Regulation of store-operated Ca2+ entry by IP3 receptors independent of their ability to release Ca2+

Abstract

Loss of endoplasmic reticular (ER) Ca²⁺ activates store-operated Ca²⁺ entry (SOCE) by causing the ER localized Ca²⁺ sensor STIM to unfurl domains that activate Orai channels in the plasma membrane at membrane contact sites (MCS). Here, we demonstrate a novel mechanism by which the inositol 1,4,5 trisphosphate receptor (IP₃R), an ER-localized IP₃-gated Ca²⁺ channel, regulates neuronal SOCE. In human neurons, SOCE evoked by pharmacological depletion of ER-Ca²⁺ is attenuated by loss of IP₃Rs, and restored by expression of IP₃Rs even when they cannot release Ca²⁺, but only if the IP₃Rs can bind IP₃. Imaging studies demonstrate that IP₃Rs enhance association of STIM1 with Orai1 in neuronal cells with empty stores; this requires an IP₃-binding site, but not a pore. Convergent regulation by IP₃Rs, may tune neuronal SOCE to respond selectively to receptors that generate IP₃.

Introduction

The activities of all eukaryotic cells are regulated by increases in cytosolic-free Ca²⁺ concentration ([Ca²⁺]_c), which are almost invariably evoked by the opening of Ca²⁺-permeable ion channels in biological membranes. The presence of these Ca²⁺ channels within the plasma membrane (PM) and the membranes of intracellular Ca²⁺ stores, most notably the endoplasmic reticulum (ER), allows cells to use both intracellular and extracellular sources of Ca²⁺ to evoke Ca²⁺ signals. In animal cells, the most widely expressed Ca²⁺ signaling sequence links extracellular stimuli, through their specific receptors and activation of phospholipase C, to formation of inositol 1,4,5-trisphosphate (IP₃), which then stimulates Ca²⁺ release from the ER through IP₃ receptors (IP₃R) (Foskett et al., 2007; Prole and Taylor, 2019). IP₃Rs occupy a central role in Ca²⁺ signaling by releasing Ca²⁺ from the ER. IP₃Rs thereby elicit cytosolic Ca²⁺ signals, and by depleting the ER of Ca²⁺ they initiate a sequence that leads to activation of store-operated Ca²⁺ entry (SOCE) across the PM (Putney, 1986; Thillaiappan et al., 2019). SOCE occurs when loss of Ca²⁺ from the ER causes Ca²⁺ to dissociate from the luminal Ca²⁺-binding sites of an integral ER protein, stromal interaction molecule 1 (STIM1). STIM1 then unfolds its cytosolic domains to expose a region that binds directly to a Ca²⁺ channel within the PM, Orai, causing it to open and Ca²⁺ to flow into the cell across the PM (Parekh and Putney, 2005; Prakriya and Lewis, 2015; Lewis, 2020). The interactions between STIM1 and Orai occur across a narrow gap between the ER and PM, a membrane contact site (MCS), where STIM1 puncta trap Orai channels. While STIM1 and Orai are undoubtedly the core components of SOCE, many additional proteins modulate their interactions (Rosado et al., 2000; Palty et al., 2012; Deb et al., 2016; Srivats et al., 2016) and other proteins contribute by regulating the assembly of MCS (Chang et al., 2013; Giordano et al., 2013; Kang et al., 2019).

It is accepted that IP₃-evoked Ca²⁺ release from the ER through IP₃Rs is the usual means by which extracellular stimuli evoke SOCE. Here, the role of the IP₃R is widely assumed to be restricted to its ability to mediate Ca²⁺ release from the ER and thereby activate STIM1. Evidence from Drosophila, where we suggested an additional role for IP₃Rs in regulating SOCE (Agrawal et al., 2010; Chakraborty et al., 2016), motivated the present study, wherein we examined the contribution of IP₃Rs to SOCE in mammalian neurons. We show that in addition to their ability to activate STIM1 by evoking ER Ca²⁺ release, IP₃Rs also facilitate interactions between active STIM1 and Orai1. This additional role for IP₃Rs, which is regulated by IP₃ but does not require a functional pore, reveals an unexpected link between IP₃, IP₃Rs and Ca²⁺ signaling that is not mediated by IP₃-evoked Ca²⁺ release. We speculate that dual regulation of SOCE by IP₃Rs may allow Ca²⁺ release evoked by IP₃ to be preferentially coupled to SOCE.

Results

Loss of IP₃R1 attenuates SOCE in human neural stem cells and neurons

We investigated the effects of IP₃Rs on SOCE by measuring [Ca²⁺]_c in human neural stem cells and neurons prepared from embryonic stem cells. Human neural progenitor cells (hNPCs) were derived from H9 embryonic stem cells using small molecules that mimic cues provided during human brain development (Gopurappilly et al., 2018). We confirmed that hNPCs express canonical markers of neural stem cells (Figure 1A) and that IP₃R1 is the predominant IP₃R subtype (GEO accession no. GSE109111; Gopurappilly et al., 2018). An inducible lentiviral shRNA-miR construct targeting IP₃R1 reduced IP₃R1 expression by 93 ± 0.4% relative to a non-silencing (NS) construct (Figure 1B and C). Carbachol stimulates muscarinic acetylcholine receptors, which are expressed at low levels in hNPCs (Gopurappilly et al., 2018). In Ca²⁺-free medium, carbachol evoked an increase in [Ca²⁺]_c in about 10% of hNPCs, consistent with it stimulating Ca²⁺ release from the ER through IP₃Rs. Restoration of extracellular Ca²⁺ then evoked an increase in [Ca²⁺]_c in all cells that responded to carbachol. Both carbachol-evoked Ca²⁺ release and SOCE were abolished in hNPCs expressing IP₃R1-shRNA, confirming the effectiveness of the IP₃R1 knockdown (Figure 1—figure supplement 1A–C).

Figure 1.

Loss of IP₃R1 attenuates SOCE in human neural stem cells.

(A) Confocal images of hNPCs (passage 6) stained for DAPI and neural stem cell proteins: Pax6 and Ki67 (proliferation marker). Scale bars, 50 μm. (B) WB for IP₃R1 of hNPCs expressing non-silencing (NS) or IP₃R1-shRNA. (C) Summary results (mean ±s.d., n=3) show IP₃R1 expression relative to actin. ^**p < 0.01, Student’s t-test with unequal variances. (D) Changes in [Ca²⁺]_c evoked by thapsigargin (Tg, 10 µM) in Ca²⁺-free HBSS and then restoration of extracellular Ca²⁺ (2 mM) in hNPCs expressing NS or IP₃R1-shRNA. Mean ± s.e.m. from hree independent experiments, each with four replicates that together included 100–254 cells. Inset shows the target of Tg. (E–G) Summary results (individual cells, median (bar), 25th and 75th percentiles (box) and mean (circle)) show Ca²⁺ signals evoked by Tg or Ca²⁺ restoration (E), rate of Ca²⁺ entry (F) and resting [Ca²⁺]_c (G). ^***p < 0.001, Mann-Whitney U-test. (H) Changes in [Ca²⁺]_c evoked by Tg (10 µM) in Ca²⁺-free HBSS and after restoring extracellular Ca²⁺ (2 mM) in neurons (differentiated hNPCs) expressing NS or IP₃R1-shRNA. Mean ± s.e.m. from three experiments with ~200 cells. (I,J) Summary results (presented as in E-G) show Ca²⁺ signals evoked by Tg or Ca²⁺ restoration (I) and rate of Ca²⁺ entry (J). ^***p < 0.001. Mann-Whitney U-test. See also Figure 1—figure supplement 1. Source data in Figure 1—source data 1.

Figure 1—figure supplement 1.

Loss of IP₃R1 attenuates SOCE in neural precursor cells and differentiated neurons.

(A–C) hNPCs expressing NS (A, C) or IP₃R1-shRNA (B) were stimulated with carbachol (CCh, 100 µM) in Ca²⁺-free HBSS before restoring extracellular Ca²⁺ (10 mM). Each trace shows the Fura 2 fluorescence ratio (F₃₄₀/F₃₈₀) from a single cell (>50 cells from three experiments). Traces in (C) show only cells that responded to CCh. (D, E) hNPCs expressing shRNA were stimulated with thapsigargin (Tg, 10 µM) in Ca²⁺-free HBSS before restoring extracellular Ca²⁺ (2 mM). Traces are from individual cells (>180 cells from three experiments), with the mean response shown by a thick line. Summary results in Figure 1D–G. (F) Confocal images of hNPCs and neurons spontaneously differentiated (10 days) from hNPCs stained for DAPI and neuronal markers: Tuj1 (βIII-tubulin) and NeuN (neuronal nuclear antigen). Scale bars, 50 μm. Only differentiated hNPCs express neuronal markers. (G) WB for STIM1 and Orai1 in lysates from hNPCs cells expressing non-silencing (NS) or IP₃R1-shRNA. Summary results (mean ±s.d., n=3) show relative expression of STIM1 and Orai1 relative to control shRNA (NS) cells. p>0.01, Student’s t-test with unequal variances. (H, I) Spontaneously differentiated hNPCs (25 days) expressing NS (H) or IP₃R1-shRNA (I) were depolarized by addition of KCl (75 mM). Traces show responses from single cells (>30 cells from three experiments) and mean response (thick line). (J) Summary results (mean ± s.e.m., three experiments) show peak increases in [Ca²⁺]_c (Δ[Ca²⁺]_c) evoked by depolarization. No significant difference, Student’s t-test with unequal variances. (K, L) Spontaneously differentiated hNPCs expressing NS (K) or IP₃R1-shRNA (L) were stimulated with Tg (10 µM) in Ca²⁺-free HBSS before restoring extracellular Ca²⁺ (2 mM). Traces from individual cells (>100 cells from three experiments) and the mean response (bold) are shown. Summary results in Figure 1H–J. Source data in Figure 1—figure supplement 1—source data 1.

