be regulated by the four signaling molecules (ABA, ETH, MeJA, and SA).
As shown in Figure 4f, the expression level of CaCP15 was increased in pepper plants inoculated with Phytophthora capsicipc. The P. capsicipc reduced the expression level of CaCP15 within the first 3 h after infection but were gradually upregulated the expression upregulated before 48 h post-treatment, reaching the peak of the expression 3.5-fold higher than the control. After that, there was a sharp reduction at 72 h, reaching the lowest expression level. Interestingly, CaCP15 transcripts were slightly upregulated at 96 h and then reduced to the same expression level at 24 h (Figure 5f). These results suggested that CaCP15 possibly participated in the pepper resistance to pathogens.
To determine the roles of CaCP15 in response to salt, osmotic, drought, cold, heat, and oxidative stresses, we artificially altered the growth environment of pepper plants (Figure 6, [22]). For the salt and osmotic stress, pepper plants were soaked in NaCl and mannitol solution, respectively. The CaCP15 expression was gradually enhanced by NaCl (300 mM) treatment at 3 h and constant until 6 h, followed by an increment that represented the peak expression (to 3.4-fold) at 12 h (Figure 6a). Similarly, mannitol treatment increased the CaCP15 transcripts, reaching the peak (2.7-fold) at 6 h. However, the expression level of CaCP15 gradually declined until 48 h post-treatment, at which point the transcript levels were lower than those of the control (Figure 6b). Under drought stress, the transcription level of CaCP15 was slightly downregulated in the leaves of pepper plants at 3 h but was upregulated from 3 h to 6 h after uprooting the pepper plants. Interestingly, the transcription level of CaCP15 was rapidly downregulated at 12 h, a same level relative to the control. However, compared to the control (0 h), CaCP15 expression had a 2.0-fold upregulation under drought stress at 24 h, reaching the peak (Figure 6c). To analyze the abundance of CaCP15 transcripts under cold and heat stress, we exposed pepper plants to 4 °C and 40 °C in the illumination incubator. Results showed that the transcription level of CaCP15 showed a downregulation trend at 4 ℃ and 40 °C. As shown in Figure 6d, CaCP15 expression declined drastically within the first 3 h of the 4 °C treatment and remained constant at 6 h. There was a sharp increase in CaCP15 expression at 12 h and a decrease at 24 h. In the 40 °C treatment, CaCP15 expression reduced in the first 1 h and suddenly increased at 3 h. Interestingly, CaCP15 transcript levels were slightly downregulated from 6 h to 24 h (Figure 6e). Pepper plants were also sprayed with 100 mM H2O2 to study whether the CaCP15 gene responded to oxidative stress. Compared with the control (0 h), the transcriptional level of CaCP15 remained stable at 3 h but was dramatically downregulated at 6 h after treatment, reaching the bottom. Thereafter, the CaCP15 expression was sharply enhanced at 12 h and gradually downregulated from 24 h to 48 h (Figure 6f). The results showed that the CaCP15 gene responded positively to these abiotic stresses.
3.5. Knockdown of CaCP15 Enhnaces Salt and Osmotic Stress Resistance in Pepper
CaCP15 was silenced in pepper by the VIGS technique to verify the function of CaCP15 under salt and osmotic stress [24]. At two weeks after planting, the B12 pepper plants were infiltrated with Agrobacterium cells containing TRV2:00, TRV2:CaPDS, and TRV2:CaCP15 vectors and were subjected to stress treatments after about 45 days of the infiltration. The empty vector TRV2:00 was used as the negative control. Since CaPDS silencing caused leaf photobleaching symptoms, the TRV2: CaPDS plants were used as the positive controls for detecting VIGS efficiency. As shown in Figure 7a, TRV2: CaPDS plants showed obvious leaf photobleaching symptoms, indicating that the VIGS system was successful. Compared with the TRV2:00 plants, TRV2:CaCP15 plants had no morphological changes after 45 days of inoculation (Figure 7a). Therefore, we measured the expression level of CaCP15 in the leaves of TRV2:00 and TRV2:CaCP15 plants by qRT-PCR. The efficiency of CaCP15 silencing was 80% lower in the CaCP15-silenced plants compared with the control, implying that CaCP15 was successfully silenced by the VIGs assays (Figure 7b). To determine the function of CaCP15 under salt or osmotic stress, we exposed the leaf discs (1.0 cm in diameter) from the leaves of TRV2:00 and TRV2:CaCP15 plants to NaCl or mannitol solution (300 mM), with sterile water as the control. After 3 days, the leaf discs of the control plants subjected to salt or osmotic stress exhibited a bleached phenotype compared to those subjected to the control (sterile water), and more obvious than the leaf discs of TRV2: CaCP15 under stress (Figure 7c). Hence, we measured the chlorophyll content of the leaf discs under different treatments. The chlorophyll content in the TRV2:CaCP15 and TRV2:00 plants was reduced after treatment, and the leaf discs of the TRV2:00 plants degraded more than those of CaCP15-silenced plants discs (Figure 7d). Moreover, we also measured the MDA content, which reflected the degree of leaf damage under stress. As shown in Figure 7e, MDA accumulation was gradually increased in TRV2:CaCP15 and TRV2:00 plants after NaCl or mannitol treatment, but the MDA content of the control plants was higher than that of TRV2:CaCP15 plants. These findings proved that CaCP15 silencing could enhance the salt and osmotic stress resistance in pepper.
