1. Introduction
The use of antibiotics in humans and animals represents the cornerstone of modern medicine. Since their discovery, antibiotics have revolutionized the treatment of bacterial infections around the world. However, bacteria have evolved mechanisms to become resistant to these agents, and a steady increase in this phenomenon has made antimicrobial resistance one of the major health problems affecting humankind.
In the case of Gram-negative bacteria, infections caused by multi-drug-resistant Enterobacterales, Pseudomonas aeruginosa, and Acinetobacter sp. are on the rise [1]. This reality has led to the use of old antibiotics, such as colistin, as a last-resort antimicrobial against these pathogens. Colistin, a polypeptide antibiotic also known as polymyxin E, was discovered in 1949 and was largely used in the 1950s; however, due to its neuro- and nephro-toxicity, it was abandoned in the 1980s in favor of other antibiotics [2]. Colistin exerts its antibacterial activity against Gram-negative organisms by electrostatically binding the negatively charged phosphate groups of lipid A in the bacterial lipopolysaccharide (LPS), disrupting the integrity of the bacterial membrane [3].
Currently, antibiotic resistance against colistin is not as worrisome as that against other antimicrobials; however, due to the overuse and misuse of this antibiotic among humans and animals, colistin resistance is on the rise, as described in several reports from different nations [4,5,6]. Resistance against this agent in Enterobacterales, P. aeruginosa, and Acinetobacter sp. was originally described as being chromosomally encoded. This resistance mechanism was identified to be due to the modification of the LPS, through cationic substitutions by the addition of phosphoethanolamine (PEtN) or 4-amino-4-deoxy-L-arabhinose (L-Ara4N), molecules that reduce the net negative charge of the LPS, which impedes the binding of the antibiotic [7]. Specific mutations in any of the chromosomal genes of the two bacterial sensory two-component systems, PhoPQ or PmrAB, or in its negatively regulating gene, mgrB, induces the synthesis of the LPS-modifying moieties [7]. However, in 2015, Liu et al. described an additional colistin-resistance mechanism, the first plasmid-mediated resistant gene against this antibiotic, mcr-1, in E. coli [8]. Shortly after its discovery, mcr-1 was identified in over 20 different countries, and, to date, nine additional mcr-like genes have been described [9]. Furthermore, mcr genes have also been identified in Pseudomonas aeruginosa and Acinetobacter sp. [10,11]. These plasmid-mediated genes confer bacteria the ability to produce an enzyme, phosphoethanolamine transferase, that catalyzes the addition of substrates that bind the LPS and inhibit the binding of colistin [8].
With the global spread of mcr genes among multi-drug-resistant bacterial strains and their further horizontal transmission among bacteria, the effectiveness of colistin is in serious jeopardy. An additional factor that might facilitate the spread of colistin resistance is the likelihood of acquiring this plasmid-mediated resistant trait in multi-drug-resistant E. coli clones such as O25b-ST131, the most common multi-drug-resistant high-risk clone associated with extra-intestinal E. coli infections around the world [12]. This clone commonly carries resistance genes to antibiotics frequently prescribed in general practice, such as cephalosporins, which are mainly mediated by the blaCTX-M gene, as well as quinolones, and can easily be transmitted through the consumption of food [13]. These antibiotics can co-select for colistin-resistant strains and, thus, contribute to the spread of resistance against this agent. ST131 E. coli clones carrying colistin resistance genes have already been reported in environmental and clinical samples [14,15].
As the surveillance of antibiotic resistance and research is a key component of the global action plan against antimicrobial resistance [16], the purpose of the current study was to determine the prevalence of the plasmid-mediated colistin resistance genes mcr-1 to mcr-5 among colistin and multi-drug-resistant Enterobacterales, Pseudomonas aeruginosa and Acinetobacter sp. strains isolated from patients in a tertiary hospital in the city of Toluca, Mexico. Additionally, we sought to assess whether the plasmid-mediated colistin-resistant E. coli strains isolated from these patients belonged to the ST131 clone and co-expressed blaCTX-M genes.
2. Materials and Methods
This was a prospective study conducted between May and October 2022 in coordination with the Microbiology laboratory from Centro Médico ISSEMYM, Toluca, Mexico. Strains included in this research were isolated from cultures obtained by the clinical laboratory of the hospital as part of routine care for hospitalized patients, as instructed by their physician. No additional specimens were obtained for the purposes of this study and no personal information was obtained from patients; therefore, informed consent was not required.
2.1. Bacterial Strains, Culture, Identification, and Microbial Susceptibility Testing
Biological samples were plated on blood agar and MacConkey agars and cultured at 35 ± 2 °C for 18 h. Strains growing on the latter medium were identified using the VITEK Compact System (bioMerieux, Marcy l’E’toile, France), following the manufacturer’s instructions. Only strains that were unequivocally identified by the Vitek system to belong to the order Enterobacterales or the genus Pseudomonas aeruginosa or Acinetobacter spp. were included in the study (identification probability > 90%).
The minimum inhibitory concentrations (MIC) of different antibiotics against the strains included in the study were determined using the VITEK Compact System (bioMerieux, Marcy l’E’toile, France) and compared to the Clinical and Laboratory Standard Institute (CLSI) guidelines [17]. Only strains that fulfilled the multi-drug-resistance (MDR), extensively drug-resistant (XDR), or pan-drug-resistant criteria (PDR) established by Magiorakos et al. [18] were included for further testing. MDR, XDR, and PDR strains were initially tested for colistin resistance by the colistin broth disk elution test described by Simner et al. [19]. The MIC of the strains determined to be resistant by this method (≥4 µg/mL) were further measured in duplicate using the micro broth dilution method according to CLSI guidelines [17] and only those confirmed to be colistin-resistant (MIC ≥ 4 µg/mL) were included in the study.
2.2. PCR Amplification
DNA was extracted using the boil lysis method, and extracted DNA was tested via PCR for mcr-1 to mcr-5 genes using the primers described in Table 1. Amplified PCR products were sequenced in both directions and nucleotide sequences were compared against the National Center for Biotechnology Information BLAST database [20]. In the case of colistin-resistant E. coli strains carrying mcr genes, the presence of the O25b-ST131 clone and blaCTX-M genes was determined using previously described PCR primers (Table 1).