Thapsigargin, a selective and irreversible inhibitor of the ER Ca²⁺ pump (sarcoplasmic/endoplasmic reticulum Ca²⁺-ATPase, SERCA), was used to deplete the ER of Ca²⁺ and thereby activate SOCE (Figure 1D; Parekh and Putney, 2005). Restoration of extracellular Ca²⁺ to thapsigargin-treated hNPCs evoked a large increase in [Ca²⁺]_c, reflecting the activity of SOCE (Figure 1D). The maximal amplitude and rate of SOCE were significantly reduced in cells lacking IP₃R1, but the resting [Ca²⁺]_c and thapsigargin-evoked Ca²⁺ release were unaffected (Figure 1D–F and Figure 1—figure supplement 1D and E). STIM1 and Orai1 expression were also unaltered in hNPC lacking IP₃R1 (Figure 1—figure supplement 1G). After spontaneous differentiation of hNPC, cells expressed markers typical of mature neurons, and the cells responded to depolarization with an increase in [Ca²⁺]_c (Figure 1—figure supplement 1F and Figure 1—figure supplement 1H–J). Thapsigargin evoked SOCE in these differentiated neurons; and expression of IP₃R1-shRNA significantly reduced the SOCE response without affecting depolarization-evoked Ca²⁺ signals (Figure 1H–J and Figure 1—figure supplement 1H–L).

Loss of IP₃R1 attenuates SOCE in human neuroblastoma cells

IP₃Rs link physiological stimuli that evoke Ca²⁺ release from the ER to SOCE, but the contribution of IP₃Rs is thought to be limited to their ability to deplete the ER of Ca²⁺. We have reported that in Drosophila neurons there is an additional requirement for IP₃Rs independent of ER Ca²⁺ release (Venkiteswaran and Hasan, 2009; Agrawal et al., 2010; Chakraborty et al., 2016). Our results with hNPCs and stem cell-derived neurons suggest a similar requirement for IP₃Rs in regulating SOCE in mammalian neurons. To explore the mechanisms underlying this additional role for IP₃Rs, we turned to a more tractable cell line, SH-SY5Y cells. These cells are derived from a human neuroblastoma; they exhibit many neuronal characteristics (Agholme et al., 2010); they express M3 muscarinic acetylcholine receptors that evoke IP₃-mediated Ca²⁺ release and SOCE (Grudt et al., 1996); and they express predominantly IP₃R1 (Wojcikiewicz, 1995; Tovey et al., 2001), with detectable IP₃R3, but no IP₃R2 (Figure 2A). We used inducible expression of IP₃R1-shRNA to significantly reduce IP₃R1 expression (by 74 ± 1.2%), without affecting IP₃R3 (Figure 2A and B). As expected, carbachol-evoked Ca²⁺ signals in individual SH-SY5Y cells were heterogenous and the carbachol-evoked Ca²⁺ release was significantly reduced by knockdown of IP₃R1 (Figure 2C and D and Figure 2—figure supplement 1A and B). Thapsigargin evoked SOCE in SH-SY5Y cells (Grudt et al., 1996), and it was significantly attenuated after knockdown of IP₃R1 without affecting resting [Ca²⁺]_c, the Ca²⁺ release evoked by thapsigargin or expression of STIM1 and Orai1 (Figure 2E–G and Figure 2—figure supplement 1C–E).

Figure 2.

Loss of IP₃R1 attenuates SOCE in SH-SY5Y cells.

(A) WB for IP₃R1-3 of SH-SY5Y cells expressing non-silencing (NS) or IP₃R1-shRNA. (B) Summary results (mean ± s.d., n=4) show IP₃R expression relative to actin normalized to control NS cells. ^**p < 0.01, Student’s t-test with unequal variances. (C) Ca²⁺ signals evoked by carbachol (CCh, 3 µM) in SH-SY5Y cells expressing NS or IP₃R1-shRNA. Mean ± s.e.m. from three experiments with 70–90 cells. (D) Summary results show peak changes in [Ca²⁺]_c (Δ[Ca²⁺]_c) evoked by CCh. ^***p < 0.001, Mann-Whitney U-test. (E) Ca²⁺ signals evoked by thapsigargin (Tg, 10 µM) in Ca²⁺-free HBSS and then after restoration of extracellular Ca²⁺ (2 mM) in cells expressing NS or IP₃R1-shRNA. Mean ± s.e.m. from three experiments with ~50 cells. (F, G) Summary results (individual cells, mean ± s.e.m., n=3, ~50 cells) show peak changes in [Ca²⁺]_c evoked by Ca²⁺ restoration (Δ[Ca²⁺]_c) (F) and rate of Ca²⁺ entry (G). ^***p < 0.001, Mann-Whitney U-test. (H) Ca²⁺ signals evoked by Tg and then Ca²⁺ restoration in cells expressing NS-shRNA, or IP₃R1-shRNA alone or with IP₃R1 or IP₃R3. Traces show mean ± s.e.m. (50–115 cells from three experiments). (I, J) Summary results (mean ± s.e.m, 50–115 cells from three experiments) show peak increases in [Ca²⁺]_c (Δ[Ca²⁺]_c) evoked by Ca²⁺ restoration (I) and rates of Ca²⁺ entry (J) evoked by restoring extracellular Ca²⁺. (K) Effects of thapsigargin (Tg, 10 µM) in Ca²⁺-free HBSS and then after Ca²⁺ restoration (2 mM) in cells expressing IP₃R1-shRNA alone or with IP₃R1 or mCh-STIM1. Traces show mean ± s.e.m. (100–150 cells from three experiments). (L, M) Summary results (mean ± s.e.m.) show peak increase in [Ca²⁺]_c after Ca²⁺ restoration (Δ[Ca²⁺]_c) (L) and rate of Ca²⁺ entry (M). Different letters indicate significant differences (panels I, J, L, M), p <0.001, one-way ANOVA with pair-wise Tukey’s test. See also Figure 2—figure supplements 1–3. Source data in Figure 2—source data 1.

Figure 2—figure supplement 1.

Reduced expression of IP₃R1 using either shRNA or CRISPR/Cas9n attenuates SOCE in SH-SY5Y cells.

(A, B) Ca²⁺ signals evoked by carbachol (CCh, 3 μM) in Ca²⁺-free HBSS in SH-SY5Y cells expressing NS (A) or IP₃R1-shRNA (B). Traces show responses from single cells (100–200 cells from three experiments). (C, D) SH-SY5Y cells expressing NS (C) or IP₃R1-shRNA (D) were treated with thapsigargin (Tg, 1 µM) in Ca²⁺-free HBSS before restoration of extracellular Ca²⁺ (2 mM). Traces show responses from single cells (50–100 cells from three experiments) and mean response (thick lines). Summary results in Figure 2C–G. (E) Western blots (WB) for STIM1 and Orai1 from lysates of SH-SY5Y cells expressing non-silencing (NS) or IP₃R1-shRNA. Summary results (mean ±s.d., n=3) show STIM1 and Orai1 expression relative to NS-shRNA cells. p>0.05, Student’s t-test with unequal variances. (F) Western blot for IP₃R1 and tubulin from lysates from WT SH-SY5Y cells and for cells from a cell line in which the IP₃R1 gene was targeted using CRISPR/Cas9 (IKO null). The blot is typical of three similar analyses. Summary results (mean ±s.d., n=3) show IP₃R1 expression relative to WT cells. p<0.001, Student’s t-test with unequal variances.(G) Western blots (WB) for STIM1 (S1), STIM2 (S2) and Orai1 (O1) from lysates of WT and IKO null SH-SY5Y cells. Summary results (mean ±s.d., n=3) show STIM1,2 and Orai1 expression relative to WT cells. p>0.05, Student’s t-test with unequal variances.(H) Ca²⁺ signals evoked by carbachol (CCh, 1 μM) in WT and IKO null SH-SY5Y cells in Ca²⁺-free HBSS. (I) SH-SY5Y cells (WT or IKO null) were treated with thapsigargin (Tg, 1 µM) in Ca²⁺-free HBSS before restoring extracellular Ca²⁺ (2 mM). Mean ± s.e.m. from three experiments with WT cells (black, 110 cells), IKO null cells (red, 117 cells). (J) Summary results show the peak increases in [Ca²⁺]_c evoked by Tg (1 µM) in Ca²⁺-free HBSS (Δ[Ca²⁺]_c) and after Ca²⁺ restoration (SOCE). Different letters indicate p<0.001, Mann-Whitney U-test. (K) PCRs for IP₃R1 and GAPDH (control gene) of genomic DNA isolated from SH-SY5Y cells. Results (mean ± s.e.m. from three independent analyses of a single cell line) are shown for wild type (WT) cells and for cells in which the IP₃R1 gene was targeted using CRISPR/Cas9n (IKO). Expression of IP₃R1 has been normalized to expression of GAPDH. ^**p < 0.01, Student’s t-test with unequal variances. (L) Droplet digital PCR amplification was used to determine gene copy number for IP₃R1 and a control gene RPP30 for WT and IKO SH-SY5Y cells. **p<0.05, Student’s t-test with unequal variances. (M) Western blot for IP₃R1 and tubulin from lysates from WT SH-SY5Y cells and for cells from a cell line in which the IP₃R1 gene was targeted using CRISPR/Cas9n (IKO). The blot is typical of 3 similar analyses. Summary results (mean ±s.d., n=3) show IP₃R1 expression relative to WT cells. **p<0.01, Student’s t-test with unequal variances. (N) Ca²⁺ signals evoked by carbachol (CCh, 1 μM) in WT and IKO SH-SY5Y cells in Ca²⁺-free HBSS. Results show (mean ± s.e.m.) for each of three independently edited cell lines (IKO1, 2 and 3), each with at least 30 cells; and the overall mean ± s.e.m. (red line). Results from a total of 89 WT cells and 130 IKO cells are shown. (O) Summary results (mean ± s.e.m. from three experiments with 80–100 cells) show peak changes in [Ca²⁺]_c (Δ[Ca²⁺]_c) evoked by CCh. ***p<0.001, Mann-Whitney U-test. (P) SH-SY5Y cells (WT or IKO) were treated with thapsigargin (Tg, 1 µM) in Ca²⁺-free HBSS before restoring extracellular Ca²⁺ (2 mM). Mean ± s.e.m. from three experiments with WT cells (black, 85 cells), three independently edited cell lines (IKO 1, 2 and 3; at least 30 cells for each) and the pooled results from all edited cells (97; red). (Q) Summary results show the peak increases in [Ca²⁺]_c evoked by Tg (1 µM) in Ca²⁺-free HBSS (Δ[Ca²⁺]_c) and after Ca²⁺ restoration (SOCE). Different letters indicate p<0.001, Mann-Whitney U-test. Source data in Figure 2—figure supplement 1—source data 1 .