3.6. Transient Overexpression of CaCP15 Reduces Salt and Osmotic Stress Resistance in Pepper
To further investigate the function of CaCP15 in salt and osmotic stress tolerance, we overexpressed CaCP15 in pepper leaves using the 35S:CaCP15 vector, with taking the 35S:00 empty vector as the control. The infiltrated plants were treated with NaCl, mannitol, and water (control). After 12 h post-treatment, the leaves of CaCP15-overexpressing plants had significantly wilted compared with the 35S:00 leaves under salt and osmotic stress (Figure 8a). We further measured the physiological indexes related to the ROS system. The leaves of CaCP15-overexpressing and control plants showed excessive MDA accumulation, which was higher in the CaCP15-overexpressing leaves than in the 35S:00 plants under stress (Figure 8b). The MDA content in 35S: CaCP15 plants showed a 51.1% increase compared with 35S:00 plants under osmotic stress. Similarly, the H2O2 content was increased in all plants under stress, and the content was markedly higher in CaCP15-overexpressing leaves than in the 35S:00 plants. The H2O2 content of the CaCP15-overexpressing leaves increased by 16.1% under salt stress and 45.3% under osmotic stress (Figure 8c). In addition, superoxide dismutase (SOD) and peroxidase (POD) activities in 35S: CaCP15 and 35S:00 plants were significantly enhanced under salt or osmotic stress compared with the control. However, the accumulation of main ROS-scavenging enzymes in the CaCP15-overexpressing leaves was significantly lower than in control leaves under stress. Compared with the control, the activities of SOD in 35S:CaCP15 plants decreased by 38.0% under salt stress, while the activities of POD reduced by 25.5% under salt stress and 32.3% under osmotic stress (Figure 8d,e). In contrast, the proline content was reduced in response to salt and osmotic stress in all plants. The degree of reduction in the CaCP15-overexpression leaves (14.5% under salt and 26.7% under osmotic stress) was more obvious than in 35S:00 plants (Figure 8f). Furthermore, we also measured the transcriptional level of antioxidant-related genes (CaPOD, CaSOD, and CaCAT) and stress-related genes (CaNHX1, CaP5CS, CaPOX2, and CaSOS1) to analyze the function of CaCP15 in pepper under salt or osmotic stress. As shown in Figure 8g, there was a significant increase 35S:CaCP15 and 35S:00 plants under salt or mannitol stress, and the transcriptional levels of these genes were significantly lower in the CaCP15-overexpression leaves than in the control plants (Figure 8g). Overall, CaCP15 overexpression increased the sensibility to salt and osmotic stresses, suggesting that CaCP15 may play a negative regulatory role in the salt and osmotic stress resistance of pepper.
4. Discussion
PLCPs are a functional proteolytic enzyme family involved in plant growth, development, senescence, immune and stress responses [31]. The PLCPs family has complementary and redundant functions, making it difficult to determine the functional importance of a particular PLCP in plants. In this study, we characterized a multiple stress-induced proteolytic enzyme CaCP15. CaCP15 is a member of the SAG12 subfamily, with two typical conserved domains: “ERFNIN” and “GCNGG” motifs. This is consistent with the other members of the SAG12 subfamily [22]. The CPs sequences of other plants also have “ERFNIN” and “GCNGG” conserved regions, demonstrating that the functions of the two domains are important. The evolutionary tree analyses of the CP proteins showed CaCP15 was homologous to NtCP15 and SlCP15 in tobacco and tomato, respectively. A previous study have proved that SlCP15 is one of the immune proteases in tomatoes [32]. NtCP15 confers resistance to pathogens [33]. Similarly, we verified that CaCP15 expression was increased after P. capsicipc treatment. Besides, MeJA and SA applications increased the CaCP15 transcripts to 5.0-fold compared with the control. MeJA and SA are critical in plant defense against pathogen infection [34,35]. Our results indicated that CaCP15 might be involved in the resistance against pathogenic bacteria through the MeJA- and SA-dependent signaling pathways in pepper. The tissue expression analysis of CaCP15 in pepper showed that the transcription level of CaCP15 was 8-fold higher in the stems than in the roots, suggesting that the gene may play a role in stem development.
