Synergistic effects of novel penicillin-binding protein 1A amino acid substitutions contribute to high-level amoxicillin resistance of Helicobacter pylori

Abstract

ABSTRACT

The growing resistance to amoxicillin (AMX)—one of the main antibiotics used in Helicobacter pylori eradication therapy—is an increasing health concern. Several mutations of penicillin-binding protein 1A (PBP1A) are suspected of causing AMX resistance; however, only a limited set of these mutations have been experimentally explored. This study aimed to investigate four PBP1A mutations (i.e., T558S, N562H, T593A, and G595S) carried by strain KIN76, a high-level AMX-resistant clinical H. pylori isolate with an AMX minimal inhibition concentration (MIC) of 2 µg/mL. We transformed a recipient strain 26695 with the DNA containing one to four mutation allele combinations of the pbp1 gene from strain KIN76. Transformants were subjected to genomic exploration and antimicrobial susceptibility testing. The resistance was transformable, and the presence of two to four PBP1A mutations (T558S and N562H, or T593A and G595S), rather than separate single mutations, was necessary to synergistically increase the AMX MIC up to 16-fold compared with the wild-type (WT) strain 26695. An AMX binding assay of PBP1A was performed using these strains, and binding was visualized by chasing Bocillin, a fluorescent penicillin analog. This revealed that all four-mutation allele-transformed strains exhibited decreased affinity to AMX on PBP1A than the WT. Protein structure modeling indicated that functional modifications occur as a result of these amino acid substitutions. This study highlights a new synergistic AMX resistance mechanism and establishes new markers of AMX resistance in H. pylori.

IMPORTANCE

The development of resistance to antibiotics, including amoxicillin, is hampering the eradication of Helicobacter pylori infection. The identification of mechanisms driving this resistance is crucial for the development of new therapeutic strategies. We have demonstrated in vitro the synergistic role of novel mutations in the pbp1 gene of H. pylori that is suspected to drive amoxicillin resistance. Also deepening our understanding of amoxicillin resistance mechanisms, this study establishes new molecular markers of amoxicillin resistance that may be useful in molecular-based antibiotic susceptibility testing approaches for clinical practice or epidemiologic investigations.

INTRODUCTION

Helicobacter pylori is a Gram-negative bacterium that infects the stomach of approximately 50% of humans (1). Unless treated, this infection persists throughout life and inevitably leads to chronic active gastritis, which is associated with severe gastrointestinal complications including peptic ulcer disease and gastric cancer (2, 3). Despite the understanding that treatment of this infection can heal or prevent such diseases, curing H. pylori has proven difficult in some cases because of the limited efficacy of drugs under the harsh physiological conditions of the stomach and the exceptional adaptive abilities of this bacterium (4, 5). H. pylori has developed growing resistance to available antibiotics, causing its listing by the World Health Organization as one of the top 20 priority infections that pose the greatest threat to human health due to their drug resistance (6). Therefore, understanding the mechanistic and biological attributes that drive this antimicrobial resistance is crucial to the development of new strategies for overcoming bacterial resistance (7, 8). However, antimicrobial resistance-associated genetic determinants of H. pylori have mainly been detected by statistically comparing putative mutations in antibiotic-susceptible and antibiotic-resistant clinical isolates (7, 9). Additional experimental evidence is, therefore, required to establish the biological relevance of resistance attributes for H. pylori.

Amoxicillin (AMX) is a major β-lactam antibiotic that is used in H. pylori eradication therapy, with widely acknowledged efficacy (10). Unlike most bacterial species, AMX resistance (AMX-R) in H. pylori has long been considered a rare phenomenon, which explains the limited efforts in exploring its underlying mechanisms (11). Mutations, in particular those altering genes encoding penicillin-binding proteins (PBPs), have been suspected of being the cause of AMX-R, but evidence of their biological relevance is still lacking (7, 9). A recent increase in the epidemiological and clinical significance of this resistance has refocused attention on the need for additional research in this area. Substantial AMX-R has been reported in several regions of the world (12, 13), and clinical strains displaying a minimal inhibitory concentration (MIC) of AMX above 1 µg/mL (which was historically rare) are increasing in prevalence (14, 15). We previously reported a clinical H. pylori strain from the Democratic Republic of the Congo exhibiting high-level AMX-R. Following whole genome sequencing (WGS), we identified a set of novel PBP1A amino acid substitutions, including T558S and N562H, in addition to the previously reported but not experimentally established T593A and G595S substitutions (16). These substitutions were suspected of contributing to the AMX-R. In the current study, we aimed to experimentally explore the biological relevance of these mutations in a standard laboratory H. pylori strain 26695 by site-specific mutagenesis (SSM), followed by an AMX binding assay and prediction of the PBP1A 3D structure.