Figure 2—figure supplement 2.

Attenuated SOCE in SH-SY5Y cells lacking IP₃R1 is rescued by expression of IP₃R1, IP₃R3 or STIM1.

(A) Ca²⁺ signals evoked by carbachol (CCh, 3 μM) in SH-SY5Y cells expressing NS or IP₃R1-shRNA, and the latter with IP₃R1 or IP₃R3. Traces show mean ± s.e.m. from >3 experiments with 50–70 cells. (B–D) Summary results show peak Ca²⁺ signals (Δ[Ca²⁺]_c) evoked by CCh (B), resting [Ca²⁺]_c (C) and the peak Ca²⁺ signal evoked by Tg (10 µM) in Ca²⁺-free HBSS (Δ[Ca²⁺]_c, a reporter of ER Ca²⁺ content) (D). Different letter codes indicate significantly different values, p<0.001, one-way ANOVA and pair-wise Tukey’s test. (E) Effects of expressing mCh-STIM1 in SH-SY5Y cells expressing NS shRNA on the Ca²⁺ signals evoked by Tg (1 µM) in Ca²⁺-free HBSS and then after restoration of extracellular Ca²⁺ (2 mM). Traces show mean ± s.e.m. from three experiments with 30–110 cells. (F) Summary results show the peak Δ[Ca²⁺]_c evoked by restoring extracellular Ca²⁺ after Tg. Mean ± s.e.m. p>0.05, Mann-Whitney U-test. Source data in Figure 2—figure supplement 2—source data 1.

Figure 2—figure supplement 3.

Loss of IP₃R1 does not affect SOCE in HEK cells.

(A) WB for IP₃R1 in HEK cells expressing non-silencing (NS) or IP₃R1-shRNA. Summary results (mean ±s.d., n=3) show IP₃R1 expression relative to tubulin. ^***p < 0.001, Student’s t-test with unequal variances. (B) HEK cells expressing NS or IP₃R1-shRNA were treated with thapsigargin (Tg, 1 µM) in Ca²⁺-free HBSS before restoration of extracellular Ca²⁺ (2 mM). Traces show mean response from >100 cells from three experiments. (C) Summary results show the peak increases in [Ca²⁺]_c evoked by Tg (1 µM) in Ca²⁺-free HBSS (Δ[Ca²⁺]_c, a reporter of ER Ca²⁺ content) and after Ca²⁺ restoration (SOCE). (D) Wild type HEK cells (HEK WT) and cells lacking all IP₃Rs (HEK-TKO) were treated with thapsigargin (Tg, 1 µM) in Ca²⁺-free HBSS before restoration of extracellular Ca²⁺ (2 mM). Traces show mean ± s.e.m. from three experiments with 80–120 cells. (E) Summary results show the peak Δ[Ca²⁺]_c evoked by restoring extracellular Ca²⁺ after Tg. Mean ± s.e.m. p>0.01, Mann-Whitney U-test. (F) Proximity ligation assay (PLA) analyses of interactions between STIM1 and Orai1 in wild type HEK (WT) and TKO cells. Confocal images are shown for control cells (-Tg) or after 10 min treatment with thapsigargin (+Tg, 1 µM) in Ca²⁺-free HBSS. PLA reaction product is red, and nuclei are stained with DAPI (blue). Scale bars, 5 µm. Summary results show the surface area of the PLA spots for ~20 cells from two independent analyses. Individual values, median (bar) and 25th and 75th percentiles (box). **p<0.01, Student’s t-test with unequal variances. Source data in Figure 2—figure supplement 3—source data 1.

We also used CRISPR/Cas9n and Cas9 to disrupt one or both copies of the IP₃R1 gene, subsequently referred to as IKO (one copy knockout) and IKO null (both copies knocked out) in SH-SY5Y cells. IP₃R1 expression was absent in the IKO null (Figure 2—figure supplement 1F) whereas expression of STIM1, STIM2 and Orai1 were unperturbed (Figure 2—figure supplement 1G). Carbachol-evoked Ca²⁺ release and thapisgargin-evoked SOCE were significantly reduced (Figure 2—figure supplement 1H–J). Since the IKO null cells were fragile and grew slowly, we examined SOCE in SH-SY5Y cells with disruption of one copy of the IP₃R1 gene. In the IKO cells, IP₃R1 expression, carbachol-evoked Ca²⁺ signals and thapsigargin-evoked SOCE were all reduced (Figure 2—figure supplement 1K–Q).

These observations, which replicate those from hNPCs and neurons (Figure 1), vindicate our use of SH-SY5Y cells to explore the mechanisms linking IP₃Rs to SOCE in human neurons.

Expression of IP₃R1 or IP₃R3 in SH-SY5Y cells expressing IP₃R1-shRNA restored both carbachol-evoked Ca²⁺ release and thapsigargin-evoked SOCE without affecting resting [Ca²⁺]_c or thapsigargin-evoked Ca²⁺ release (Figure 2H–J and Figure 2—figure supplement 2A–D). Over-expression of STIM1 in cells expressing NS-shRNA had no effect on SOCE (Figure 2—figure supplement 2E and F), but it restored thapsigargin-evoked SOCE in cells expressing IP₃R1-shRNA, without affecting resting [Ca²⁺]_c or thapsigargin-evoked Ca²⁺ release (Figure 2K–M). We conclude that IP₃Rs are required for optimal SOCE, but they are not essential because additional STIM1 can replace the need for IP₃Rs (Figure 3A).

Figure 3.

Regulation of SOCE by IP₃R requires IP₃ binding but not a functional pPore in SH-SY5Y cells.

(A) SOCE is activated when loss of Ca²⁺ from the ER through IP₃Rs activates STIM1 (i). Our results suggest an additional role for IP₃Rs (ii). (B) SH-SY5Y cells expressing IP₃R1-shRNA alone or with IP₃R1 or IP₃R1^DA were stimulated with thapsigargin (Tg, 1 µM) in Ca²⁺-free HBSS before restoring extracellular Ca²⁺ (2 mM). Traces show mean ± s.e.m, for 100–150 cells from three experiments. (C) Cells expressing IP₃R1-shRNA and IP₃R1^DA were treated with NS-siRNA or Orai1-siRNA before measuring Tg-evoked Ca²⁺ entry. Traces show mean ± s.e.m. for 85–100 cells from three experiments. (D) Summary results (mean ± s.e.m.) show peak increases in [Ca²⁺]_c (Δ[Ca²⁺]_c) evoked by Ca²⁺ restoration. (E) Tg-evoked Ca²⁺ entry in cells expressing IP₃R1-shRNA with IP₃R1, IP₃R1^RQ or IP₃R1^RQ/KQ. Traces show mean ± s.e.m, for 90–150 cells from three experiments. (F) Summary results (mean ± s.e.m.) show peak increases in [Ca²⁺]_c (Δ[Ca²⁺]_c) evoked by Ca²⁺ restoration. Different letter codes (panels D, F) indicate significantly different values, p<0.001, for multiple comparison one-way ANOVA and pair-wise Tukey’s test and for two genotype comparison Mann Whitney U-test. See also Figure 3—figure supplement 1—source data 1. Source data in Figure 3—source data 1.

Figure 3—figure supplement 1.

Attenuated SOCE in SH-SY5Y cells lacking IP₃R1 is rescued by expression of pore-dead IP₃R1 with a functional IP₃-binding site.

(A) WB with IP₃R1 antibody showing expression of IP₃R1 and IP₃R1^DA in SH-SY5Y cells expressing IP₃R1-shRNA. (B) Summary (mean ± s.e.m, n=3) shows IP₃R1 expression normalized to actin. p<0.001, one-way ANOVA with pair-wise Tukey’s test. Here, and in most subsequent panels, different letters indicate groups that are statistically different, with the test defined for each panel. (C) Ca²⁺ signals evoked by carbachol (CCh 3 μM) in SH-SY5Y cells expressing IP₃R1-shRNA alone or with IP₃R1, IP₃R1^DA, IP₃R1^RQ/KQ or IP₃R1^1-604. Traces show mean ± s.e.m. from three experiments. (D) Summary results (mean ± s.e.m) show peak changes in [Ca²⁺]_c evoked by CCh (Δ[Ca²⁺]_c). p<0.001, one-way ANOVA with pair-wise Tukey’s test. (E) Resting [Ca²⁺]_c (left) and thapsigargin (Tg)-evoked Ca²⁺ release (1 µM, Δ[Ca²⁺]_c) (right) in cells treated as indicated. p<0.001, one-way ANOVA with pair-wise Tukey’s test. (F) WB showing Orai1 expression in cells expressing IP₃R1-shRNA and IP₃R1^DA, and then treated with NS or Orai1-siRNA. (G) Summary results (normalized to GAPDH expression, mean ± s.d, n=3). ^**p<0.01, Student’s t-test with unequal variances. (H) Resting [Ca²⁺]_c (left) and Tg-evoked Ca²⁺ release (right) in cells expressing IP₃R1-shRNA and IP₃R1^DA, and then treated with NS or Orai1-siRNA. p<0.05, Mann-Whitney U-test. (I) WB for IP₃R1 in cells expressing IP₃R1-shRNA alone or with IP₃R1 or IP₃R1^RQ/KQ. Results typical of two independent experiments. (J) Resting [Ca²⁺]_c (left) and Ca²⁺ release evoked by Tg (right) in cells expressing IP₃R1-shRNA alone or with the indicated IP₃R1. Mean ± s.e.m., n=3 experiments. p<0.001, one-way ANOVA with pair-wise Tukey’s test. (K) Changes in [Ca²⁺]_c evoked by Tg (10 µM) in Ca²⁺-free HBSS and then after restoration of extracellular Ca²⁺ (2 mM) in cells expressing IP₃R1-shRNA alone or with IP₃R1 or IP₃R1^1-604. Mean ± s.e.m. from three experiments with >100 cells. (L) Summary results show peak increases in [Ca²⁺]_c evoked by Ca²⁺ restoration in the indicated cells. p<0.001, one-way ANOVA with pair-wise Tukey’s test. (M) SH-SY5Y cells expressing NS-shRNA were stimulated with the indicated concentrations of CPA in Ca²⁺-free HBSS to partially deplete ER Ca²⁺ stores and then with ionomycin (Iono, 1 µM) to release all remaining Ca²⁺. Results show mean ± s.e.m. for >30 cells from three experiments. (N) Summary results (mean ± s.e.m.) show Δ[Ca²⁺]_c evoked by CPA or ionomycin. p<0.001, one-way ANOVA with pair-wise Tukey’s test. The results confirm that the lower concentrations of CPA partially deplete the ER of Ca²⁺. (O) Summary results (mean ± s.e.m, 80–100 cells from three experiments) show the peak increases in [Ca²⁺]_c (Δ[Ca²⁺]_c) after adding Tg (store Ca²⁺ release) and after restoring extracellular Ca²⁺ (SOCE) with or without YM-254890 treatment. Different letter codes indicate significantly different values within the Ca²⁺ release or SOCE groups, p<0.001, one-way ANOVA and pair-wise Tukey’s test. Source data in Figure 3—figure supplement 1—source data 1.