In plants, CPs are involved in salt and osmotic stress responses. For example, the expression levels of AtRD21A and AtRD19A in Arabidopsis were increased under salt stress [12]. The transcription level of Cyp15a was increased in pea seedlings treated with NaC1 [13], and the wheat PLCP gene (TaCP) was upregulated by salt stress [36]. SPCP2-overexpressing Arabidopsis thaliana had enhanced salt stress resistance [14]. Salinity stress increased the expressions of CPs genes (LOC_Os01g73980, LOC_Os02g27030, and LOC_Os05g01810) in rice [37]. The two barley CysProt were involved in drought stress response [38]. Furthermore, CaCP11 and CaCP34 participated in salt and mannitol stress resistance of pepper [22,24]. These studies suggest that CPs may play important roles in abiotic stress responses in plants. We identified several cis-elements in putative promoter regions of CaCP15, which could respond to signal molecules and environmental stresses. Interestingly, one GT-1 motif, a cis-acting element involved in response to salt stress [39], and one MYB and two MYC drought-stress-related cis-acting elements were found in the CaCP15 promoter [40]. Hence, we used qRT-PCR analysis to verify the function of CaCP15 under abiotic stress and exogenous plant hormone application. The results revealed that CaCP15 was regulated by salt and osmotic stress, and its transcription level increased by 3.3-fold at 12 h under NaCl treatment and 2.7-fold at 6 h under mannitol treatment compared with at 0 h. In addition, ABA application upregulated CaCP15 expression, and the expression level at 12 h was 2.0-fold higher than that at 0 h. Similarly, ETH treatments also enhanced the CaCP15 expression, and the expression level at 12 h was increased by 7.5-fold compared with at 0 h. Since ABA and ETH signaling pathways are central regulators of abiotic stress responses in plants, we hypothesized that CaCP15 responded to abiotic stress through the ABA or ETH signaling pathway [41,42,43]. We used VIGs and transient overexpression assay to further verify the function of CaCP15 in response to salt and osmotic stress. Chlorophyll content can reflect the damage degree of plants under stress [44]. It was found that deletion or overexpression of CPs, such as AtCEP1 and HvPAP14, could induce changes in the expression of photosynthetic genes in plants [45,46]. Thus, chlorophyll content can be affected by CPs in the cytoplasm [47]. Compared with control plants, the total chlorophyll content in the CaCP15-silenced leaves showed a 36.7% and 64.6% increase after NaCl and mannitol treatments, respectively. ROS-induced lipid peroxidation is an internal indicator of ROS damage, reflected by the MDA content [48]. MDA is generally used to evaluate the degree of ROS-mediated lipid peroxidation in plants under high salt stress [48]. The MDA content in the CaCP15-silenced leaves was lower than control plants after the treatments, and the CaCP15-silenced leaves showed a 31.6% reduction under salt stress and a 33.4% reduction under osmotic stress. However, the transiently overexpressing-CaCP15 leaves showed a 51.1% increase in the MDA content and had 43.3% higher H2O2 contents than the controls control under osmotic stress. Salt stress also slightly increased the MDA and H2O2 contents in the 35S:CaCP15 leaves compared to the 35S:00 plants. H2O2 is a product of ROS [49]. Thus, these results showed that CaCP15 might play a negative role in the abiotic stress response of pepper by clearing ROS accumulation. We also observed the variation in the activities of the major ROS scavenging enzymes (SOD and POD) in the transiently overexpressing-CaCP15 plants experiment with significant differences before and after treatments. The SOD and POD activities of the CaCP15- overexpression plants were significantly lower than those of the control. The antioxidant enzyme system and enzyme encoding genes (CaPOD, CaSOD, and CaCAT) were activated under stress conditions to protect pepper from the injuries caused by stress [50]. In our study, the stress treatments reduced the expression of CaPOD, CaSOD, and CaCAT in the CaCP15-overexpression pepper plants. Salt stress significantly improved the activities of the antioxidant enzymes to decompose H2O2, a product of ROS, suggesting that ROS-scavenging plays an important role in salt tolerance mechanism [51]. These results showed that CaCP15 overexpression reduced the stress resistance of pepper by reducing the ROS scavenging enzymes activities.
Proline protects against osmotic stress, and NtP5CS1 is involved in proline biosynthesis under salt stress [52]. The proline content and the expression of CaP5CS were lower in the CaCP15-overexpressing leaves than in control under stress. CaCP15 increased the sensitivity of plants to salt and osmotic stress. Moreover, the stress response genes, such as SOS, NHX1, P5CS, etc., could be activated under stress [53,54,55,56]. The transcription levels of NtSOS1 and NtNHX1 were significantly increased in AlSRG1 transgenic tobacco under salt or osmotic stress, increasing their abiotic stress resistance [57]. ZmMKK4 regulated osmotic stress response in transgenic tobacco by ROS-scavenging, and NtPOX1 was upregulated in the ZmMKK4-overexpressing plants [58]. In our study, the expression of CaSOS1, CaPOX2, and CaNHX1 in CaCP15-overexpression pepper leaves was reduced under stress compared to the control leaves, showing that CaCP15 overexpression enhanced the sensitivity of pepper to salt and osmotic stress.
5. Conclusions
In conclusion, CaCP15 is a SAG12 protein containing two highly conserved domains. The expression profile revealed that CaCP15 was associated with the development of pepper stems and was involved in abiotic and biotic stress responses. CaCP15 silencing in pepper enhanced salt and osmotic stress resistance. Contrarily, transient overexpression of CaCP15 reduced salt and osmotic stress resistance by decreasing the antioxidant enzyme activities and negatively regulating the stress-related genes. In summary, CaCP15 may negatively regulate salt and osmotic stress resistance in pepper. This study demonstrates the molecular and physiological responses of CaCP15 to salt and osmotic restress in plant. Our future studies will focus on determining the factors the interacting with CaCP15 under salt and osmotic stress to understand the regulatory pathways and mechanisms related to abiotic stress for breeding stress-resistant pepper varieties.