RESULTS

Synergistic effects of cumulated substitutions in PBP1A mediate amoxicillin resistance

The H. pylori strain KIN76 isolated from a patient in the Democratic Republic of the Congo with unusually high resistance to AMX presented four mutations associated with AMX resistance within the pbp1 gene (i.e., T593A, G595S, T558S, and N562H) (16). Using Cefinase paper discs, we did not detect any β-lactamase activity for the DNA donor strain KIN76, or strain 26695, which was used as the recipient in the following transformation experiments. The MICs of AMX for strains KIN76 and 26695 were 2 and 0.0625 µg/mL, respectively. The pbp1 gene of strain KIN76 has 87 nucleotide mismatches compared to the pbp1 of strain 26695. Most of these are synonymous variations, except for 19 amino acid variations that could potentially be associated with AMX-R, including the four alleles mentioned above.

We used the corresponding ~400-bp DNA fragment in the pbp1 gene, amplified from the genomic DNA of strain KIN76 directly by polymerase chain reaction (PCR) or constructed in two steps by fusion PCR, to perform the SSM in the recipient AMX-susceptible (AMX^S) strain 26695 (Fig. 1; Table 1). These DNA fragments carried single (Fr1 with T558S, Fr2 with N562H, Fr6 with T593A, and Fr7 with G595S), dual (Fr3 with T558S/N562H, Fr4 with T593A/G595S), or quadruple (Fr5 with T558S/N562H/T593A/G595S) mutations. Additionally, a PCR product (Fr0) with no mutations obtained from the AMX^S strain was used as a control. After the transformation of strain 26695 using Fr0, Fr1, Fr2, Fr6, or Fr7 PCR products, no AMX-resistant (AMX^R) colonies were detected on AMX plates with a concentration of 0.25 µg/mL or more. By contrast, transformation with dual-mutation carrying fragments Fr3 and Fr4 resulted in AMX^R 26695_Fr3 and 26695_Fr4 colonies on 0.25 but not 0.5 µg/mL AMX-containing plates, with an average transformation efficiency of 2.7 × 10³ and 3.5 × 10³ transformants/µg DNA in three independent experiments, respectively. The AMX MIC of colonies selected from AMX-containing plates ranged from 0.25 to 0.5 µg/mL (Table 2). Similarly, AMX^R 26695_Fr5 quadruple-mutation transformant strains were selected on both 0.25 and 0.5 µg/mL AMX-containing plates, with a transformation efficiency of 5.4 × 10³ and 3.6 × 10³ transformants/µg, respectively (Table 2). The AMX MIC of colonies 26695_Fr5 (with four mutations on PBP1A) ranged from 0.25 to 1 µg/mL, showing higher AMX MICs than colonies 26695_Fr3 and 26695_Fr4 (with two mutations) (Table 3). The resistance phenotype remained consistent after storing transformant and wild-type (WT) strains at −80°C for 2 weeks and after passing through culture on agar plates without AMX.

Fig 1

Amplicon construction. The pbp1 DNA fragments carrying different rearrangements of mutations were amplified by PCR from genomic DNA of clinical isolate KIN76 (A). Amplicons Fr1, Fr2, Fr6, and Fr7 carrying a single mutation were additionally constructed by fusion PCR of the single-stranded DNA fragments FrT558S-a/FrT558S-b, Fr2a/Frb2, FrT593A-a/FrT593A-b, and G595S-a/G595S-b, respectively. A DNA fragment (Fr0) without any mutation was also prepared from 26695 genomic DNA and used as a negative control. The PCR fragments before fusion PCR (B). All the final KIN76 amplicons prepared before transformation into strain 26695 (C). All the PCR fragments were checked in 1.8% agarose S gel electrophoresis.

Primer nameSequence (5′–3′)Binding siteForward F1 CGAAGTCAAAACTTTCACGCCCATTGAAAC 1,521…1,550 F2 TTGACGCTTGGTTCATTGGCTTTACC 1,688…1,713 F3 ATTACGGCACCATGCTCAAACCC 1,466…1,488 F4 CTTTAAGCGACATGGGGTTTAAAAACCT 1,358…1,385 N562H.F ATTGCCGGTAAAACCGGGACTTCTAACAACCATATTGACG 1,654…1,693 T558S.F AACCGGGAGTTCTAACAACAATATTGACGCTTGGTTCATT 1,665…1,704 T593A.F2 GGAGCGGCAGGAGGCGTTGTGAGCGCGCCTGT 1,771…1,802 G595S.F2 ACCTATTGGCAAAGGAGCGACAGGAAGCGTTGTGAGCGC 1,758…1,796Reverse R1 CGCTCCTTTGCCAATAGGTGTGT 1,754…1,776 R2 GATGGAATTGGGAGTTGAATAGTAGGGGAT 1,900…1,929 R4 GCGAAGGGTTGCATAAAATGTCTTTAGACG 2,075…2,104 N562H.R CGTCAATATGGTTGTTAGAAGTCCCGGTTTTACCGGCAAT 1,654…1,693 T558S.R AATGAACCAAGCGTCAATATTGTTGTTAGAACTCCCGGTT 1,665…1,704 T593A.R2 CGCTCACAACGCCTCCTGCCGCTCCTTTGCCAATAGGT 1,758…1,795 G595S.R2 GCGCTCACAACGCTTCCTGTCGCTCCTTTGCCAATAGGT 1,758…1,795