2.3. Conjugation Experiments
Conjugation experiments were carried out using E. coli J53, a sodium azide-resistant strain, as the recipient organism, following the broth-mating method. Briefly, donor and recipient strains were cultured on Luria–Bertani (LB) broth with shaking at 125 rpm at 37 °C to logarithmic phase (OD600 = 0.5). Conjugation was performed by mixing donor and recipient strains in a 1:1 ratio in 4 mL of LB broth and incubated overnight at 37 °C without shaking. Transconjugants were selected on Mueller Hinton agar plates containing 100 mg/mL sodium azide and 4 µg/mL of colistin. The presence of mcr genes in transconjugants was assessed via antimicrobial susceptibility testing using the micro broth dilution method, as suggested by CLSI [17], as well as PCR and sequencing. The transmission of the blaCTX-M gene to transconjugants was confirmed by PCR, and its ESBL phenotype, by the CLSI confirmatory method [17].
2.4. S1-Pulsed-Field Gel Electrophoresis (PFGE) and Southern Blot Analysis
To determine the location of transmissible elements, genomic DNA of both mcr-1-carrying E. coli transconjugant strains was digested with S1 nuclease (Thermo Fisher Scientific, Waltham, MA, USA) and electrophoresed on a CHEF-mapper XA pulsed-field gel electrophoresis system (Bio-Rad Laboratories Inc., Hercules, CA, USA) for 22 h at 14 °C with run conditions of 6 V/cm and pulse times from 2.16 s to 63.8 s. The DNA fragments were transferred to a positively charged nylon membrane (EMD Millipore, Burlington, MA, USA) and then hybridized with an approximately 600 bp digoxigenin-labeled mcr-1 probe, according to the manufacturer’s instructions (Roche, Mannheim, Germany). The fragments were then detected using an NBT/BCIP color detection kit (Hoffman-La Roche Ltd., Basel, Switzerland). The Salmonella enterica serotype Braenderup H9812 was used as the size marker.
For all experiments, a previously identified E.coli strain isolated from a swine farm, resistant to the colistin-carrying mcr-1 gene, was included as a positive control [25].
3. Results
3.1. Colistin Resistance
In total, 241 isolates of MDR, XDR, and PDR strains of Enterobacterales, P. aeruginosa, and Acinetobacter sp. were collected at the clinical laboratory from Centro Médico ISSEMYM Toluca and included in this study. The number of isolates per bacterial species identified is shown in Figure 1.
Among the 241 multi-drug-resistant strains included in the study, 12 (5.0%) were found by the micro-broth dilution method to be resistant against colistin (MIC ≥ 4 µg/mL) and included E. coli (n = 4), P. aeruginosa (n = 4), K. pneumoniae (n = 3), and E. cloacae (n = 1). The colistin MIC of these 12 strains and their isolation sites are shown in Table 2.
The antibiotic resistance profiles of the 12 strains found to be resistant to colistin against commonly used antibiotics and their respective classification as MDR, XDR, or PDR are depicted in Table 3.
3.2. mcr Prevalence
Of all 12 strains resistant to colistin, the multiplex PCR protocol amplified one fragment of approximately 320 bp in two E. coli isolates (2207 and 5891) and in the control strain, suggesting the presence of the mcr-1 gene (Figure 2). Sequencing in both directions of these amplicons confirmed that both strains carry this gene. PCR targeting was negative on all strains for the mcr-2 to -5 genes. Both mcr-1-carrying E.coli strains were shown to be ESBL producers carrying the blaCTX-M gene and belonging to the O25b-ST131 clone.
3.3. Conjugation Experiments
Conjugation experiments were conducted on strains 2207 and 5891, with both isolates transmitting their colistin resistance trait to the recipient J53 E. coli strain, suggesting that mcr-1 was located on transferable plasmids. Both transconjugants were shown to be PCR-positive for the mcr-1 gene (Figure 2) and sequencing in both directions of these transconjugant amplicons confirmed the horizontal transmission of mcr-1. The two parental strains also transmitted their blaCTX-M gene, and the recipient strains were confirmed to be ESBL producers by the CLSI confirmatory test [17] as well as de novo resistant to colistin, as assessed by the micro-broth dilution method (≥4 µg/mL). The strain 2207 transconjugant presented an identical colistin MIC to that of the parental strain, while the 5891 transconjugant presented a one to two-fold higher MIC.
3.4. Southern Blot Analysis
DNA digestion with S1 nuclease and Southern blot analysis were performed for both transconjugants. The results of these analyses indicated that the mcr-1 genes isolated from the two transconjugants were located on a plasmid of approximately 60 kb (Figure 3).
4. Discussion
Due to the increasing rates of resistance among Gram-negative bacilli against commonly used antibiotics, mainly in bacterial strains isolated from hospitalized patients, colistin has emerged as one of the last-resort antimicrobials in the treatment of these infections. Unfortunately, resistance against this agent is on the rise, particularly in Asia, which is mainly attributed to its overuse in veterinary medicine [26].
One of the main objectives of the current study was to determine the prevalence of colistin resistance among multi-drug-resistant Enterobacterales, P. aeruginosa, and Acinetobacter sp. strains isolated from patients in a tertiary hospital in Mexico. In total, 241 strains were included in the study, of which 12 (5.0%) were found to be resistant to colistin according to the CLSI guidelines. Of the 12 colistin-resistant strains, 4 were P. aeruginosa, with a colistin-resistance prevalence of 7.5%, (4/53); 4 were E. coli, with a prevalence of 2.5% (4/162); 3 were K. pneumoniae, with a prevalence of 15.0% (3/20), and 1 was E. cloacae, with a prevalence of 50.0% (1/2). Although K. pneumoniae presented one of the highest prevalence levels of colistin resistance, no PDR strains were found, unlike P. aeruginosa, for which one strain was found to be resistant to all tested antibiotics. In this study, no Acinetobacter sp. isolates were found to be colistin-resistant.
The antibiotic resistance profiles of the colistin-resistant strains found in this study are shown in Table 3. As all 241 strains included in the current study were multi-drug-resistant isolates, the antibiotic resistance among them was high. In the case of P. aeruginosa, colistin-resistant strains presented an extremely high prevalence of resistance against carbapenems (100%), ceftazidime (100%), ciprofloxacin (100%), and amikacin (100%) and low resistance to tigecycline (25%). For Enterobacterales, higher rates of resistance were found against ciprofloxacin (100.0%), trimethoprim/sulfamethoxazole (87.5%), cephalosporines (62.5%), and ceftazidime (62.0%); no resistance was found against amikacin. Finally, resistance against at least one of the carbapenems was found in one E. coli (1/4) and one K. pneumoniae (1/3) strain.