It has been reported that SOCE is unaffected by loss of IP₃R in non-neuronal cells (Ma et al., 2001; Chakraborty et al., 2016). Consistent with these observations, the SOCE evoked in HEK cells by stores emptied fully by treatment with thapsigargin was unaffected by expression of IP₃R1 shRNA (Figure 2—figure supplement 3A–3C) or by knockout of all three IP₃R subtypes using CRISPR/cas9 (HEK-TKO cells; Figure 2—figure supplement 3D and E). The association of STIM1 with Orai1 in wild type HEK cells and HEK TKO cells after thapsigargin-evoked store depletion also appeared identical as tested by a proximity ligation assay (PLA, described further in Figure 5 and Figure 2—figure supplement 3F). Neuronal and non-neuronal cells may, therefore, differ in the contribution of IP₃R to SOCE. We return to this point later.

Binding of IP₃ to IP₃R without a functional pore stimulates SOCE

IP₃Rs are large tetrameric channels that open when they bind IP₃ and Ca²⁺, but they also associate with many other proteins (Prole and Taylor, 2019), and many IP₃Rs within cells appear not to release Ca²⁺ (Thillaiappan et al., 2019). A point mutation (D2550A, IP₃R1^D/A) within the IP₃R1 pore prevents it from conducting Ca²⁺ (Dellis et al., 2008). As expected, expression of IP₃R1^D/A in cells lacking IP₃R1 failed to rescue carbachol-evoked Ca²⁺ release, but it unexpectedly restored thapsigargin-evoked SOCE (Figure 3B-D; and Figure 3—figure supplement 1). We confirmed that rescue of thapsigargin-evoked Ca²⁺ entry by this pore-dead IP₃R was mediated by a conventional SOCE pathway by demonstrating that it was substantially attenuated by siRNA-mediated knockdown of Orai1 (Figure 3C and D and Figure 3—figure supplement 1F–H).

Activation of IP₃Rs is initiated by IP₃ binding to the N-terminal IP₃-binding core of each IP₃R subunit (Prole and Taylor, 2019). Mutation of two conserved phosphate-coordinating residues in the α-domain of the binding core (R568Q and K569Q of IP₃R1, IP₃R1^RQ/KQ) almost abolishes IP₃ binding (Yoshikawa et al., 1996; Iwai et al., 2007), while mutation of a single residue (R568Q, IP₃R1^RQ) reduces the IP₃ affinity by ~10-fold (Dellis et al., 2008). Expression of rat IP₃R1^RQ/KQ rescued neither carbachol-evoked Ca²⁺ release nor thapsigargin-evoked SOCE in cells lacking IP₃R1 (Figure 3E and F and Figure 3—figure supplement 1C and I). However, expression of IP₃R1^RQ substantially rescued thapsigargin-evoked SOCE (Figure 3E and F and Figure 3—figure supplement 1J). Expression of an N-terminal fragment of rat IP₃R (IP₃R1^1-604), to which IP₃ binds normally (Iwai et al., 2007), failed to rescue thapsigargin-evoked SOCE (Figure 3—figure supplement 1K and L). These results establish that a functional IP₃-binding site within a full-length IP₃R is required for IP₃Rs to facilitate thapsigargin-evoked SOCE. Hence in cells with empty Ca²⁺ stores, IP₃ binding, but not pore-opening, is required for regulation of SOCE by IP₃Rs. In cells stimulated only with thapsigargin and expressing IP₃Rs with deficient IP₃ binding, basal levels of IP₃ are probably insufficient to meet this need.

We further examined the need for IP₃ by partially depleting the ER of Ca²⁺ using cyclopiazonic acid (CPA), a reversible inhibitor of SERCA, to allow submaximal activation of SOCE (Figure 3—figure supplement 1M and N). Under these conditions, addition of carbachol in Ca²⁺-free HBSS to SH-SY5Y cells expressing IP₃R1-shRNA caused a small increase in [Ca²⁺]_c (Figure 4A–C). In the same cells expressing IP₃R1^DA, the carbachol-evoked Ca²⁺ release was indistinguishable from that observed in cells without IP₃R^DA (Figure 4B and C), indicating that the small response was entirely mediated by residual native IP₃R1 and/or IP₃R3. Hence, the experiment allows carbachol to stimulate IP₃ production in cells expressing IP₃R1^DA without causing additional Ca²⁺ release. The key result is that in cells expressing IP₃R1^DA, carbachol substantially increased SOCE from sub maximal to higher levels (Figure 4AC). Moreover, addition of carbachol to control shRNA expressing SH-SY5Y cells with maximal store depletion (thapsigargin, Tg, 2 µM) resulted in a small increase in SOCE (Figure 4—figure supplement 1A). We conclude that in neuronal cells IP₃, through IP₃Rs, regulates coupling of empty stores to SOCE. This is the first example of an IP₃R mediating a response to IP₃ that does not require the pore of the channel.

Figure 4.

Receptor-regulated IP₃ production stimulates SOCE in cells with empty Ca²⁺ stores and expressing pore-dead IP₃R.

(A, B) SH-SY5Y cells expressing IP₃R1-shRNA alone (A) or with IP₃R1^DA (B) were treated with a low concentration of CPA (2 µM) in Ca²⁺-free HBSS to partially deplete the ER of Ca²⁺ and sub-maximally activate SOCE (see Figure 3—figure supplement 1M–N). Carbachol (CCh, 1 µM) was then added to stimulate IP₃ formation through muscarinic receptors, and extracellular Ca²⁺ (2 mM) was then restored. Traces (mean ± s.e.m of 68–130 cells from three experiments) show responses with and without the CCh addition. (C) Summary results show the peak increases in [Ca²⁺]_c (Δ[Ca²⁺]_c) after addition of CCh (CCh-induced Ca²⁺ release) and then after restoring extracellular Ca²⁺ (SOCE). (D–F) SH-SY5Y cells wild type (WT) (D) and expressing NS-shRNA (E) or IP₃R1-shRNA (F) were treated with YM-254890 (YM, 1 µM, 5 min) in Ca²⁺-free HBSS to inhibit Gαq and then with thapsigargin (Tg, 1 µM) before restoring extracellular Ca²⁺ (2 mM). Traces show mean ± s.e.m of ~120 cells from three experiments. (G–I) Similar analyses of HEK cells. Summary results (mean ± s.e.m, 50–100 cells from three experiments) are shown in (I). Different letter codes (panels C and I) indicate significantly different values within the store Ca²⁺ release or SOCE groups, p<0.001, one-way ANOVA and pair-wise Tukey’s test. See also Figure 4—figure supplement 1. Source data in Figure 4—source data 1.

Figure 4—figure supplement 1.

Effects of generating IP₃ and inhibiting Gq on Ca²⁺ signals and STIM1-Orai1 interactions in SH-SY5Y and HEK cells.

(A) SOCE is enhanced in SH-SY5Y cells expressing control-shRNA after ER-Ca² depletion (thapsigargin, 2 µM) followed by carbachol (CCh, 1 µM) stimulated IP₃ formation. Traces (mean ± s.e.m of ~270 cells each from five experiments) show responses with and without the CCh addition. Summary results show the peak increases in [Ca²⁺]_c (Δ[Ca²⁺]_c) for SOCE after restoring extracellular Ca²⁺. Different letters indicate significantly different values of p<0.001 by Mann- Whitney U-test. (B) PLA analyses of interactions between STIM1 and Orai1 in wild type (WT) SH-SY5Y cells untreated (-YM) or treated (+YM, 1 μm) with Gq inhibitor YM-254890. Confocal images are shown for control cells (-Tg) or after treatment with thapsigargin (+Tg, 1 µM) in Ca²⁺-free HBSS. PLA reaction product is red, and nuclei are stained with DAPI (blue). Scale bars, 5 µm. Summary results show the surface area of the PLA spots for ~20 cells from two independent analyses. Individual values, median (bar) and 25th and 75th percentiles (box). **p<0.01, Student’s t-test with unequal variances. (C) HEK cells expressing NS shRNA and treated with the Gq inhibitor, YM-254890 (YM, 1 μM, 5 min) were stimulated with carbachol (CCh, 100 μM). Traces show mean ± s.e.m. from three experiments with 30–40 cells. The results confirm that treatment with YM-254890 effectively uncouples CCh from IP₃-evoked Ca²⁺ signals. (D) From results shown in Figure 4G and H, rates of thapsigargin-evoked Ca²⁺ entry were determined. Summary shows mean ± s.e.m, from 100 to 120 cells. p<0.001, Mann-Whitney U-test. (E–F) Changes in [Ca²⁺]_c evoked by thapsigargin (Tg, 1 μM) in Ca²⁺-free HBSS and then after restoration of extracellular Ca²⁺ (2 mM) in WT (C) and TKO (D) HEK cells after treatment with YM-254890 (YM, 1 μM, 5 min). Traces show mean ± s.e.m. from three experiments with 100–120 cells. (G) Summary results show peak increase in [Ca²⁺]_c (Δ[Ca²⁺]_c) evoked by addition of thapsigargin and then after restoring extracellular Ca²⁺ (SOCE). Mean ± s.e.m. Different letter codes indicate significantly different values, p<0.001, Mann- Whitney U-test. Source data in Figure 4—figure supplement 1—source data 1.