Validation, L.Z. and S.Y.; Data curation, L.Z.; Writing—original draft, L.Z. and H.X.; Visualization, L.Z. and J.W.; Bioinformatics analysis; C.C.; Writing—editing, C.C. Writing—review & editing, M.L., Q.D., Y.Y., J.W. and H.X.; Conceptualization, H.X.; Resources, H.X.; Supervision, H.X.; Funding acquisition, H.X. All authors have read and agreed to the published version of the manuscript.
Not applicable.
Not applicable.
Not applicable.
The authors declare that they have no known competing financial interests about the work reported in this paper.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 1. The gene and protein structures of CaCP15. (a) The gene structures of CaCP15, (b) The conserved motifs of CaCP15, (c) Two highly conserved domains of CaCP15, (d) The three-dimensional models of the CaCP15.
Enlarge this image.Figure 2. Multiple sequence alignment of CPs. Dark-blue background, pink background, and blue background respectively signified 100%, 75%, and 50% conserved amino acid residues. The single line presented the ERFNIN motif; the arrow presented the GCNGG motif, and the different colors triangles indicated the catalytic triad Cys-, His-, Asn, and Glu-active site residue, respectively.
Enlarge this image.Figure 3. Phylogenetic analysis of CaCP15 and other plants CPs. Ca, Capsicum annuum L.; At, Arabidopsis thaliana; St, Solanum tuberosum; Dc, Daucus carota; Sl, Solanum lycopersicum; Cs, Cannabis sativa; Nt, Nicotiana tabacum; Eg, Elaeis guineensis; Hb, Hevea brasiliensis; Os, Oryza sativa; Si, Sesamum indicum; Pt, Populus trichocarpa; Zm, Zea mays.
Enlarge this image.Figure 5. Expression patterns of CaCP15 in different tissues, responsing to exogenous phytohormones and phytophthora capsici. (a) Expression of CaCP15 in different tissues; (b) Expression of CaCP15 under ABA; (c) Expression of CaCP15 under ETH; (d) Expression of CaCP15 under SA; (e) Expression of CaCP15 under MeJA; (f), Expression of CaCP15 under phytophthora capsici.
Enlarge this image.Figure 6. Expression patterns of CaCP15 under abiotic stresses. (a) salt, (b) osmotic, (c) drought, (d) cold, (e) heat, and (f) oxidative stresses.
Enlarge this image.Figure 7. Silencing of CaCP15 enhances salt and osmotic stress resistance in pepper. (a) TRV2-CaPDS, TRV2:00, and TRV2-CaCP15 pepper plants; (b) The efficiency of CaCP15 silencing in leaves; (c) The manifestations of CaCP15- silenced and control leaves discs to salt and osmotic stresses; (d,e) Chlorophyll and MDA contents of the CaCP15-silenced and control leaf discs in response to 300 mM NaCl and mannitol stresses, respectively. The values are the means ± SE (standard error) of three independent replicates. The letters (a–e) represent significant differences according to Tukey’s test (p < 0.05).
Enlarge this image.Figure 8. Transient overexpression of CaCP15 reduces salt and osmotic stress resistance in pepper. (a) Phenotypes of pepper leaves under salt or mannitol stress and control; (b) MDA and (c) H2O2 contents; (d,e) SOD and POD enzymes activities, and (f) Proline content; (g) Expression of antioxidant-related genes and stress-related genes in overexpression and control plants. All the values are the means of three independent replicates ± SE (standard error). Means with different letters represent significantly different according to Tukey’s test (p < 0.05).
Primer sequences in this study.
| Primers | Sequence (5′–3′) |
|---|---|
| Primer sequences of VIGS | |
| TRV2-CaCP15F | GCTCTAGAACCAGCAAGTGAGTCGTCAT |
| TRV2-CaCP15R | CGGGATCCCTTCATGAATCTTCAATTACTAGCT |
| CaPDSF | TGTTGTCAAAACTCCAAGGTCTGTA |
| CaPDSR | TTTCTCCCACTTGGTTCACTCTTGT |
| Primer sequences of ORF | |
| CaCP15 | GGTACCATGGCATTCAATTTTTACCACAAAA |
| CaCP15 | GGATCCTCAAACAGTTGGGAAAGAAGC |
| Quantitative real-time PCR | |
| CaCP15-F | TGGCAGAGCATGGGAAAGTA |
| CaCP15-R | CGTGCCCAAATACATAGCCC |
| CaUBI3-F | TGTCCATCTGCTCTCTGTTG |
| CaUBI3-R | CACCCCAAGCACAATAAGAC |
| CaPOD-F | AACAGGGAAACCCGAATGGG |
| CaPOD-R | TTTGGTGCAGCCCTCTTCTC |
| CaSOD-F | GAGAACCGTCATGCTGGTGA |
| CaSOD-R | GAGAGGAATCTGCTCGTCGG |
| CaCAT-F | AAGCAGGCTGGGGAGAGATA |
| CaCAT-R | CATGAGTGACTCGGGGATCG |