The prevalence of colistin resistance in this study is in agreement with reports in different geographical areas of the world among muti-drug-resistant strains isolated from hospitalized patients [10,27,28], but higher than the 1.26% worldwide prevalence reported by Dadashi et al. [29]. In Mexico, reports on the prevalence of colistin-resistant strains are scarce; however, in a recent report by the Red Temática de Investigación y Vigilancia de la Farmacorresistencia (INVIFAR network), that included clinical strains isolated from different parts of the country, the colistin resistance prevalence among K. pneumoniae strains was 17.8% [30], a rate similar to that found in the current study among isolates of this bacterial species (3/20 = 15.0%). Unlike the INVIFAR report, where no resistance to colistin was found among E. coli strains, we found that 2.5% of the E. coli strains included in the current study presented this resistance trait. These results confirm that colistin resistance among clinical isolates in our country is already a reality and should be carefully monitored.
As the world has been witnessing an increase in resistance against colistin, this phenomenon has been mainly attributed to the emergence and dissemination of plasmid-mediated (mcr-1 to mcr-10) genes among bacteria. The first mcr gene (mcr-1) was originally described in 2015 in China [8], and in Mexico, mcr-1 was first identified in 2019 in an E. coli strain isolated from a fecal sample from a child [31]. The presence of this plasmid-mediated gene in our country was recently confirmed in K. pneumoniae strains isolated from different clinical samples [30]. In the present study, only two E. coli strains, both isolated from female patients with urinary tract infections that required hospitalization, were found to carry the mcr-1 gene and both strains were able to efficiently transfer this colistin-resistant determinant to recipient strains by means of an approximately 60 kb plasmid, as demonstrated by Southern blot analysis. No other mcr gene was found in the strains analyzed and no other bacterial species in addition to E. coli were found to carry mcr-mediated colistin resistance genes. In this study, mcr genes were not found in P. aeruginosa. However, as colistin is the last-resort antibiotic against strains of this organism resistant to carbapenems, reports of mcr genes among multi-drug-resistant strains of this species have started to emerge [32,33], and the horizontal transmission of mcr-1 genes has been shown to occur from P. aeruginosa to other bacterial species [34], the surveillance of mcr-carrying P. aeruginosa strains remains highly encouraged.
The low prevalence of mcr genes found in this investigation among colistin-resistant strains (2/12) suggests that in our population, resistance to this agent might be mainly driven, as suggested by Gogry et al. [26], by chromosomal mutations, such as those in the genes regulating the two-component systems, PhoPQ or PmrAB, or in its negatively regulating gene, mgrB, by mcr genes different from the mcr-1 to mcr-5 genes included in this investigation or by unknown colistin resistance mechanisms. The results of the current investigation are in agreement with those found in a recent report by Garza-Ramos et al. who found that the more prevalent colistin-resistant mechanism in Mexico is not driven by mcr genes but by mgrB mutations [30]. Moreover, the low prevalence of mcr genes in our population might be partially explained by the fact that colistin-resistance in Enterobacterales has been linked mainly to mgrB mutations [35], rather than to plasmid-mediated genes. In the case of P. aeruginosa, the main drivers of colistin resistance have also been shown to be mainly due to chromosome mutations leading to the overexpression of efflux pumps or defective biofilm formation [36].
The relatively low prevalence of mcr genes among colistin-resistant Gram-negative bacteria found in this study (16.7%) is higher than the values reported for E.coli in Egypt (7.5%) [37] and similar to those described in Ecuador (20.0%) [38] but lower than the prevalence shown in a study in Nepal [39] and Peru [40] where the prevalence of strains that serve as carriers of mcr genes were reported to be high among colistin-resistant E. coli and K. pneumoniae. The results of the current research confirm the fact that the horizontal transmission of colistin resistance has spread at different rates among different geographical areas of the world. It is also important to note that in this study, mcr genes were searched for in colistin-resistant strains and only multi-drug-resistant isolates were included, but different studies have shown that colistin-susceptible Enterobacterales can carry mcr genes [41,42]. Thus, the prevalence of mcr-carrying strains at the Microbiology laboratory from Centro Médico ISSEMYM, Toluca, Mexico, could be higher than the levels indicated by the results in this study. Further research is needed to understand the epidemiology of the additional mechanisms of colistin resistance to those identified in the current study.
Several reports have shown that Gram-negative bacilli can co-harbor mcr genes and other plasmid-mediated antibiotic resistance traits such as those encoding for carbapenemase and ESBL production. Since colistin is mainly indicated as a last-resort antibiotic, the co-expression of colistin and carbapenemase resistance is worrisome among the medical community and, understandably, has been more thoroughly studied and more commonly demonstrated among Enterobacterales [30,43] than its co-expression with extended-spectrum-β-lactamases. However, bacterial strains co-harboring mcr and ESBL genes should also be carefully monitored. In addition, to encode for intrinsic resistance against cephalosporines, penicillins, and monobactams, plasmids carrying ESBL-encoding genes can also harbor resistance genes against other commonly used antibiotics such as ciprofloxacin, trimethoprim/sulfamethoxazole, and aminoglycosides [44]. When administered, any of these antibiotics could co-select for colistin-resistant strains and contribute to the spread of resistance against this antimicrobial. In the present study, the two mcr-1-carrying E.coli strains were additionally found to carry blaCTX-M genes, a phenomenon that has also been demonstrated in human isolates in Qatar [45], Peru [46], and the Indian Ocean Commission [47], showing that the co-expression of plasmid-mediated resistance against colistin and ESBL production has spread to different regions of the world.
In the current study, both mcr-1- and CTXM-carrying E. coli strains were able to horizontally transmit their colistin resistance and ESBL production to the recipient strain, suggesting that conjugation may play a role in the spread of colistin resistance. In this study, only a minority of colistin-resistant isolates were found to carry mcr genes and in the two mcr-1-carrying strains, no carbapenem resistance was detected, leaving other therapeutic options available for the treatment of infections caused by these strains. However, as different studies have shown that the horizontal transmission of mcr-1 genes occurs in food [48] and animals [49], this mechanism might be responsible for the steady increase in colistin resistance among Gram-negative bacilli around the globe.
