1. Introduction
Traumatic brain injury (TBI) is the leading cause of traumatic death worldwide and a major public health problem in Europe, associated with high mortality and morbidity rates and a significant socioeconomic burden [1,2,3]. Worldwide, the annual incidence of head injury is estimated to be between 27 and 69 million new cases, with road traffic accidents being the leading cause [4].
The pathophysiology of TBI is complex and involves a cascade of events that occur at the time of injury and continue for days or weeks after injury [5]. In particular, TBI can be attributed to two different, partly overlapping, pathogenetic mechanisms, which can be divided into primary and secondary brain damage [6,7,8]. Primary brain damage results from direct mechanical damage to brain tissue, which may be caused by acceleration or deceleration forces, rotational forces, or direct impact. The resulting damage may include contusions, lacerations, and diffuse axonal damage [9,10]. Secondary brain damage follows the activation of biochemical cascades of various types (such as free radical generation, neuroinflammatory response, and cell death) that occur after the initial injury and may lead to further brain tissue damage, including hypoxia, ischaemia, inflammation, and oxidative stress [11,12].
The study of TBI is of great forensic relevance. The diagnosis of brain injury may be difficult in some cases or may leave diagnostic doubts, especially in mild trauma with insignificant pathological brain changes or in cases where instrumental tests are negative [13]. Even in the forensic setting, the diagnosis of brain injury may be difficult, as in cases of diffuse axonal injury (DAI) in which macroscopic examination does not reveal obvious brain changes [14,15].
Therefore, in recent years, an important area of research has been directed towards the study of new biomarkers, such as micro-RNAs (miRNAs), which can assist clinicians in the diagnosis, staging, and prognostic evaluation of TBI, as well as forensic pathologists in the assessment of TBI and in the estimation of additional relevant data, such as survival time [16]. They may also represent valuable therapeutic targets for the treatment of TBI [17,18,19,20,21].
In this sense, micro-RNAs (miRNAs) represent potential and promising biomarkers applicable in clinical diagnostics and forensic science. miRNAs are small non-coding RNA molecules involved in the pathophysiology of many diseases and are crucial for neurodevelopment and brain function [22,23]. By regulating gene activity, miRNAs control cellular processes for neuronal damage and repair: differentiation, proliferation, apoptosis, and metabolism. Altered miRNA levels have been reported in several central nervous system (CNS) disease processes [24], including traumatic brain injury [25]. miRNAs have also been proposed as therapeutic targets for TBI, so several studies have been conducted on murine models in order to evaluate their use [20,21]. For example, the use of inhibitors (antagomiR) or mimetics (agomiR) of miRNAs has been tested as an innovative therapeutic strategy to reduce brain damage and improve clinical outcomes in patients with TBI [26,27].
Compared to known TBI protein biomarkers, miRNAs may be preferable due to their specific characteristics [28]. First, their small size is related to greater stability even in highly degraded samples, such as cadaveric samples. Secondly, their high tissue-specific expression gives them greater sensitivity to the pathology under investigation. Furthermore, due to their action at the post-transcriptional level, miRNAs can be detected in the early stages of a disease, long before the effects of downstream protein expression are observed [29]. For these reasons, several papers have been produced to evaluate the different miRNA expression profiles in subjects with TBI compared to controls [30].
The majority of TBI studies have been conducted on cell lines or biological fluid samples such as plasma, serum, cerebrospinal fluid (CSF), and saliva [31,32,33,34,35]. Only a minority of studies have been conducted on tissue samples (brain tissue), mainly from mouse models subjected to controlled cortical impact [36,37,38,39]. In the currently available postmortem studies of TBI, the expression levels of specific miRNAs on formalin-fixed, paraffin-embedded (FFPE) brain tissue samples have been investigated. In these studies, several miRNAs have been identified as dysregulated in brain injury, such as miR-16, miR-21, miR-92, miR-124, miR-138, and miR-144 [40,41]. Numerous other miRNAs have been implicated in the pathophysiology of TBI and are being investigated for their potential role in both clinical–therapeutic and forensic settings. Despite this evidence, further studies are currently required to validate their use.
This study concerns the profile expression of a set of miRNAs, preliminarily selected based on the literature review, evaluated on formalin-fixed, paraffin-embedded (FFPE) brain tissue samples from subjects who died of TBI, stratified based on the survival time and the severity of the injury.