| CaP5CS-F | ATTCTGCTGATCCTGCTCGG |
| CaP5CS-R | CCCGAATCTGCTCACACAGT |
| CaPOX2-F | ACCCAACGATAACTCAGCCA |
| CaPOX2-R | AGTTGGCTGTTCTTGCATCG |
| CaSOS1-F | ACTGGAGCTGGTCAACATCA |
| CaSOS1-R | AGCTCCCCAGTTAAAGGTCC |
| CaNHX1-F | AGGCAGTCGAGTACAGTGTC |
| CaNHX1-R | ATGGGGCGCATGAATGAATC |
References
1. Golldack, D.; Lüking, I.; Yang, O. Plant tolerance to drought and salinity: Stress regulating transcription factors and their functional significance in the cellular transcriptional network. Plant Cell Rep.; 2011; 30, pp. 1383-1391. [DOI: https://dx.doi.org/10.1007/s00299-011-1068-0]
2. Yu, H.Y.; Li, T.; Zhou, J.M. Secondary salinization of greenhouse soil and its effects on soil properties. Soils; 2005; 37, pp. 581-586. [DOI: https://dx.doi.org/10.3321/j.issn:0253-9829.2005.06.002]
3. Vij, S.; Tyagi, A.K. Emerging trends in the functional genomics of the abiotic stress response in crop plants: Review Article. Plant Biotechnol. J.; 2007; 5, pp. 361-380. [DOI: https://dx.doi.org/10.1111/j.1467-7652.2007.00239.x]
4. Sanchez, D.H.; Pieckenstain, F.L.; Szymanski, J.; Erban, A.; Bromke, M.; Hannah, M.A.; Kraemer, U.; Kopka, J.; Udvardi, M.K. Comparative functional genomics of salt stress in related model and cultivated plants identifies and overcomes limitations to translational genomics. PLoS ONE; 2011; 6, pp. 14-19. [DOI: https://dx.doi.org/10.1371/journal.pone.0017094]
5. van Zelm, E.; Zhang, Y.; Testerink, C. Salt tolerance mechanisms of plants. Annu. Rev. Plant Biol.; 2020; 71, pp. 403-433. [DOI: https://dx.doi.org/10.1146/annurev-arplant-050718-100005] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32167791]
6. Hirayama, T.; Shinozaki, K. Research on plant abiotic stress responses in the post-genome era: Past, present and future. Plant J.; 2010; 61, pp. 1041-1052. [DOI: https://dx.doi.org/10.1111/j.1365-313X.2010.04124.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20409277]
7. Jaspers, P.; Kangasjärvi, J. Reactive oxygen species in abiotic stress signaling. Physiol. Plant; 2010; 138, pp. 405-413. [DOI: https://dx.doi.org/10.1111/j.1399-3054.2009.01321.x]
8. Hasanuzzaman, M.; Hossain, M.A.; da Silva, J.A.T.; Fujita, M. Plant response and tolerance to abiotic oxidative stress: Antioxidant defense is a key factor. Crop Stress and Its Management: Perspectives and Strategies; Venkateswarlu, B.; Shanker, A.K.; Shanker, C.; Maheswari, M. Springer: Dordrecht, The Netherlands, 2012; pp. 261-315. ISBN 978-94-007-2220-0
9. Roberts, I.N.; Caputo, C.; Criado, M.V.; Funk, C. Senescence-associated proteases in plants. Physiol. Plant; 2012; 145, pp. 130-139. [DOI: https://dx.doi.org/10.1111/j.1399-3054.2012.01574.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22242903]
10. Van Wyk, S.G.; Du Plessis, M.; Cullis, C.A.; Kunert, K.J.; Vorster, B.J. Cysteine protease and cystatin expression and activity during soybean nodule development and senescence. BMC Plant Biol.; 2014; 14, 294. [DOI: https://dx.doi.org/10.1186/s12870-014-0294-3] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25404209]
11. van der Hoorn, R.A.L. Plant proteases: From phenotypes to molecular mechanisms. Annu. Rev. Plant Biol.; 2008; 59, pp. 191-223. [DOI: https://dx.doi.org/10.1146/annurev.arplant.59.032607.092835] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18257708]
12. Koizumi, M.; Yamaguchi-Shinozaki, K.; Tsuji, H.; Shinozaki, K. Structure and expression of two genes that encode distinct drought-inducible cysteine proteinases in Arabidopsis thaliana. Gene; 1993; 129, pp. 175-182. [DOI: https://dx.doi.org/10.1016/0378-1119(93)90266-6]
13. Jones, J.T.; Mullet, J.E. A salt- and dehydration-inducible pea gene, Cyp15a, encodes a cell-wall protein with sequence similarity to cysteine proteases. Plant Mol. Biol.; 1995; 28, pp. 1055-1065. [DOI: https://dx.doi.org/10.1007/BF00032666]
14. Chen, H.J.; Su, C.T.; Lin, C.H.; Huang, G.J.; Lin, Y.H. Expression of sweet potato cysteine protease SPCP2 altered developmental characteristics and stress responses in transgenic Arabidopsis plants. J. Plant Physiol.; 2010; 167, pp. 838-847. [DOI: https://dx.doi.org/10.1016/j.jplph.2010.01.005] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20129700]