G-protein-coupled receptors are linked to IP₃ formation through the G-protein Gq, which stimulates phospholipase C β (PLC β). We used YM-254890 to inhibit Gq (Kostenis et al., 2020; Patt et al., 2021). As expected, addition of YM-254890 to wild type (WT) or NS-shRNA transfected SH-SY5Y cells abolished the Ca²⁺ signals evoked by carbachol (Figure 4—figure supplement 1C), but it also reduced the maximal amplitude and rate of thapsigargin-evoked SOCE (Figure 4D–E and Figure 3—figure supplement 1O). YM-254890 had no effect on the residual thapsigargin-evoked SOCE in SH-SY5Y cells expressing IP₃R1-shRNA (Figure 4F and Figure 3—figure supplement 1O). The latter result is important because it demonstrates that the inhibition of SOCE in cells with functional IP₃Rs is not an off-target effect causing a direct inhibition of SOCE.

In wild type or HEK-TKO (lacking all three IP₃Rs) cells, YM-254890 had no effect on thapsigargin-evoked SOCE, but it did inhibit SOCE in HEK cells lacking only IP₃R1 (Figure 4G–I and Figure 4—figure supplement 1D–G). These results suggest that in HEK cells, which normally express all three IP₃R subtypes (Mataragka and Taylor, 2018), neither loss of IP₃R1 nor inhibition of Gαq is sufficient on its own to inhibit thapsigargin-evoked SOCE, but when combined there is a synergistic loss of SOCE.

IP₃Rs promote interaction of STIM1 with Orai1 within MCS

Our evidence that IP₃Rs intercept coupling between empty stores and SOCE (Figure 3A) prompted us to investigate the coupling of STIM1 with Orai1 across the narrow junctions between ER and PM (Carrasco and Meyer, 2011). An in situ proximity ligation assay (PLA) is well suited to analyzing this interaction because it provides a signal when two immunolabeled proteins are within ~40 nm of each other (Derangère et al., 2016), a distance comparable to the dimensions of the junctions wherein STIM1 and Orai1 interact (Poteser et al., 2016). We confirmed the specificity of the PLA and demonstrated that it reports increased association of STIM1 with Orai1 after treating SH-SY5Y cells with thapsigargin by measuring the surface area of PLA spots (Figure 5A and Figure 5—figure supplement 1A–F) and not the number, because the latter did not change upon store-depletion (Figure 5—figure supplement 1O). In cells expressing IP₃R1-shRNA, thapsigargin had no effect on the STIM1-Orai1 interaction reported by PLA, but the interaction was rescued by expression of IP₃R1 or IP₃R1^DA. There was no rescue with IP₃R1^RQ/KQ (Figure 5B–E). WT SH-SY5Y cells that were depleted of basal IP₃ by treatment with the Gq inhibitor YM-254890, showed significantly reduced STIM1-Orai1 interaction after thapsigargin-evoked depletion of Ca²⁺ stores (Figure 4—figure supplement 1B). The results with PLA exactly mirror those from functional analyses (Figures 1—4), suggesting that IP₃ binding to IP₃R enhances SOCE by facilitating interaction of STIM1 with Orai1 (Figure 3A).

Figure 5.

IP₃Rs promote interaction of STIM1 with Orai1.

(A–E) PLA analyses of interactions between STIM1 and Orai1 in SH-SY5Y cells expressing NS-shRNA (A) or IP₃R1-shRNA alone (B) or with IP₃R1 (C), IP₃R1^DA (D) or IP₃R1^RQ/KQ (E). Confocal images are shown for control cells or after treatment with thapsigargin (Tg, 1 µM) in Ca²⁺-free HBSS. PLA reaction product is red, and nuclei are stained with DAPI (blue). Scale bars, 5 µm. Summary results show the surface area of the PLA spots for 8–10 cells from two independent analyses. Individual values, median (bar) and 25th and 75th percentiles (box). ^***p < 0.001, Student’s t-test with unequal variances. See also Figure 5—figure supplement 1. Source data in Figure 5—source data 1.

Figure 5—figure supplement 1.

Validation of PLA measurements of Orai1-STIM1 interactions.

(A) PLA using antibodies to Orai1 and STIM1 to establish whether they are associated. Complementary oligonucleotides conjugated to a secondary antibody (2nd) targeting their respective primary antibodies (1st) hybridize when they are close to each other, allowing rolling circle amplification (RCA) and production of a red fluorescent product. The latter can be quantified from the surface area of the fluorescent spots or their intensity. We obtained indistinguishable results with both methods of quantification. We therefore show only results obtained from surface-area measurements. (B–D) Confocal images from PLA assays of SH-SY5Y cells expressing NS-shRNA performed with no primary antibody (B), or with primary antibody for only STIM1 (C) or only Orai1 (D). Scale bars, 5 µm. (E, F) Confocal images of SH-SY5Y cells expressing NS-shRNA with (F) or without thapsigargin treatment (E) (Tg, 1 µM, in Ca²⁺-free HBSS). Cells are stained with DAPI and immunostained for Orai1 or STIM1. Scale bars, 5 µm. (G–N) Similar analyses of cells expressing IP₃R1-shRNA alone (G, H), or with IP₃R1 (I, J), IP₃R1^DA (K, L) or IP₃R1^RQ/KQ (M, N). Results (E–N) are typical of two experiments. (O) Number of PLA spots per cell in the indicated genotypes with (5 min) or without (0 min) thapsigargin treatment (Tg, 1 µM in Ca²⁺-free HBSS) in the indicated genotypes. Different letter indicates significantly different values, p<0.001 one-way ANOVA and pair-wise Tukey’s test. The PLA results are shown in Figure 5. Source data in Figure 5—figure supplement 1—source data 1.

In independent experiments we tested the effect of fluorescent-tagged and ectopically expressed ligand bound (wild type rat IP₃R1) and mutant (rat IP₃R1^RQ/KQ; Figure 6—figure supplement 1A) IP₃R1 on SOCE dependent STIM1 oligomerization and translocation to ER-PM junctions in SH-SY5Y cells (Figure 6). In agreement with PLA data (Figure 5), ER-PM translocation of mVenus-STIM1 upon SOCE induction was reduced significantly in mCherry-IP₃R1^RQ/KQ expressing cells compared to mCherry-IP₃R1 expressing SH-SY5Y cells (Figure 6A, B, D and E and Figure 6—figure supplement 1B and D). SOCE also brought about a small increase in the surface intensity of over-expressed wild type mCherry-IP₃R1 and mCherry-IP₃R1^RQ/KQ in the regions where we observe formation of SOCE-dependent STIM1 puncta (Figure 6A–C and Figure 6—figure supplement 1C and E). Moreover, the intensity of mCherry-IP₃R1^RQ/KQ appeared marginally lower than mCherry-IP₃R1 (Figure 6—figure supplement 1C and E). The significance, if any, of these small changes in surface localization between over-expressed mCherry-IP₃R1 and mCherry-IP₃R1^RQ/KQ upon SOCE induction, need further verification by alternate methods.

Figure 6.

Ligand-bound IP₃R1 supports SOCE-dependent STIM1 movement to ER-PM contact sites.

(A–B) Representative TIRF images of mVenus STIM1 co-transfected with either wild type mcherry-rat IP₃R1 (A) or IP₃R1^RQ/KQ (ligand binding mutant), (B) in wild type SH-SY5Y cells before (Basal) and after CPA induced store depletion (CPA treated) at 4 min and 7 min. On the right are shown RGB profile plots of STIM1 (green) and IP₃R1, wild type or mutant (magenta) corresponding to the rectangular selections (Cell 1 and Cell 2). Scale bar is 10 µm.(C–D) Changes in number of IP₃R1 (C) and STIM1 (D) puncta upon CPA-induced store depletion over a period of 10 min in the indicated genotypes. Mean ± s.e.m from seven cells from n=6 independent experiments. (E) Summary result (mean ± s.e.m) showing the change in the number of maximum STIM1 puncta formed after CPA-induced store depletion in the indicated genotypes. Mean ± s.e.m. of seven cells from n=6 independent experiments. Different letters indicate significant differences, p<0.05, Mann-Whitney U-test. See also Figure 6—figure supplement 1. Source data in Figure 6—source data 1.

Figure 6—figure supplement 1.

Validation of fluorescent-tagged rat IP₃R1 constructs.

(A) Western blot image showing the expression of IP₃R1 in the indicated genotypes Results with these constructs are shown in Figure 6. (B–C) Changes in the intensity of STIM1 and IP₃R1 puncta (>2 pixel) upon CPA-induced store depletion over a period of 10 min in the indicated genotypes. Intensity changes were measured within ROIs drawn in each cell, where new STIM1 puncta formed visibly upon CPA-induced store depletion. Mean ± s.e.m from seven cells from n=6 independent experiments. (D) Summary result (mean ± s.e.m) showing the change in intensity of STIM1 after CPA-induced store depletion in the indicated genotypes. Mean ± s.e.m. of seven cells from n=6 independent experiments. Different letters indicate significant differences, p<0.05, Mann-Whitney U-test. (E) Summary result (mean ± s.e.m) showing the change in the intensity of IP₃R1 after CPA-induced store depletion in the indicated genotypes. Mean ± s.e.m. of seven cells from n=6 independent experiments. Different letters indicate significant differences, p<0.05, Student’s t-test with unequal variances. Source data in Figure 6—figure supplement 1—source data 1.