The aim of this study is to investigate the expression profiles (downregulation and upregulation) of a set of miRNAs in subjects deceased as a result of TBI in order to assess, verify, and define the role of non-coding RNA molecules in different pathophysiological mechanisms of brain injury. This study also aims to correlate the detected expression profiles with survival time, defined as the time elapsed between the traumatic event and death, and with the severity of the trauma.
2. Results
2.1. Study Group Characteristics
Forty subjects deceased as a result of traumatic brain injury (TBI) were selected: thirty-one (77.50%) were male and nine (22.50%) were female. The mean age of the subjects included in the study group was 45.05 ± 19.17 SD (median 53 years, age min 12, max 65). In particular, 13 subjects were younger than 35 years old, and 27 were older than 35 years old.
The most common cause of death in the study group was major trauma (55%). The injury mechanisms leading to the head injury were a road traffic accident in twenty-five cases (62.5%), a fall from standing in seven cases (17.5%), a fall from a height in four cases (10%), a train accident in three cases (7.5%), and blunt trauma in one case (2.5%). Road traffic accidents were thus the most common mechanism of head injury, accounting for 42.5% of the study group. The most common type of brain injury was subarachnoid haemorrhage (SAH), which was present in 24 of the subjects (60%). In all selected cases, the postmortem interval (PMI) was less than 6 days, with a mean of 80.275 ± 19.599 h (median 76, PMI min 52, PMI max 123). In addition, of the selected subjects, six had undergone surgical treatment by decompressive craniotomy (Table 1).
2.2. Control Group Characteristics
Ten subjects who died of natural causes, with a cardiovascular genesis, were selected according to the inclusion and exclusion criteria (Table 2). Six (60%) were male and four (40%) were female, and the mean age of the subjects included in the study group was 53.2 ± 10.97 SD (median 55.5 years, age min 24, max 65).
2.3. Subgroup Characteristics
The study group was selected by defining four subgroups consisting of cases distributed according to survival time (Figure 1). Specifically, the four subgroups consisted of twelve cases of fatal TBI (no survival), nine cases of TBI with short survival (survival < 1 day), ten cases of TBI with middle survival (survival >1 and <7 days), and nine cases of TBI with long survival (survival > 7 days).
The study group was stratified in parallel according to the severity of the trauma, which was assessed using criteria derived from the Abbreviated Injury Scale (AIS) score (Figure 2). Specifically, three subgroups were defined, consisting of eight cases of mild–moderate TBI (AIS 1-2), ten cases of severe TBI (AIS 3-4), and twenty-two cases of critical–fatal TBI (AIS 5-6).
2.4. miRNA Expression Profiles in Cases and Controls
Complex data analysis revealed expression levels with statistically significant differences—between cases and controls—for hsa-miR-16-5p, hsa-miR-21-5p, hsa-miR-23a-3p, hsa-miR-130a-3p, and hsa-miR-155-5p.
In particular, overall higher expression levels were detected in cases compared to controls (upregulation) for miR-16-5p, miR-21-5p, miR-130a-3p, and miR-155-5p (Figure 3). On the other hand, lower expression levels were detected in cases compared to controls (downregulation) for miR-23a-3p (Figure 3).
In contrast, no significant variations in expression levels between cases and controls were detected for miR-19a-3p.
2.5. Subgroup Analysis: Correlation of Expression Profiles with Survival Time and Severity of Trauma
According to survival time, data analysis showed that miR-21-5p expression levels were approximately three times higher in the subgroup consisting of TBI with short survival (<1 day) than in the subgroups with no survival (fatal) and middle survival (1–7 days). In contrast, miR-21-5p expression levels were under-regulated in the subgroup of TBI with long survival (>7 days).
The analysis of miR-16-5p showed an approximately 6-fold upregulation in the short-survival subgroup (<1 day) and an approximately 4-fold upregulation in the middle-survival (1–7 days) and long-survival (>7 days) subgroups.
The expression levels of miR-130a were significantly higher in TBI cases with short (<1 day) and middle survival (1–7 days) than in TBI cases with no survival (fatal) or long survival (>7 days).
In contrast, there were no statistically significant differences in the expression levels of the remaining miRNAs investigated between the subgroups stratified by survival time.