15. James, M.; Masclaux-Daubresse, C.; Marmagne, A.; Azzopardi, M.; Laîné, P.; Goux, D.; Etienne, P.; Trouverie, J. A New Role for SAG12 cysteine protease in roots of Arabidopsis thaliana. Front. Plant Sci.; 2019; 9, 1998. [DOI: https://dx.doi.org/10.3389/fpls.2018.01998] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30687379]
16. Wingler, A.; Marès, M.; Pourtau, N. Spatial patterns and metabolic regulation of photosynthetic parameters during leaf senescence. New Phytol.; 2004; 161, pp. 781-789. [DOI: https://dx.doi.org/10.1111/j.1469-8137.2004.00996.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33873714]
17. Pourtau, N.; Marès, M.; Purdy, S.; Quentin, N.; Ruël, A.; Wingler, A. Interactions of abscisic acid and sugar signalling in the regulation of leaf senescence. Planta; 2004; 219, pp. 765-772. [DOI: https://dx.doi.org/10.1007/s00425-004-1279-5]
18. Quirino, B.F.; Reiter, W.-D.; Amasino, R.D. One of two tandem Arabidopsis genes homologous to monosaccharide transporters is senescence-associated. Plant Mol. Biol.; 2001; 46, pp. 447-457. [DOI: https://dx.doi.org/10.1023/A:1010639015959]
19. Stessman, D.; Miller, A.; Spalding, M.; Rodermel, S. Regulation of photosynthesis during Arabidopsis leaf development in continuous light. Photosynth. Res.; 2002; 72, pp. 27-37. [DOI: https://dx.doi.org/10.1023/A:1016043003839]
20. Ueda, T.; Seo, S.; Ohashi, Y.; Hashimoto, J. Circadian and senescence-enhanced expression of a tobacco cysteine protease gene. Plant Mol. Biol.; 2000; 44, pp. 649-657. [DOI: https://dx.doi.org/10.1023/A:1026546004942]
21. Singh, S.; Singh, A.; Nandi, A.K. The rice OsSAG12-2 gene codes for a functional protease that negatively regulates stress-induced cell death. J. Biosci.; 2016; 41, pp. 445-453. [DOI: https://dx.doi.org/10.1007/s12038-016-9626-9]
22. Zhou, L.; Li, M.; Du, Q.; Yang, S.; Li, J.; Fan, Y.; Mao, K.; Zhang, J.; Xiao, H.; Wang, J. Genome-wide identification of PLCPs in pepper and the functional characterization of CaCP34 in resistance to salt- and osmotic-induced leaf senescence. Sci. Hortic.; 2023; 309, 111624. [DOI: https://dx.doi.org/10.1016/j.scienta.2022.111624]
23. Lian, X.Y.; Wang, X.; Gao, H.N.; Jiang, H.; Mao, K.; You, C.X.; Li, Y.Y.; Hao, Y.J. Genome wide analysis and functional identification of MdKCS genes in apple. Plant Physiol. Biochem.; 2020; 151, pp. 299-312. [DOI: https://dx.doi.org/10.1016/j.plaphy.2020.03.034]
24. Xiao, H.J.; Yin, Y.X.; Chai, W.G.; Gong, Z.H. Silencing of the CaCP gene delays salt- and osmotic-induced leaf senescence in Capsicum annuum L. Int. J. Mol. Sci.; 2014; 15, pp. 8316-8334. [DOI: https://dx.doi.org/10.3390/ijms15058316] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24823878]
25. Ma, X.; Li, Y.; Gai, W.X.; Li, C.; Gong, Z.H. The CaCIPK3 gene positively regulates drought tolerance in pepper. Hortic. Res.; 2021; 8, 216. [DOI: https://dx.doi.org/10.1038/s41438-021-00651-7]
26. Arkus, K.A.J.; Cahoon, E.; Jez, J. Mechanistic analysis of wheat chlorophyllase. FASEB J.; 2006; 20, A40. [DOI: https://dx.doi.org/10.1096/fasebj.20.4.A40-a]
27. Shoaf, A.R.; Steele, R.H. Microsomal (MuS)1 lipid peroxidation, drug oxidations and chemiluminescence (CL): Mechanisms. Biochem. Biophys. Res. Commun.; 1974; 61, pp. 1363-1371. [DOI: https://dx.doi.org/10.1016/S0006-291X(74)80434-1]
28. Wang, C.Q.; Chen, M.; Wang, B.S. Betacyanin accumulation in the leaves of C3 Halophyte Suaeda salsa L. is induced by watering roots with H2O2. Plant Sci.; 2007; 172, pp. 1-7. [DOI: https://dx.doi.org/10.1016/j.plantsci.2006.06.015]
29. Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem.; 1971; 44, pp. 276-287. [DOI: https://dx.doi.org/10.1016/0003-2697(71)90370-8]
30. Ranieri, A.; Petacco, F.; Castagna, A.; Soldatini, G.F. Redox state and peroxidase system in sunflower plants exposed to ozone. Plant Sci.; 2000; 159, pp. 159-167. [DOI: https://dx.doi.org/10.1016/S0168-9452(00)00352-6]
31. Wang, W.; Zhou, X.M.; Xiong, H.X.; Mao, W.Y.; Zhao, P.; Sun, M. xiang Papain-like and legumain-like proteases in rice: Genome-wide identification, comprehensive gene feature characterization and expression analysis. BMC Plant Biol.; 2018; 18, 87. [DOI: https://dx.doi.org/10.1186/s12870-018-1298-1]