Extended synaptotagmins (E-Syts) are ER proteins that stabilize ER-PM junctions including STIM1-Orai1 MCS (Maléth et al., 2014; Kang et al., 2019; Woo et al., 2020). Over-expression of E-Syt1 in SH-SY5Y cells expressing IP₃R1-shRNA rescued thapsigargin-evoked Ca²⁺ entry without affecting resting [Ca²⁺]_c or thapsigargin-evoked Ca²⁺ release (Figure 7A–C). The rescued Ca²⁺ entry is likely to be mediated by conventional SOCE because it was substantially attenuated by knockdown of STIM1 (Figure 7D–F). Over-expression of E-Syt1 had no effect on SOCE in cells with unperturbed IP₃Rs (Figure 7G–I). These results suggest that attenuated SOCE after loss of IP₃Rs can be restored by exaggerating ER-PM MCS.

Figure 7.

Extended synaptotagmins rescue SOCE in cells lacking IP₃R1.

(A) SH-SY5Y cells expressing IP₃R1-shRNA alone or with E-Syt1 were stimulated with Tg (1 µM) in Ca²⁺-free HBSS before restoring extracellular Ca²⁺ (2 mM). Traces show mean ± s.e.m, for 20–80 cells from three experiments. (B) Summary results show Δ[Ca²⁺]_c evoked by restoring Ca²⁺ (SOCE). Mean ± s.e.m, ^***p < 0.001, Mann-Whitney U- test. (C) Summary results (mean ± s.e.m, n=20–80 cells) show resting [Ca²⁺]_c (left) and the peak Ca²⁺ signals (Δ[Ca²⁺]_c) evoked by thapsigargin (Tg, 1 µM) in Ca²⁺-free HBSS for SH-SY5Y cells expressing IP₃R1-shRNA alone or with human E-Syt1. (D) Cells over-expressing E-Syt1 and treated with IP₃R1-shRNA in combination with either NS or STIM1 siRNA were stimulated with Tg (1 µM) in Ca²⁺-free HBSS before restoration of extracellular Ca²⁺ (2 mM). Mean ± s.e.m. from three experiments with 30–40 cells. (E, F) Summary results (mean ± s.e.m, n=30–40 cells) show SOCE evoked by Tg (E), resting [Ca²⁺]_c and the Tg-evoked Ca²⁺ release from intracellular stores (F). ^***p< 0.001, Mann-Whitney U- test. (G) Similar analyses of cells expressing NS shRNA alone or with human E-Syt1 and then treated with Tg (1 µM) in Ca²⁺-free HBSS before restoring extracellular Ca²⁺ (2 mM). Mean ± s.e.m. from three experiments with 115–135 cells. (H, I) Summary results (mean ± s.e.m, n=115–135 cells) show resting [Ca²⁺]_c (H) and Δ[Ca²⁺]_c evoked by Tg (store release) or Ca²⁺ restoration (SOCE) (I). No significant difference, Mann Whitney U-test. Source data in Figure 7—source data 1.

Discussion

After identification of STIM1 and Orai1 as core components of SOCE (Prakriya and Lewis, 2015; Thillaiappan et al., 2019), the sole role of IP₃Rs within the SOCE pathway was assumed to be the release of ER Ca²⁺ that triggers STIM1 activation. The assumption is consistent with evidence that thapsigargin-evoked SOCE can occur in avian (Sugawara et al., 1997; Ma et al., 2002; Chakraborty et al., 2016) and mammalian cells without IP₃Rs (Prakriya and Lewis, 2001). Although SOCE in mammalian HEK cells was unaffected by loss of IP₃Rs in our study (Figure 2—figure supplement 3), it was modestly reduced in other studies of mammalian cells (Bartok et al., 2019; Yue et al., 2020). However, additional complexity is suggested by evidence that SOCE may be reduced in cells without IP₃Rs (Chakraborty et al., 2016; Bartok et al., 2019; Yue et al., 2020), by observations implicating phospholipase C in SOCE regulation (Rosado et al., 2000; Broad et al., 2001), by evidence that SOCE responds differently to IP₃Rs activated by different synthetic ligands (Parekh et al., 2002) and by some, albeit conflicting reports (Woodard et al., 2010; Santoso et al., 2011; Béliveau et al., 2014; Sampieri et al., 2018; Ahmad et al., 2022), that IP₃Rs may interact with STIM and/or Orai (Woodard et al., 2010; Santoso et al., 2011; Béliveau et al., 2014; Sampieri et al., 2018).

We identified two roles for IP₃Rs in controlling endogenous SOCE in human neurons. As widely reported, IP₃Rs activate STIM1 by releasing Ca²⁺ from the ER, but they also, and independent of their ability to release Ca²⁺, enhance interactions between active STIM1 and Orai1 (Figure 8). The second role for IP₃Rs can be supplanted by over-expressing other components of the SOCE complex, notably STIM1 or ESyt1 (Figure 2K–M and Figure 7A and B). It is intriguing that STIM1 (Carrasco and Meyer, 2011; Lewis, 2020), ESyt1 (Giordano et al., 2013) and perhaps IP₃Rs (through the IP₃-binding core) interact with phosphatidylinositol 4,5-bisphosphate (PIP₂), which is dynamically associated with SOCE-MCS (Kang et al., 2019). We suggest that the extent to which IP₃Rs tune SOCE in different cells is probably determined by the strength of Gq signaling, the proximity of IP₃Rs to nanodomains of PLC signaling and endogenous interactions between STIM1 and Orai1. The latter is likely to depend on the relative expression of STIM1 and Orai1 (Woo et al., 2020), the STIM isoforms expressed, expression of proteins that stabilize STIM1-Orai1 interactions (Darbellay et al., 2011; Rana et al., 2015; Rosado et al., 2015; Knapp et al., 2022), and the size and number of the MCS where STIM1 and Orai1 interact (Kang et al., 2019). The multifarious contributors to SOCE suggest that cells may differ in whether they express “spare capacity”. In neuronal cells, loss of IP₃ (Figure 4D) or of the dominant IP₃R isoform (IP₃R1-shRNA; Figures 1 and 2) is sufficient to unveil the contribution of IP₃R to SOCE, whereas HEK cells require loss of both IP₃ and IP₃R1 to unveil the contribution (Figure 4H and I). The persistence of SOCE in cells devoid of IP₃Rs (Figure 2—figure supplement 3D and E; Prakriya and Lewis, 2001; Ma et al., 2002) possibly arises from adaptive changes within the SOCE pathway. This does not detract from our conclusion that under physiological conditions, where receptors through IP₃ initiate SOCE, IP₃Rs actively regulate SOCE.

Figure 8.

Dual regulation of SOCE by IP₃Rs.

(A) SOCE is activated when loss of Ca²⁺ from the ER, usually mediated by opening of IP₃Rs when they bind IP₃, causes STIM to unfurl cytosolic domains (2). The exposed cytosolic domains of STIM1 reach across a narrow gap between the ER and PM at a MCS to interact with PIP₂ and Orai1 in the PM. Binding of STIM1 to Orai1 causes pore opening, and SOCE then occurs through the open Orai1 channel. We show that IP₃Rs when they bind IP₃ also facilitate interactions between Orai1 and STIM, perhaps by stabilizing the MCS (1). Receptors that stimulate IP₃ formation thereby promote both activation of STIM (by emptying Ca²⁺ stores) and independently promote interaction of active STIM1 with Orai1. (B) Other mechanisms, including ryanodine receptors (RyR), can also release Ca²⁺ from the ER. We suggest that convergent regulation of SOCE by IP₃R with bound IP₃ allows receptors that stimulate IP₃ formation to selectively control SOCE.

The IP₃Rs that initiate Ca²⁺ signals reside in ER immediately beneath the PM and alongside, but not within, the MCS where STIM1 accumulates after store depletion (Thillaiappan et al., 2017; Figure 6A and B). In migrating cells too, IP₃Rs and STIM1 remain separated as they redistribute to the leading edge (Okeke et al., 2016). Furthermore, there is evidence that neither STIM1 nor STIM2 co-immmunoprecipitate with IP₃R1 (Ahmad et al., 2022). We suggest, and consistent with evidence that SOCE in cells without IP₃Rs can be restored by over-expressing E-Syt1 (Figure 7A–C), that ligand-bound IP₃Rs facilitate SOCE either by stabilizing the MCS wherein STIM1 and Orai1 interact, or by indirectly supporting STIM1 movement towards the MCS, rather than by directly regulating either protein. Stabilization of the MCS is analogous with similar structural roles for IP₃Rs in maintaining MCS between ER and mitochondria (Bartok et al., 2019) or lysosomes (Atakpa et al., 2018; Figure 8). Alternately, our observation that SOCE-dependent STIM1 movement to the MCS is reduced in presence of IP₃R1^RQ/KQ (Figure 6 and Figure 6—figure supplement 1), suggests that ligand-bound IP₃R1s could help in STIM1 mobilization to the MCS. The mechanism(s) by which ligand bound IP₃R1s might stabilize the MCS or stimulate STIM1 movement to the MCS remain to be elucidated by methods that can directly assay the MCS such as electron microscopy.

Since both contributions of IP₃Rs to SOCE require IP₃ binding (Figure 3E and F), each is ultimately controlled by receptors that stimulate IP₃ formation (Figure 4B and C). Convergent regulation by IP₃Rs at two steps in the SOCE pathway may ensure that receptor-regulated PLC activity provides the most effective stimulus for SOCE; more effective, for example, than ryanodine receptors, which are also expressed in neurons (Figure 8B). By opening IP₃Rs parked alongside SOCE MCS (Thillaiappan et al., 2017; Ahmad et al., 2022), IP₃ selectively releases Ca²⁺ from ER that is optimally placed to stimulate SOCE, and by facilitating Orai1-STIM1 interactions IP₃ reinforces this local activation of SOCE (Figure 8A and B).

We conclude that IP₃-regulated IP₃Rs regulate SOCE by mediating Ca²⁺ release from the ER, thereby activating STIM1 and/or STIM2 (Ahmad et al., 2022) and, independent of their ability to release Ca²⁺, IP₃Rs facilitate the interactions between STIM and Orai that activate SOCE. Dual regulation of SOCE by IP₃ and IP₃Rs allows robust control by cell-surface receptors and may reinforce local stimulation of Ca²⁺ entry.