The highly antibiotic-resistant clone ST131, predominantly serogroup O25b, is considered the dominant extra-intestinal pathogenic E. coli around the world, as well as a frequent cause of urinary tract infections [12,13]. In the current study, the two E. coli strains carrying the mcr-1 and blaCTX-M genes were isolated from patients with urinary tract infections and were resistant to most classes of antibiotics, demonstrating sensitivity only to the carbapenems and, in the case of one strain (2207), to cefepime. In addition, these two strains were found to belong to the ST131-O25b clone, an E. coli clone that commonly exhibits resistance to quinolones, trimethoprim/sulfamethoxazole, and aminoglycosides, and is recognized as the primary lineage responsible for the spread of blaCTX-M genes [50]. The results of this study support previous findings on strains isolated from humans [15,51], showing that the already highly resistant clone ST131 can acquire plasmid-mediated colistin resistance genes. As this clone can be transmitted from person to person and through the consumption of contaminated food [13], and given that its prevalence in the feces of healthy humans is on the rise [52], the spread of this multi-drug-resistant clone could be facilitated by a lack of hygiene, which suggests that less privileged areas of the world might see an increase in the prevalence of this clone. If mcr-1-carrying O25b-ST131 E. coli clones expand to different geographical areas, commonly used antibiotics, such as ciprofloxacin, cephalosporines, and trimethoprim/sulfamethoxazole, could co-select for colistin-resistant strains and contribute to the spread of resistance against this last-resort antibiotic.
Limitations of the current study include its small sample size, unicentric design, and short timeframe. In addition, as colistin resistance can be mediated by chromosomal mutations, or by plasmid-mediated mcr genes different from those included in the current study, it cannot be concluded that the colistin resistance found in the two E. coli strains reported herein might be mediated by the mcr-1 genes alone or that such resistance is a combination of additional resistance mechanisms. Lastly, not all known mcr variants were analyzed, thus, the actual plasmid-mediated colistin resistance prevalence at our institution might be higher than the levels suggested by these results.
In order to further understand the epidemiology, dissemination, and evolution of colistin resistance in our country, larger, multicentric studies must be performed. In addition, as mcr-mediated resistance against this agent is on the rise, these studies must include further analysis of the plasmid types involved in the horizontal transmission of mcr genes, as well as identify whether other mobile genetic elements, such as transposons or integrons, are involved in the spread of this worrisome antibiotic resistant trait. This information can help the medical and scientific community and policymakers to understand how these antibiotic-resistant traits move among bacteria and whether interventions can be applied to stop their spread.
In conclusion, this study, albeit small, demonstrated that the emergence and spread of mcr-carrying strains among humans is a reality in Mexico. In addition, the presence of this resistant trait among highly resistant and easily transmissible O25b-ST131 E. coli clones further complicates the antibiotic resistance scenario in our country. Further surveillance studies are needed in other hospitals and among other ambulatory patients in Mexico to determine the magnitude of the problem of colistin resistance, especially that mediated by mcr genes, in order to establish policies aimed at optimizing antibiotic stewardship programs to reduce the dissemination of resistance against this last-resort antibiotic.
Conceptualization, M.G.-M.; Formal analysis, H.N.-S., D.Q.-d.l.P., R.P.-V., I.B.-J. and L.G.-M.; Investigation, M.G.-M., H.N.-S., D.Q.-d.l.P., I.B.-J. and J.D.S.-L.; Project administration, H.N.-S.; Resources, M.G.-M., R.P.-V. and L.G.-M.; Validation, R.P.-V. and J.D.S.-L.; Writing—original draft, M.G.-M.; Writing—review and editing, D.Q.-d.l.P., I.B.-J. and J.D.S.-L. All authors have read and agreed to the published version of the manuscript.
Not applicable.
The authors thank Jesús Silva for providing the J53 E. coli strain for the conjugation experiments and Todd Michael Pitts for reviewing this manuscript.
The authors declare no conflict of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Figure 2. PCR amplification results for the mcr-1 gene. Lane 1: molecular marker; lane 2: mcr-1 positive control; lane 3: mcr-1 negative control; lane 4: E. coli strain 5891; lane 5: E. coli conjugate strain 5891; lane 6: E. coli strain 2207; and lane 7: E. coli conjugate strain 2207.
Figure 3. Southern blot analysis with a probe for mcr-1. (A) S1-nuclease-PFGE of E.coli transconjugants. (B) Southern blot hybridization with mcr-1 probe. Lane 1: marker; lane 2: E. coli J53 strain; lane 3: E. coli strain 2207 transconjugant; and lane 4: E. coli strain 5891 transconjugant.
Primers and PCR conditions used to determine the presence of mcr and blaCTX-M genes and O25b-ST131 clones.
| Amplified Gene | Primers Sequence (5′–3′) | Reference |
|---|---|---|
| mcr-1-fw | AGTCCGTTTGTTCTTGTGGC | [ |
| mcr-1-rv | AGATCCTTGGTCTCGGCTTG | |
| mcr-2-fw | CAAGTGTGTTGGTCGCAGTT | [ |
| mcr-2-rv | TCTAGCCCGACAAGCATACC | |
| mcr-3-fw | AAATAAAAATTGTTCCGCTTATG | [ |
| mcr-3-rv | AATGGAGATCCCCGTTTTT | |
| mcr-4-fw | TCACTTTCATCACTGCGTTG | [ |
| mcr-4-rv | TTGGTCCATGACTACCAATG | |
| mcr-5-fw | ATGCGGTTGTCTGCATTTATC | [ |
| mcr-5-rv | TCATTGTGGTTGTCCTTTTCTG | |
| pabB-fw | TCCAGCAGGTGCTGGATCGT | [ |
| pabB-rv | GCGAAATTTTTCGCCGTACTGT | |
| blaCTX-M-fw | TTTGCGATGTGCAGTACCAGTA | [ |
| blaCTX-M-rv | CGATATCGTTGGTGGTGCCATA |
Colistin MIC of strains identified as resistant and their isolation sites.
| Strain | Micoorganism | Colistin MIC (µg/mL) | Isolation Site |
|---|---|---|---|
| 744 | P. aeruginosa | 8 | Blood |
| 1308 | K. pneumoniae | 16 | Respiratory secretions |
| 2207 | E. coli | 4 | Respiratory secretions |
| 2230 | E. coli | 4 | Urine |
| 2445 | E. coli | 8 | Renal abscess |
| 2892 | P. aeruginosa | 16 | Respiratory secretions |
| 3148 | P. aeruginosa | 8 | Urine |
| 3172 | K. pneumoniae | 4 | Blood |
| 3196 | P. aeruginosa | 4 | Urine |
| 3202 | K. pneumoniae | 4 | Respiratory secretions |
| 3271 | E. cloacae | 16 | Respiratory secretions |
| 5891 | E. coli | 4 | Urine |
Antibiotic resistance profile of colistin-resistant strains.