32. Ilyas, M.; Hörger, A.C.; Bozkurt, T.O.; Van Den Burg, H.A.; Kaschani, F.; Kaiser, M.; Belhaj, K.; Smoker, M.; Joosten, M.H.A.J.; Kamoun, S. et al. Functional divergence of two secreted immune proteases of tomato. Curr. Biol.; 2015; 25, pp. 2300-2306. [DOI: https://dx.doi.org/10.1016/j.cub.2015.07.030] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26299516]
33. Mosher, R.A.; Durrant, W.E.; Wang, D.; Song, J.; Dong, X. A Comprehensive structure-function analysis of Arabidopsis SNI1 defines essential regions and transcriptional repressor activity. Plant Cell; 2006; 18, pp. 1750-1765. [DOI: https://dx.doi.org/10.1105/tpc.105.039677] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16766691]
34. Ghorbel, M.; Brini, F.; Sharma, A.; Landi, M. Role of jasmonic acid in plants: The molecular point of view. Plant Cell Rep.; 2021; 40, pp. 1471-1494. [DOI: https://dx.doi.org/10.1007/s00299-021-02687-4] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33821356]
35. Zhong, Q.; Hu, H.; Fan, B.; Zhu, C.; Chen, Z. Biosynthesis and roles of salicylic acid in balancing stress response and growth in plants. Int. J. Mol. Sci.; 2021; 22, 11672. [DOI: https://dx.doi.org/10.3390/ijms222111672]
36. Zang, Q.W.; Wang, C.X.; Li, X.Y.; Guo, Z.A.; Jing, R.L.; Zhao, J.; Chang, X.P. Isolation and characterization of a gene encoding a polyethylene glycol-induced cysteine protease in common wheat. J. Biosci.; 2010; 35, pp. 379-388. [DOI: https://dx.doi.org/10.1007/s12038-010-0043-1]
37. Niño, M.C.; Kim, M.S.; Kang, K.K.; Cho, Y.G. Genome-wide identification and molecular characterization of cysteine protease genes in rice. Plant Biotechnol. Rep.; 2020; 14, pp. 69-87. [DOI: https://dx.doi.org/10.1007/s11816-019-00583-8]
38. Gomez-Sanchez, A.; Gonzalez-Melendi, P.; Santamaria, M.E.; Arbona, V.; Lopez-Gonzalvez, A.; Garcia, A.; Hensel, G.; Kumlehn, J.; Martinez, M.; Diaz, I. Repression of drought-induced cysteine-protease genes alters barley leaf structure and responses to abiotic and biotic stresses. J. Exp. Bot.; 2019; 70, pp. 2143-2155. [DOI: https://dx.doi.org/10.1093/jxb/ery410]
39. Hyeong, C.P.; Man, L.K.; Yun, H.K.; Joo, M.J.; Jae, H.Y.; Min, C.K.; Chan, Y.P.; Jae, C.J.; Byeong, C.M.; Ju, H.L. et al. Pathogen- and NaCl-induced expression of the SCaM-4 promoter is mediated in part by a GT-1 box that interacts with a GT-1-like transcription factor. Plant Physiol.; 2004; 135, pp. 2150-2161. [DOI: https://dx.doi.org/10.1104/pp.104.041442]
40. Hartmann, U.; Sagasser, M.; Mehrtens, F.; Stracke, R.; Weisshaar, B. Differential combinatorial interactions of cis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes. Plant Mol. Biol.; 2005; 57, pp. 155-171. [DOI: https://dx.doi.org/10.1007/s11103-004-6910-0]
41. Danquah, A.; de Zelicourt, A.; Colcombet, J.; Hirt, H. The role of ABA and MAPK signaling pathways in plant abiotic stress responses. Biotechnol. Adv.; 2014; 32, pp. 40-52. [DOI: https://dx.doi.org/10.1016/j.biotechadv.2013.09.006]
42. Cao, Y.-R.; Chen, S.-Y.; Zhang, J.-S. Ethylene signaling regulates salt stress response. Plant Signal. Behav.; 2008; 3, pp. 761-763. [DOI: https://dx.doi.org/10.4161/psb.3.10.5934] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19513226]
43. Husain, T.; Fatima, A.; Suhel, M.; Singh, S.; Sharma, A.; Prasad, S.M.; Singh, V.P. A brief appraisal of ethylene signaling under abiotic stress in plants. Plant Signal. Behav.; 2020; 15, 1782051. [DOI: https://dx.doi.org/10.1080/15592324.2020.1782051] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32692940]
44. Gai, W.X.; Ma, X.; Qiao, Y.M.; Shi, B.H.; ul Haq, S.; Li, Q.H.; Wei, A.M.; Liu, K.K.; Gong, Z.H. Characterization of the bZIP transcription factor family in pepper (Capsicum annuum L.): CabZIP25 positively modulates the salt tolerance. Front. Plant Sci.; 2020; 11, 139. [DOI: https://dx.doi.org/10.3389/fpls.2020.00139] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32174937]