Materials and methods

Culture of human neural precursor cells

Human neural precursor cells (hNPCS) were derived from a human embryonic stem cell (hESC) line, H9/WA09 (RRID: CVCL_9773), using a protocol that inhibits dual SMAD signaling and stimulates Wnt signaling (Reinhardt et al., 2013) as described previously (Gopurappilly et al., 2018, 2019). hNPCs were grown as adherent dispersed cells on growth factor-reduced Matrigel (0.5%, Corning, Cat#356230) in hNPC maintenance medium (NMM) at 37 °C in humidified air with 5% CO₂. NMM comprised a 1:1 mixture of Dulbecco’s Modified Eagle Medium with Nutrient Mixture F-12 (DMEM/F-12, Invitrogen, Cat#10565018) and Neurobasal medium (ThermoFisher, Cat#21103049), supplemented with GlutaMAX (0.5 x, Thermo Fisher, Cat#35050061), N2 (1:200, Thermo Fisher, 17502048), B27 without vitamin A (1:100, Thermo Fisher, Cat#12587010), Antibiotic-Antimycotic (Thermo Fisher, Cat#15240112), CHIR99021 (3 μM, STEMCELL Technologies, Cat#72052), purmorphamine (0.5 mM, STEMCELL Technologies, Cat#72202), and ascorbic acid (150 μM, Sigma, Cat#A92902). Doubling time was ~24 hr. Cells were passaged every 4–5 days by treatment with StemPro Accutase (Thermo Fisher, Cat#A1110501), stored in liquid nitrogen, and thawed as required. Cells were confirmed to be mycoplasma-free by monthly screening (MycoAlert, Lonza, Cat#LT07-318). hNPCs between passages 16 and 19 were used.

All experiments performed with hESC lines were approved by the Institutional Committee for Stem Cell Research, registered under the National Apex Committee for Stem Cell Research and Therapy, Indian Council of Medical Research, Ministry of Health, New Delhi.

Stable knockdown of IP₃R1

An UltramiR lentiviral inducible shRNA-mir based on the shERWOOD algorithm (Auyeung et al., 2013; Knott et al., 2014) was used to inhibit IP₃R1 expression. The all-in-one pZIP vector, which allows puromycin-selection and doxycycline-induced expression of both shRNA-mir and Zs-Green for visualization, was from TransOMIC Technologies (Huntsville, AL). Lentiviral pZIP transfer vectors encoding non-silencing shRNA (NS, NT#3-TTGGATGGGAAGTTCACCCCG) or IP₃R1-targeting shRNA (ULTRA3316782- TTTCTTGATCACTTCCACCAG) were packaged as lentiviral particles using packaging (pCMV- dR8.2 dpvr, Addgene, plasmid #8455) and envelope vectors (pCMV-VSV-G, Addgene, plasmid #8454) by transfection of HEK293T cells (referred as HEK, ATCC, Cat# CRL-3216). Viral particles were collected and processed and hNPCs (passage 9) or SH-SY5Y cells were transduced (multiplicity of infection, MOI = 10) using Lipofectamine LTX with PLUS reagent (Thermo Fisher, Cat#15338100). Cells were maintained in media containing doxycycline (2 μg/ml, Sigma, Cat# D3072) to induce shRNA expression, and puromycin to select transduced cells (1 μg/ml for hNPCs; 3 μg/ml for SH-SY5Y cells; Sigma, Cat# P9620). Cells were passaged 4–5 times after lentiviral transduction to select for stable expression of shRNAs.

Derivation of neurons from hNPCs

Neurons were differentiated from hNPCs stably transduced with shRNA. hNPCs were seeded at 50–60% confluence in NMM on coverslips coated with poly-d-lysine (0.2 mg/ml, Sigma, Cat#P7280). After 1–2 days, the medium was replaced with neuronal differentiation medium, which comprised a 1:1 mixture of DMEM/F-12 with Neurobasal supplemented with B27 (1:100), N2 (1:200), GlutaMAX (0.5 x) and Antibiotic-Antimycotic solution. Medium was replaced on alternate days. Neurons were used after 15–20 days.

Culture and transfection of SH-SY5Y cells

SH-SY5Y cells (ATCC, USA, Cat# CRL-2266) were grown on culture dishes in DMEM/F-12 with 10% fetal bovine serum (Sigma, Cat# F4135) at 37°C in humidified air with 5% CO₂. Cells were passaged every 3–4 days using TrypLE Express (ThermoFisher, Cat# 12605036) and confirmed to be free of mycoplasma. Cells expressing shRNA were transiently transfected using TransIT-LT1 reagent (Mirus, Cat# MIR-2300) in Opti-MEM (ThermoFisher, Cat# 31985062). Plasmids (250 ng) and/or siRNA (200 ng) in transfection reagent (1 µg/2.5 µl) were added to cells grown to 50% confluence on glass coverslips attached to an imaging dish. Cells were used after 48 hr. The siRNAs used were to human Orai1 (100 nM, Dharmacon, Cat# L-014998-00-0005) or non-silencing (NS, Dharmacon, Cat# D-495 001810-10-05), to human STIM1 (Santa Cruz Biotechnology, Cat# sc-76589) or NS (Santa Cruz Biotechnology, Cat# sc-37007). The expression plasmids were IP₃R1 (rat type 1 IP₃R1 in pcDNA3.2/V5DEST vector) (Dellis et al., 2008), rat IP₃R1^DA (D2550 replaced by A in pcDNA3.2 vector) (Dellis et al., 2008), rat IP₃R1^RQ (R568 replaced by Q of type 1 IP₃R in pCDNA3.2/V5DEST vector) (Dellis et al., 2008), rat IP₃R1^RQ/KQ (R568 and K569 replaced by Q of type 1 IP₃R in pCDNA3.2/V5DEST vector), rat IP₃R1^1-604 (residues 1–604 of IP₃R with N-terminal GST tag in pCDNA3.2/V5DEST vector; Dellis et al., 2008), rat IP₃R3 (rat type 3 IP₃R in pcDNA3.2/V5DEST vector; Saleem et al., 2013), human mCherry-STIM1 (N terminal mCherry tagged human STIM1 in pENTR1a vector; Nunes-Hasler et al., 2017) and human extended synaptotagmin 1 (E-Syt1), a kind gift from Dr S. Muallem, NIDCR, USA (Maléth et al., 2014).

CRISPR/Cas9 and Cas9n editing of SH-SY5Y cells

To allow either CRISPR/Cas9 or Cas9n-mediated disruption of IP₃R1 expression, we used a published method to clone gRNAs into the backbone vector (pSpCas9n(BB)–2A-Puro PX462 V2.0, Addgene, Cat#62987; Ran et al., 2013). Forward and reverse sgRNA oligonucleotides (100 µM) were annealed and ligated using T4 DNA ligase by incubation (10 µl, 37 °C, 30 min) before slow cooling to 20 °C. Plasmids encoding Cas9n were digested with BbsI-HF (37 °C, 12 hr), gel-purified (NucleoSpin Gel and PCR Clean-up kit from Takara) and the purified fragment was stored at –20 °C. A mixture (final volume 20 µl) of gRNA duplex (1 µl, 0.5 µM), digested px459 (for IKO null) or pX462 vector (for IKO) (30 ng), 10× T4 DNA ligase buffer (2 µl) and T4 DNA ligase (1 µl) was incubated (20 °C, 1 hr). After transformation of DH5-α competent E. coli with the ligation mixture, plasmids encoding Cas9 or Cas9n and the sgRNAs were extracted, and the coding sequences were confirmed (Ran et al., 2013). The plasmid (2 µg) was then transfected into SH-SY5Y cells (50–60% confluent) in a six-well plate using TransIT LT-1 reagent (Mirus Bio, Cat# MIR-2300). After 48 hr, puromycin (3 µg/ml, 72 hr) was added to kill non-transfected cells. IKO colonies were propagated and screened for Ca²⁺ signals evoked by carbachol and for the presence of the IP₃R gene by genomic DNA PCR and droplet digital PCR using primers close to the region targeted by the gRNAs (Miotke et al., 2014). Three independently derived IKO lines, each with one residual IP₃R1 gene, were used for analyses of Ca²⁺ signaling (see Figure 2—figure supplement 1N-Q). For one of the cell lines (IKO 2), disruption of one copy of the IP₃R1 gene was confirmed by genomic PCR, droplet digital PCR and western blotting (see Figure 2—figure supplement 1K-M). For the IKO null line, single-cell selection was done in a 96-well plate setup followed by screening for carbachol-evoked Ca²⁺ signals from multiple clones. A single clone was selected (Figure 2—figure supplement 1H) and a western blot performed to confirm absence of IP₃R1 expression (Figure 2—figure supplement 1F). All the oligonucleotide sequences are described in Supplementary file 1.

Plasmid construction

Mutagenesis and all DNA modifications were carried out using Q5 Hot Start high-fidelity 2 X Master Mix (New England BioLabs, Cat# M0494L) using the recommendations of the manufacturer. Primers used in this study (details given in Supplementary file 1) were synthesized by Integrated DNA Technologies (IDT). Mutations in the Ligand binding domain (R568Q and K569Q) of IP₃R1 were generated on the rat mCherry-IP₃R1 cDNA in pDNA3.1 Mutations in all the constructs were confirmed by sequencing.

Ca²⁺ imaging

Methods for single-cell Ca²⁺ imaging were described previously (Gopurappilly et al., 2019). Briefly, cells grown as a monolayer (~70% confluence) on homemade coverslip-bottomed dishes were washed and loaded with Fura 2 by incubation with Fura 2 AM (4 μM, 45 min, 37 °C, Thermo Fisher, Cat# F1221), washed and imaged at room temperature in HEPES-buffered saline solution (HBSS). HBSS comprised: 20 mM HEPES, 137 mM NaCl, 5 mM KCl, 2 mM MgCl₂, 2 mM CaCl₂, 10 mM glucose, pH 7.3. CaCl₂ was omitted from Ca²⁺-free HBSS. Treatments with carbachol (CCh, Sigma, Cat# C4382), thapsigargin (Tg, ThermoFisher, Cat# 7458), cyclopiazonic acid (CPA, Sigma Cat# C1530) or high-K⁺ HBSS (HBSS supplemented with 75 mM KCl) are described in legends.