| Colistin Resistant Bacteria | Antibiotic | Antibiotic Resistance Prevalence | Acquired |
|---|---|---|---|
| P. aeruginosa |
Ceftazidime | 4/4 (100%) | MDR: 0 |
| Cefepime | 4/4 (100%) | XDR: 3 | |
| Amikacin | 4/4 (100%) | PDR: 1 | |
| Ciprofloxacin | 4/4 (100%) | ||
| Piperacillin/tazobactam | 2/4 (50.0%) | ||
| Imipenem | 4/4 (100%) | ||
| Ceftazidime | 4/4 (100%) | ||
| Meropenem | 4/4 (100%) | ||
| Gentamicin | 4/4 (100%) | ||
| Tigecycline | 1/4 (25%) | ||
| E. coli |
Ampicillin/sulbactam | 3/4 (75%) | MDR: 2 |
| Cefuroxime | 3/4 (75%) | XDR: 2 | |
| Cefotaxime | 3/4 (75%) | PDR: 0 | |
| Ceftazidime | 3/4 (75%) | ||
| Ceftriaxone | 3/4 (75%) | ||
| Cefepime | 2/4 (50%) | ||
| Ertapenem | 1/4 (25%) | ||
| Meropenem | 0/4 (0%) | ||
| Amikacin | 0/4 (0%) | ||
| Gentamicin | 2/4 (50%) | ||
| Ciprofloxacin | 4/4 (100%) | ||
| Trimethoprim/sulfamethoxazole | 4/4 (100%) | ||
| K. pneumoniae |
Ampicillin/sulbactam | 3/3 (100%) | MDR: 1 |
| Cefuroxime | 2/3 (66.7%) | XDR: 2 | |
| Cefotaxime | 2/3 (66.7%) | PDR: 0 | |
| Ceftazidime | 2/3 (66.7%) | ||
| Ceftriaxone | 2/3 (66.7%) | ||
| Cefepime | 2/3 (66.7%) | ||
| Ertapenem | 1/3 (33.3%) | ||
| Meropenem | 0/3 (0%) | ||
| Amikacin | 0/3 (0%) | ||
| Gentamicin | 2/3 (66.7%) | ||
| Ciprofloxacin | 3/3 (100%) | ||
| Trimethoprim/sulfamethoxazole | 3/3 (100%) | ||
| E. cloacae |
Cefuroxime | 1/1 (100%) | MDR: 1 |
| Cefotaxime | 0/1 (0%) | XDR: 0 | |
| Ceftazidime | 0/1 (0%) | PDR: 0 | |
| Ceftriaxone | 0/1 (0%) | ||
| Cefepime | 0/1 (0%) | ||
| Ertapenem | 0/1 (0%) | ||
| Meropenem | 0/1 (0%) | ||
| Amikacin | 0/1 (0%) | ||
| Gentamicin | 1/1 (100%) | ||
| Ciprofloxacin | 1/1 (100%) | ||
| Trimethoprim/sulfamethoxazole | 0/1 (100%) |
References
1. Nagvekar, V.; Sawant, S.; Amey, S. Prevalence of multidrug-resistant Gram-negative bacteria cases at admission in a multispeciality hospital. J. Glob. Antimicrob. Resist.; 2020; 22, pp. 457-461. [DOI: https://dx.doi.org/10.1016/j.jgar.2020.02.030]
2. Olaitan, A.O.; Morand, S.; Rolain, J.M. Mechanisms of polymyxin resistance: Acquired and intrinsic resistance in bacteria. Front. Microbiol.; 2014; 5, 643. [DOI: https://dx.doi.org/10.3389/fmicb.2014.00643] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25505462]
3. Andrade, F.F.; Silva, D.; Rodrigues, A.; Pina-Vaz, C. Colistin Update on Its Mechanism of Action and Resistance, Present and Future Challenges. Microorganisms; 2020; 8, 1716. [DOI: https://dx.doi.org/10.3390/microorganisms8111716] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33147701]
4. Monaco, M.; Giani, T.; Raffone, M.; Arena, F.; García-Fernández, A.; Pollini, S. Colistin resistance superimposed to endemic carbapenem-resistant Klebsiella pneumoniae: A rapidly evolving problem in Italy, November 2013 to April 2014. Euro. Surveill.; 2014; 19, 20939. [DOI: https://dx.doi.org/10.2807/1560-7917.ES2014.19.42.20939] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25358041]
5. Pena, I.; Picazo, J.J.; Rodríguez-Avial, C.; Rodríguez-Avial, I. Carbapenemase-producing Enterobacteriaceae in a tertiary hospital in Madrid, Spain: High percentage of colistin resistance among VIM-1-producing Klebsiella pneumoniae ST11 isolates. Int. J. Antimicrob. Agents; 2014; 43, pp. 460-464. [DOI: https://dx.doi.org/10.1016/j.ijantimicag.2014.01.021] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24657043]
6. Meletis, G.; Oustas, E.; Botziori, C.; Kakasi, E.; Koteli, A. Containment of carbapenem resistance rates of Klebsiella pneumoniae and Acinetobacter baumannii in a Greek hospital with a concomitant increase in colistin, gentamicin and tigecycline resistance. New Microbiol.; 2015; 38, pp. 417-421.