45. Han, J.; Li, H.; Yin, B.; Zhang, Y.; Liu, Y.; Cheng, Z.; Liu, D.; Lu, H. The papain-like cysteine protease CEP1 is involved in programmed cell death and secondary wall thickening during xylem development in Arabidopsis. J. Exp. Bot.; 2019; 70, pp. 205-215. [DOI: https://dx.doi.org/10.1093/jxb/ery356]
46. Zhang, D.; Liu, D.; Lv, X.; Wang, Y.; Xun, Z.; Liu, Z.; Li, F.; Lu, H. The cysteine protease CEP1, a key executor involved in tapetal programmed cell death, regulates pollen development in Arabidopsis. Plant Cell; 2014; 26, pp. 2939-2961. [DOI: https://dx.doi.org/10.1105/tpc.114.127282]
47. Alomrani, S.; Kunert, K.J.; Foyer, C.H. Papain-like cysteine proteases are required for the regulation of photosynthetic gene expression and acclimation to high light stress. J. Exp. Bot.; 2021; 72, pp. 3441-3454. [DOI: https://dx.doi.org/10.1093/jxb/erab101]
48. Khanna-Chopra, R. Leaf senescence and abiotic stresses share reactive oxygen species-mediated chloroplast degradation. Protoplasma; 2012; 249, pp. 469-481. [DOI: https://dx.doi.org/10.1007/s00709-011-0308-z]
49. Knaus, U.G. Oxidants in physiological processes. Handb. Exp. Pharmacol.; 2021; 264, pp. 27-47. [DOI: https://dx.doi.org/10.1007/164_2020_380] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32767144]
50. Li, J.; Xie, J.; Yu, J.; Lyv, J.; Zhang, J.; Ding, D.; Li, N.; Zhang, J.; Bakpa, E.P.; Yang, Y. et al. Melatonin enhanced low-temperature combined with low-light tolerance of pepper (Capsicum annuum L.) seedlings by regulating root growth, antioxidant defense system, and osmotic adjustment. Front. Plant Sci.; 2022; 13, 998293. [DOI: https://dx.doi.org/10.3389/fpls.2022.998293]
51. Wang, D.; Lu, X.; Chen, X.; Wang, S.; Wang, J.; Guo, L.; Yin, Z.; Chen, Q.; Ye, W. Temporal salt stress-induced transcriptome alterations and regulatory mechanisms revealed by pacBio long-reads RNA sequencing in Gossypium hirsutum. BMC Genom.; 2020; 21, 838. [DOI: https://dx.doi.org/10.1186/s12864-020-07260-z]
52. Wang, C.; Lu, G.; Hao, Y.; Guo, H.; Guo, Y.; Zhao, J.; Cheng, H. ABP9, a maize bZIP transcription factor, enhances tolerance to salt and drought in transgenic cotton. Planta; 2017; 246, pp. 453-469. [DOI: https://dx.doi.org/10.1007/s00425-017-2704-x]
53. Hasegawa, P.M.; Bressan, R.A.; Zhu, J.-K.; Bohnert, H.J. Plant cellular and molecular responses to high salinity. Annu. Rev. Plant Physiol. Plant Mol. Biol.; 2000; 51, pp. 463-499. [DOI: https://dx.doi.org/10.1146/annurev.arplant.51.1.463]
54. Huda, K.M.K.; Banu, M.S.A.; Garg, B.; Tula, S.; Tuteja, R.; Tuteja, N. OsACA6, a p-type IIB Ca2+ATPase promotes salinity and drought stress tolerance in tobacco by ROS scavenging and enhancing the expression of stress-responsive genes. Plant J.; 2013; 76, pp. 997-1015. [DOI: https://dx.doi.org/10.1111/tpj.12352] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24128296]
55. Liu, J.; Zhu, J.K. Proline accumulation and salt-stress-induced gene expression in a salt-hypersensitive mutant of Arabidopsis. Plant Physiol.; 1997; 114, pp. 591-596. [DOI: https://dx.doi.org/10.1104/pp.114.2.591] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/9193091]
56. Feng, J.; Li, J.; Gao, Z.; Lu, Y.; Yu, J.; Zheng, Q.; Yan, S.; Zhang, W.; He, H.; Ma, L. et al. SKIP confers osmotic tolerance during salt stress by controlling alternative gene splicing in Arabidopsis. Mol. Plant; 2015; 8, pp. 1038-1052. [DOI: https://dx.doi.org/10.1016/j.molp.2015.01.011] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25617718]
57. Ben Saad, R.; Ben Halima, N.; Ghorbel, M.; Zouari, N.; Ben Romdhane, W.; Guiderdoni, E.; Al-Doss, A.; Hassairi, A. AlSRG1, a novel gene encoding an RRM-type RNA-binding protein (RBP) from Aeluropus Littoralis, confers salt and drought tolerance in transgenic tobacco. Environ. Exp. Bot.; 2018; 150, pp. 25-36. [DOI: https://dx.doi.org/10.1016/j.envexpbot.2018.03.002]
58. Kong, X.; Sun, L.; Zhou, Y.; Zhang, M.; Liu, Y.; Pan, J.; Li, D. ZmMKK4 regulates osmotic stress through reactive oxygen species scavenging in transgenic tobacco. Plant Cell Rep.; 2011; 30, pp. 2097-2104. [DOI: https://dx.doi.org/10.1007/s00299-011-1116-9]
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.