Responses were recorded at 2 s intervals using an Olympus IX81-ZDC2 Focus Drift-Compensating Inverted Microscope with 60×oil immersion objective (numerical aperture, NA = 1.35) with excitation at 340 nm and 380 nm. Emitted light (505 nm) was collected with an Andor iXON 897E EMCCD camera and AndoriQ 2.4.2 imaging software (RRID: SCR_014461). Maximal (R_max) and minimal (R_min) fluorescence ratios were determined by addition of ionomycin (10 μM, Sigma, Cat# 407953) in HBSS containing 10 mM CaCl₂ or by addition of Ca²⁺-free HBSS containing BAPTA (10 mM, Sigma, Cat# 196418) and Triton X100 (0.1%). Background-corrected fluorescence recorded from regions of interest (ROI) drawn to include an entire cell was used to determine mean fluorescence ratios (R = F₃₄₀/F₃₈₀) (ImageJ), and calibrated to [Ca²⁺]_c from Grynkiewicz et al., 1985:$[C{a}^{2+}{]}_c=K_D.F_{380}^{min}/F_{380}^{max}.(R-R_{min})/(R_{max}-R)$

where, K_D = 225 nM (Forostyak et al., 2013).

Western blots

Proteins were isolated in RIPA buffer (Sigma, Cat# R0278) with protease inhibitor cocktail (Sigma, Cat# P8340) or, for WB of Orai1, in medium containing 150 mM NaCl, 50 mM Tris, 1% Triton-X-100, 0.1% SDS and protease inhibitor cocktail. After 30 min on ice with intermittent shaking, samples were collected by centrifugation (11,000×g, 20 min) and their protein content was determined (Thermo Pierce BCA Protein Assay kit, ThermoFisher, Cat# 23225). Proteins (~30 µg/lane) were separated on 8% SDS-PAGE gels for IP₃R or 10% SDS-PAGE gels for STIM1 and Orai1, and transferred to a Protran 0.45 μm nitrocellulose membrane (Merck, Cat# GE10600003) using a TransBlot semi-dry transfer system (BioRad, Cat# 1703940). Membranes were blocked by incubation (1 hr, 20 °C) in TBST containing skimmed milk or bovine serum albumin (5%, Sigma, Cat# A9418). TBST (Tris-buffered saline with Tween) comprised: 137 mM NaCl, 20 mM Tris, 0.1% Tween-20, pH 7.5. Membranes were incubated with primary antibody in TBST (16 hr, 4 °C), washed with TBST (3 ×10 min), incubated (1 hr, 20 °C) in TBST containing HRP-conjugated secondary antibody (1:3000 anti-mouse, Cell Signaling Technology Cat# 7076 S; or 1:5000 anti-rabbit, ThermoScientific Cat# 32260). After 3 washes, HRP was detected using Pierce ECL Western Blotting Substrate (ThermoFisher, Cat# 32106) and quantified using ImageQuant LAS 4000 (GE Healthcare) and Image J. The primary antibodies used were to: IP₃R1 (1:1000, ThermoFisher, Cat# PA1-901, RRID: AB_2129984); β-actin (1:5000, BD Biosciences, Cat# 612656, RRID: AB_2289199); STIM1 (1:1000, Cell Signaling Technology, Cat# 5668 S, RRID: AB_10828699); Orai1 (1:500, ProSci, Cat# PM-5205, RRID: AB_10941192); IP₃R2 (1:1000, custom made by Pocono Rabbit Farm and Laboratory; Mataragka and Taylor, 2018); and IP₃R3 (1:500, BD Biosciences, Cat# 610313, RRID: AB_397705).

Immunocytochemistry

After appropriate treatments, cells on a coverslip-bottomed plate were washed twice with cold PBS, fixed in PBS with paraformaldehyde (4%, 20 °C, 20 min), washed (3×5 min) with PBS containing Triton-X100 (0.1%, PBST) and blocked by incubation (1 hr, 20 °C) in PBST containing goat serum (5%). After incubation with primary antibody in PBST (16 hr, 4 °C) and washing with PBST (3×5 min), cells were incubated (1 hr, 20 °C) with secondary antibody in PBST containing goat serum, washed (3×5 min), stained (10 min, 20 °C) with DAPI (1 µg/ml in PBS; Sigma, Cat# D9542) and washed (5 min, PBST). Cells were then covered with glycerol (60% v/v) and imaged using an Olympus FV300 confocal laser scanning microscope with 20×or 60×oil-immersion objectives. Fluorescence was analyzed using ImageJ. The primary antibodies used were to: PAX6 (1:500, Abcam, Cat# ab195045, RRID: AB_2750924); Nestin (1:500, Abcam, Cat# 92391, RRID: AB_10561437); Ki67 (1:250, Abcam, Cat# ab16667, RRID: AB_302459); SOX1 (1:1000, Abcam, Cat# ab87775, RRID: AB_2616563); Tuj1 (βIII Tubulin 1:1000, Promega, Cat# G712, RRID: AB_430874); NeuN (1:300, Abcam, Cat# ab177487, RRID: AB_2532109); Doublecortin (1:500, Abcam, Cat# 18723, RRID: AB_732011); MAP2 (1:200, Abcam, Cat# ab32454, RRID: AB_776174); STIM1 (1:1000, Cell Signaling Technology, Cat# 5668 S, RRID: AB_10828699); and Orai1 (1:500, ProSci, Cat# PM-5205, RRID: AB_10941192).

Proximity ligation Assay

The Duolink In Situ Red Starter Mouse/Rabbit kit was from Sigma (#Cat DUO92101) and used according to the manufacturer’s protocol with primary antibodies to Orai1 (mouse 1:500) and STIM1 (rabbit 1:1000). Cells (~30% confluent) were treated with thapsigargin (1 μM, 5 min) in Ca²⁺-free HBSS before fixation, permeabilization, and incubation with primary antibodies (16 hr, 4 °C) and the PLA reactants. Red fluorescent PLA signals were imaged using an Olympus FV300 confocal laser scanning microscope, with excitation at 561 nm, and a 60×oil-immersion objective. Quantitative analysis of the intensity and surface area of PLA spots used the ‘Analyze particle’ plugin of Fiji. Results are shown for 8–10 cells from two biological replicates of each genotype. Number of PLA spots in all genotypes and conditions were counted manually.

Detection of STIM1 and IP₃R1 puncta using TIRF microscopy

SHSY5Y cells were cultured on 15 mm glass coverslips coated with poly-D-lysine (100 μg/ml) in a 35 mm dish for 24 h. Cells were co-transfected with 500 ng of mCherry rIP₃R1 and 200 ng mVenus STIM1 plasmids using TransIT-LT1 transfection reagent in Opti-MEM. Following 48 hr of transfection and prior to imaging, cells were washed with imaging buffer (10 mM HEPES, 1.26 mM Ca²⁺, 137 mM NaCl, 4.7 mM KCl, 5.5 mM glucose, 1 mM Na₂HPO₄, 0.56 mM MgCl₂, at pH 7.4). The coverslips were mounted in a chamber and imaged using an Olympus IX81 inverted total internal reflection fluorescence microscope (TIRFM) equipped with oil-immersion PLAPO OTIRFM 60×objective lens/1.45 numerical aperture and Hamamatsu ORCA-Fusion CMOS camera. Olympus CellSens Dimensions 2.3 (Build 189987) software was used for imaging. The angle of the excitation beam was adjusted to achieve TIRF with a penetration depth of ∼130 nm. Images were captured from a final field of 65 µm × 65 µm (300×300 pixels, one pixel = 216 nm, binning 2×2). Cells positive for both mCherry rIP₃R1 and mVenus STIM1 were identified using 561 nm and 488 nm lasers, respectively. The cells were incubated in zero calcium buffer (10 mM HEPES, 1 mM EGTA, 137 mM NaCl, 4.7 mM KCl, 5.5 mM glucose, 1 mM Na2HPO4, 0.56 mM MgCl2, at pH 7.4) for 2 min followed by addition of 30 µM CPA in zero calcium buffer. IP₃R1 and STIM1 puncta prior to CPA addition and after CPA addition were captured at 1 min intervals. Raw images were filtered for background correction and same setting was used across all samples. Regions where fresh STIM1 puncta (2–10 pixels) appeared post-CPA treatment at 10 mins were marked and subsequently IP₃R1 puncta (2–10 pixels) were captured from the same region. Change in the intensity of either STIM1 or IP₃R1 puncta was calculated from puncta of >2 pixel by deducting the basal intensity at 0 min from the maximum intensity after CPA treatment using ImageJ ROI based mean grey value measurement. Particle analysis and RGB profile plot were done using ImageJ.

Statistical analyses

All experiments were performed without blinding or prior power analyses. Independent biological replicates are reported as the number of experiments (n), with the number of cells contributing to each experiment indicated in legends. The limited availability of materials for PLA restricted the number of independent replicates (n) to 2 (each with 8–10 cells). Most plots show means ± s.e.m. (or s.d.). Box plots show 25th and 75th percentiles, median and mean (see legends). Where parametric analyses were justified by a Normality test, we used Student’s t-test with unequal variances for two-way comparisons and ANOVA followed by pair-wise Tukey’s test for multiple comparisons. Non-parametric analyses used the Mann-Whitney U-test. Statistical significance is shown by ^***p < 0.001, ^**p < 0.01, ^*p < 0.05, or by letter codes wherein different letters indicate significantly different values (p<0.001, details in legends). All analyses used Origin 8.5 software.

Details of the plasmids and recombinant DNAs are given in Supplementary file 1.

Resource availability

Lead contact

All requests for resources and reagents should be directed to the lead contact, Dr. Gaiti Hasan ([email protected]).

Materials availability

Constructs and cell lines are available upon request. MTA required for cell lines.