7. Binsker, U.; Käsbohrer, A.; Hammerl, J.A. Global colistin use: A review of the emergence of resistant Enterobacterales and the impact on their genetic basis. FEMS Microbiol. Rev.; 2022; 46, fuab049. [DOI: https://dx.doi.org/10.1093/femsre/fuab049]
8. Liu, Y.-Y.; Wang, Y.; Walsh, T.R.; Yi, L.-X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X. et al. Emergence of plasmid-mediated colistin resistance mechanism mcr-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis.; 2016; 16, pp. 161-168. [DOI: https://dx.doi.org/10.1016/S1473-3099(15)00424-7]
9. Baron, S.; Hadjadj, L.; Rolain, J.M.; Olaitan, A.O. Molecular mechanisms of polymyxin resistance: Knowns and unknowns. Int. J. Antimicrob. Agents.; 2016; 48, pp. 583-591. [DOI: https://dx.doi.org/10.1016/j.ijantimicag.2016.06.023]
10. Ejaz, H.; Younas, S.; Qamar, M.U.; Junaid, K.; Abdalla, A.E.; Abosalif, K.O.A.; Alameen, A.A.M.; Elamir, M.Y.M.; Ahmad, N.; Hamam, S.S.M. et al. Molecular Epidemiology of Extensively Drug-Resistant mcr Encoded Colistin-Resistant Bacterial Strains Co-Expressing Multifarious β-Lactamases. Antibiotics; 2021; 10, 467. [DOI: https://dx.doi.org/10.3390/antibiotics10040467]
11. Hameed, F.; Khan, M.A.; Muhammad, H.; Sarwar, T.; Bilal, H.; Rehman, T.U. Plasmid-mediated mcr-1 gene in Acinetobacter baumannii and Pseudomonas aeruginosa: First report from Pakistan. Rev. Soc. Bras. Med. Trop.; 2019; 52, e20190237. [DOI: https://dx.doi.org/10.1590/0037-8682-0237-2019] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31508785]
12. Peirano, G.; Pitout, J.D. Molecular epidemiology of Escherichia coli producing CTX-M beta-lactamases: The worldwide emergence of clone ST131 O25:H4. Int. J. Antimicrob. Agents.; 2010; 35, pp. 316-321. [DOI: https://dx.doi.org/10.1016/j.ijantimicag.2009.11.003]
13. Nicolas, M.H.; Bertrand, X.; Madec, J.Y. Escherichia coli ST131, an intriguing clonal group. Clin. Microbiol. Rev.; 2014; 27, pp. 543-574. [DOI: https://dx.doi.org/10.1128/CMR.00125-13] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24982321]
14. Lopes, R.; Furlan, J.P.R.; Dos Santos, L.D.R.; Gallo, I.F.L.; Stehling, E.G. Colistin-Resistant mcr-1-Positive Escherichia coli ST131-H22 Carrying blaCTX-M-15 and qnrB19 in Agricultural Soil. Front. Microbiol.; 2021; 12, 659900. [DOI: https://dx.doi.org/10.3389/fmicb.2021.659900]
15. De la Tabla, V.O.; Ortega, A.; Buñuel, F.; Pérez-Vázquez, M.; Marcos, B.; Oteo, J. Detection of the high-risk clone ST131 of Escherichia coli carrying the colistin resistance gene mcr-1 and causing acute peritonitis. Int. J. Antimicrob. Agents.; 2017; 49, pp. 115-116. [DOI: https://dx.doi.org/10.1016/j.ijantimicag.2016.10.003]
16. World Health Organization. Global Action Plan on Antimicrobial Resistance; WHO: Geneva, Switzerland, 2016; 45.
17. Clinical and Laboratory Standards Institute. M100 Performance Standards for Antimicrobial Susceptibility Testing; 33rd ed. CLSI: Wayne, PA, USA, 2023; 402.
18. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B. et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect.; 2012; 18, pp. 268-281. [DOI: https://dx.doi.org/10.1111/j.1469-0691.2011.03570.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21793988]
19. Simner, P.J.; Bergman, Y.; Trejo, M.; Roberts, A.A.; Marayan, R.; Tekle, T.; Campeau, S.; Kazmi, A.Q.; Bell, D.T.; Lewis, S. et al. Two-Site Evaluation of the Colistin Broth Disk Elution Test To Determine Colistin In Vitro Activity against Gram-Negative Bacilli. J. Clin Microbiol.; 2019; 57, e01163-18. [DOI: https://dx.doi.org/10.1128/JCM.01163-18]
20. BLAST Sequence Analysis Tool. National Center for Biotechnology Information. 2013; Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 17 February 2023).
21. Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A. et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance; 2018; 23, 17-00672. [DOI: https://dx.doi.org/10.2807/1560-7917.ES.2018.23.6.17-00672]
22. Borowiak, M.; Fischer, J.; Hammerl, A.J.; Hendriksen, R.S.; Szabo, I.; Malorny, B. Identification of a novel transposon-associated phosphoethanolamine transferase gene, mcr-5, conferring colistin resistance in d-tartrate fermenting Salmonella enterica subsp. enterica serovar Paratyphi, B. J. Antimicrob. Chemother.; 2017; 72, pp. 3317-3324. [DOI: https://dx.doi.org/10.1093/jac/dkx327]
23. Clermont, O.; Dhanji, H.; Upton, M.; Gibreel, T.; Fox, A.; Boyd, D.; Mulvey, M.R.; Nordmann, P.; Ruppé, E.; Sarthou, J.L. et al. Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15-producing strains. J. Antimicrob. Chemother.; 2009; 64, pp. 274-277. [DOI: https://dx.doi.org/10.1093/jac/dkp194]
24. Edelstein, M.; Pimkin, M.; Palagin, I.; Edelstein, I.; Stratchounski, L. Prevalence and molecular epidemiology of CTX-M extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in Russian hospitals. Antimicrob. Agents Chemother.; 2003; 47, pp. 3724-3732. [DOI: https://dx.doi.org/10.1128/AAC.47.12.3724-3732.2003] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/14638473]
25. Garza-Ramos, U.; Tamayo-Legorreta, E.; Arellano-Quintanilla, D.M.; Rodriguez-Medina, N.; Silva-Sanchez, J.; Catalan-Najera, J.; Rocha-Martínez, M.K.; Bravo-Díaz, M.A.; Alpuche-Aranda, C. Draft Genome Sequence of a Multidrug- and Colistin-Resistant mcr-1-Producing Escherichia coli Isolate from a Swine Farm in Mexico. Genome Announc.; 2018; 6, e00102-18. [DOI: https://dx.doi.org/10.1128/genomeA.00102-18] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29519827]
26. Gogry, F.A.; Siddiqui, M.T.; Sultan, I.; Haq, Q.M.R. Current Update on Intrinsic and Acquired Colistin Resistance Mechanisms in Bacteria. Front. Med.; 2021; 8, 677720. [DOI: https://dx.doi.org/10.3389/fmed.2021.677720] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34476235]
27. Zafer, M.M.; El-Mahallawy, H.A.; Abdulhak, A.; Amin, M.A.; Al-Agamy, M.H.; Radwan, H.H. Emergence of colistin resistance in multi-drug resistant Klebisella pneumoniae and Escherichia coli strains isolated from cancer patients. Ann. Clin. Microbiol. Antimicrobiano.; 2019; 18, 40. [DOI: https://dx.doi.org/10.1186/s12941-019-0339-4]
28. Saavedra, S.Y.; Diaz, L.; Wiesner, M.; Correa, A.; Arévalo, S.A.; Reyes, J.; Hidalgo, A.M.; de la Cadena, E.; Perenguez, M.; Montaño, L.A. et al. Genomic and Molecular Characterization of Clinical Isolates of Enterobacteriaceae Harboring mcr-1 in Colombia, 2002 to 2016. Antimicrob. Agents Chemother.; 2017; 61, e00841-17. [DOI: https://dx.doi.org/10.1128/AAC.00841-17]
29. Dadashi, M.; Sameni, F.; Bostanshirin, N.; Yaslianifard, S.; Khosravi-Dehaghi, N.; Nasiri, M.J.; Goudarzi, M.; Hashemi, A.; Hajikhani, B. Global prevalence and molecular epidemiology of mcr-mediated colistin resistance in Escherichia coli clinical isolates: A systematic review. J. Glob. Antimicrob. Resist.; 2022; 29, pp. 444-461. [DOI: https://dx.doi.org/10.1016/j.jgar.2021.10.022]
30. Garza-Ramos, U.; Silva-Sánchez, J.; López-Jácome, L.E.; Hernández-Durán, M.; Colín-Castro, C.A.; Sánchez-Pérez, A.; Rodríguez-Santiago, J.; Morfín-Otero, R.; Rodriguez-Noriega, E.; Velázquez-Acosta, M.-D. et al. Carbapenemase-Encoding Genes and Colistin Resistance in Gram-Negative Bacteria During the COVID-19 Pandemic in Mexico: Results from the Invifar Network. Microb. Drug Resist.; 2022; 29, pp. 239-248. [DOI: https://dx.doi.org/10.1089/mdr.2022.0226]
31. Merida-Vieyra, J.; Ranero, A.D.C.; Arzate-Barbosa, P.; De La Garza, E.A.; Méndez-Tenorio, A.; Murcia-Garzón, J.; Aquino-Andrade, A. First clinical isolate of Escherichia coli harboring mcr-1 gene in Mexico. PLoS ONE; 2019; 14, e0214648. [DOI: https://dx.doi.org/10.1371/journal.pone.0214648]
32. El-Baky, R.M.A.; Masoud, S.M.; Mohamed, D.S.; Waly, N.G.; A Shafik, E.; A Mohareb, D.; Elkady, A.; Elbadr, M.M.; Hetta, H.F. Prevalence and Some Possible Mechanisms of Colistin Resistance among Multidrug-Resistant and Extensively Drug-Resistant Pseudomonas aeruginosa. Infect. Drug Resist.; 2020; 13, pp. 323-332. [DOI: https://dx.doi.org/10.2147/IDR.S238811]
33. Snesrud, E.; Maybank, R.; Kwak, Y.I.; Jones, A.R.; Hinkle, M.K.; McGann, P. Chromosomally Encoded mcr-5 in Colistin-Nonsusceptible Pseudomonas aeruginosa. Antimicrob. Agents Chemother.; 2018; 62, e00679-18. [DOI: https://dx.doi.org/10.1128/AAC.00679-18]
34. Chen, H.; Mai, H.; Lopes, B.; Wen, F.; Patil, S. Novel Pseudomonas aeruginosa Strains Co-Harbouring blaNDM-1 Metallo β-Lactamase and mcr-1 Isolated from Immunocompromised Paediatric Patients. Infect. Drug Resist.; 2022; 15, pp. 2929-2936. [DOI: https://dx.doi.org/10.2147/IDR.S368566]
35. Yap, P.S.-X.; Cheng, W.-H.; Chang, S.-K.; Lim, S.-H.E.; Lai, K.-S. MgrB Mutations and Altered Cell Permeability in Colistin Resistance in Klebsiella pneumoniae. Cells; 2022; 11, 2995. [DOI: https://dx.doi.org/10.3390/cells11192995] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36230959]
36. Azimi, L.; Lari, A.R. Colistin-resistant Pseudomonas aeruginosa clinical strains with defective biofilm formation. GMS Hyg. Infect. Control.; 2019; 14, Doc12. [DOI: https://dx.doi.org/10.3205/dgkh000328] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31728266]
37. Anan, M.M.G.; El-Seidi, E.A.; Mostafa, M.S.; Rashed, L.A.; El-Wakil, D.M. Detection of Plasmid-Mediated Mobile Colistin Resistance Gene (mcr-1) in Enterobacterales Isolates from a University Hospital. Infect Drug Resist.; 2021; 14, pp. 3063-3070. [DOI: https://dx.doi.org/10.2147/IDR.S318787]
38. Ortega-Paredes, D.; Barba, P.; Zurita, J. Colistin-resistant Escherichia coli clinical isolate harbouring the mcr-1 gene in Ecuador. Epidemiol. Infect.; 2016; 144, pp. 2967-2970. [DOI: https://dx.doi.org/10.1017/S0950268816001369] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27586373]
39. Karki, D.; Dhungel, B.; Bhandari, S.; Kunwar, A.; Joshi, P.R.; Shrestha, B.; Rijal, K.R.; Ghimire, P.; Banjara, M.R. Antibiotic resistance and detection of plasmid mediated colistin resistance mcr-1 gene among Escherichia coli and Klebsiella pneumoniae isolated from clinical samples. Gut. Pathog.; 2021; 13, 45. [DOI: https://dx.doi.org/10.1186/s13099-021-00441-5] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34225805]
40. Ugarte, R.G.; Olivo, J.M.; Corso, A.; Pasteran, F.; Albornoz, E.; Sahuanay, Z.P. Resistencia a colistín mediado por el gen mcr-1 identificado en cepas de Escherichia coli y Klebsiella pneumoniae. Primeros reportes en el Perú. An. Fac. Med.; 2018; 79, pp. 213-217. [DOI: https://dx.doi.org/10.15381/anales.v79i3.15313]
41. Carroll, L.M.; Gaballa, A.; Guldimann, C.; Sullivan, G.; Henderson, L.O.; Wiedmann, M. Identification of Novel Mobilized Colistin Resistance Gene mcr-9 in a Multidrug-Resistant, Colistin-Susceptible Salmonella enterica Serotype Typhimurium Isolate. mBio; 2019; 10, e00853-19. [DOI: https://dx.doi.org/10.1128/mBio.00853-19]
42. Terveer, E.M.; Nijhuis, R.H.T.; Crobach, M.J.T.; Knetsch, C.W.; Veldkamp, K.E.; Gooskens, J.; Kuijper, E.J.; Claas, E.C.J. Prevalence of colistin resistance gene (mcr-1) containing Enterobacteriaceae in feces of patients attending a tertiary care hospital and detection of a mcr-1 containing, colistin susceptible E. coli. PLoS ONE; 2017; 12, e0178598. [DOI: https://dx.doi.org/10.1371/journal.pone.0178598]
43. Mendes, A.C.; Novais, Â.; Campos, J.; Rodrigues, C.; Santos, C.; Antunes, P.; Ramos, H.; Peixe, L. mcr-1 in Carbapenemase-Producing Klebsiella pneumoniae with Hospitalized Patients, Portugal, 2016–2017. Emerg. Infect. Dis.; 2018; 24, pp. 762-766. [DOI: https://dx.doi.org/10.3201/eid2404.171787]
44. Östholm, Å.; Tärnberg, M.; Monstein, H.J.; Hällgren, A.; Hanberger, H.; Nilsson, L.E. High frequency of co-resistance in CTX-M-producing Escherichia coli to non-beta-lactam antibiotics, with the exceptions of amikacin, nitrofurantoin, colistin, tigecycline, and fosfomycin, in a county of Sweden. Scand. J. Infect. Dis.; 2013; 45, pp. 271-278. [DOI: https://dx.doi.org/10.3109/00365548.2012.734636]
45. Tsui, C.K.; Sundararaju, S.; Al Mana, H.; Hasan, M.R.; Tang, P.; Perez-Lopez, A. Plasmid-mediated colistin resistance encoded by mcr-1 gene in Escherichia coli co-carrying blaCTX-M-15 and blaNDM-1 genes in pediatric patients in Qatar. J. Glob. Antimicrob. Resist.; 2020; 22, pp. 662-663. [DOI: https://dx.doi.org/10.1016/j.jgar.2020.06.029]
46. Yauri-Condor, K.; Apestegui, M.Z.; Sevilla-Andrade, C.R.; Sara, J.P.; Espinoza, C.V.; Taboada, W.V.; Gonzales-Escalante, E. Extended-spectrum beta-lactamase-producing Enterobacterales carrying the mcr-1 gene in Lima, Peru. Rev. Perú. Med. Exp. Salud Publica; 2020; 37, pp. 711-715. [DOI: https://dx.doi.org/10.17843/rpmesp.2020.374.5832]
47. Leroy, A.; Naze, F.; Dortet, L.; Naas, T.; Jaubert, J. Plasmid-mediated colistin resistance gene mcr-1 in a clinical Escherichia coli isolate in the Indian Ocean Commission. Med. Mal. Infect.; 2018; 48, pp. 426-428. [DOI: https://dx.doi.org/10.1016/j.medmal.2018.04.388] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29753527]
48. Luo, X.; Matthews, K.R. The conjugative transfer of plasmid-mediated mobile colistin resistance gene, mcr-1, to Escherichia coli O157:H7 and Escherichia coli O104:H4 in nutrient broth and in mung bean sprouts. Food Microbiol.; 2023; 111, 104188. [DOI: https://dx.doi.org/10.1016/j.fm.2022.104188] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36681389]
49. Li, X.P.; Sun, R.Y.; Song, J.Q.; Fang, L.X.; Zhang, R.M.; Lian, X.L.; Liao, X.P.; Liu, Y.H.; Lin, J.; Sun, J. Within-host heterogeneity and flexibility of mcr-1 transmission in chicken gut. Int. J. Antimicrob. Agents; 2020; 55, 105806. [DOI: https://dx.doi.org/10.1016/j.ijantimicag.2019.09.010]
50. Novais, A.; Pires, J.; Ferreira, H.; Costa, L.; Montenegro, C.; Vuotto, C.; Donelli, G.; Coque, T.M.; Peixe, L. Characterization of globally spread Escherichia coli ST131 isolates (1991 to 2010). Antimicrob. Agents Chemother.; 2012; 56, pp. 3973-3976. [DOI: https://dx.doi.org/10.1128/AAC.00475-12] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22491693]
51. Li, G.; Li, X.; Wu, Y.; Xu, J.; He, F. Genomic Insights into the Colistin Resistant mcr-Carrying Escherichia coli Strains in a Tertiary Hospital in China. Antibiotics; 2022; 11, 1522. [DOI: https://dx.doi.org/10.3390/antibiotics11111522]
52. Kudinha, T.; Kong, F. Possible step-up in prevalence for Escherichia coli ST131 from fecal to clinical isolates: Inferred virulence potential comparative studies within phylogenetic group B2. J. Biomed. Sci.; 2022; 29, 78. [DOI: https://dx.doi.org/10.1186/s12929-022-00862-7] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36207707]
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
The aim of this study was to determine the prevalence of plasmid-mediated colistin resistance mcr-1 to mcr-5 genes among colistin and multi-drug-resistant Gram-negative bacilli strains isolated from patients in a tertiary hospital in Toluca, Mexico. The presence of mcr genes among the 241 strains collected was assessed by PCR. In the case of mcr-carrying E. coli, further PCR tests were performed to determine the presence of blaCTX-M and whether the strains belonged to the O25b-ST131 clone. Conjugation experiments were also carried out to assess the horizontal transmission of colistin resistance. A total of twelve strains (5.0%), of which four were E. coli; four were P. aeruginosa; three were K. pneumoniae, and one E. cloacae, were found to be resistant to colistin. Of these strains, two E. coli isolates were found to carry mcr-1, and Southern blot hybridization demonstrated its presence on an approximately 60 kb plasmid. Both mcr-1-carrying E. coli strains were found to co-express blaCTX-M, belong to the O25b-ST131 clone, and horizontally transmit their colistin resistance. The results of this study confirm the presence of plasmid-mediated colistin resistance in hospitalized patients in Mexico and demonstrated that the multi-drug-resistant O25b-ST131 E. coli clone can acquire mcr genes and transmit such resistance traits to other bacteria.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
; Pacheco-Vásquez, Reinaldo 3
; Devanhí Quintas-de la Paz 2 ; Baltazar-Jiménez, Isabel 2
; Santiago-Luna, José David 2
; Guadarrama-Monroy, Laura 3 1 Laboratorios Galindo SC, Av Juárez 501-A, Col Centro, Oaxaca 68000, Oax, Mexico; School of Medicine, Universidad Anáhuac Oaxaca, Blvd. Guadalupe Hinojosa de Murat 1100, San Raymundo Jalpam 71248, Oax, Mexico
2 School of Medicine, Universidad Anáhuac Oaxaca, Blvd. Guadalupe Hinojosa de Murat 1100, San Raymundo Jalpam 71248, Oax, Mexico
3 Centro Médico ISSEMYM Toluca, Av. Baja Velocidad KM. 57.5, Carr. Mex./Tol. Col. San Jeronimo Chicahualco, Metepec 52170, Edomex, Mexico