In relation to the severity of injury, data analysis showed a significantly higher expression of miR-16-5p and miR-21-5p in the critical–fatal TBI subgroup (AIS 5-6) than in the mild-to-moderate TBI (AIS 1-2) and severe TBI (AIS 3-4) subgroups. In contrast, there was no statistically significant variation in the expression levels of the remaining miRNAs investigated between the subgroups stratified by TBI severity (Figure 4).
3. Discussion
The mechanisms of injury described after TBI include neuroinflammation, synaptic dysfunction, protein aggregation, oxidative stress, blood–brain barrier damage, cerebral oedema, and cell death [42]. There are several cell populations involved in the pathophysiology of TBI, including astrocytes, microglia, oligodendrocytes, and endothelial cells, with inflammatory and reactive responses that may contribute to brain damage [43,44]. After TBI, cells of the innate immune system, such as microglia, can rapidly respond to the traumatic event by releasing cytokines and other pro-inflammatory molecules that contribute to the inflammatory response and local brain inflammation [45,46,47]. Cells of the adaptive immune system, such as T lymphocytes and B lymphocytes, may also be involved in the response to TBI through a more specific response that can be activated after significant tissue damage [48,49].
miRNAs represent potential and promising biomarkers of TBI, and several studies have evaluated their expressivity and demonstrated their dysregulation in relation to TBI, suggesting their involvement in pathophysiological mechanisms and their possible use in defining the diagnosis and prognosis of TBI [50,51].
miRNAs act through the mechanism of gene expression regulation by binding to specific target genes, called “target mRNAs”, and regulating their expression at the transcriptional or translational level [52,53]. This affects signalling pathways and cellular processes involving specific target genes regulated by different miRNAs.
The present study identified a panel of miRNAs that may be related to the mechanisms of damage in different brain cell populations, as well as those associated with neuroprotective and neurodegenerative mechanisms. The expression of these miRNAs was evaluated in brain tissue sections taken from subjects deceased as a result of TBI. This was compared with the expression of the same miRNAs in brain tissue sections taken from a control group of subjects deceased as a result of natural causes of cardiovascular origin.
Specifically, the following miRNAs were selected: hsa-miR-16-5p, hsa-miR-19a-3p, hsa-miR-21-5p, hsa-miR-23a-3p, hsa-miR-130a-3p, and hsa-miR-155-5p.
The described role of miR-16 [42,43,54,55] in relation to TBI is complex, depending on the specific context and conditions studied. miR-16 influences specific signalling pathways involved in traumatic brain damage and has been particularly linked to the regulation of several target genes involved in cell proliferation and glial apoptosis, including CDK6 (Cyclin-Dependent Kinase) and BCL-2 (B-cell lymphoma 2). Specifically, miR-16-5p overexpression can induce apoptosis by directly regulating BCL-2, an anti-apoptotic protein that prolongs cell survival by neutralising pro-apoptotic factors. The aberrant downregulation of BCL-2 disrupts mitochondrial membrane integrity, induces the mitochondrial release of pro-apoptotic proteins (e.g., cytochrome C and AIF), and triggers caspase activation and cytoskeletal degradation, leading to apoptosis. Studies conducted on glioma cell lines have shown that miR-16-5p binds directly to the 3′UTR of BCL-2 mRNA and deregulates cellular levels of BCL-2 mRNA and protein. These studies support an inhibitory role of miR-16-5p on glial cell proliferation, as well as its stimulating effects on apoptosis and increased caspase activity. MiR-16 has also been studied in relation to other brain disorders, such as Alzheimer’s disease, which may share some pathological features with TBI. It has been linked to the deposition of β-amyloid (Aβ), whose neurotoxicity is known to be a major cause of neurodegeneration. Additionally, miR-16 has been found to be significantly dysregulated in TBI patients, with significantly higher expression levels, particularly within the first 24 h post-trauma.
MiR-21 [38,46,47,48], one of the most studied miRNAs, is known to be involved in various cellular processes, including inflammation, apoptosis, and cell proliferation, and plays an important role in various pathological conditions, including traumatic brain injuries. In particular, in TBI, miR-21 expression is involved in blood–brain barrier damage, apoptosis, cell proliferation and differentiation, autophagy processes, and oxidative stress. Studies have shown that miR-21 acts at the astrocyte population level (reducing their activation), at the macrophage level (with pro-inflammatory effects by acting on the STAT3 signalling pathway, a protein involved in regulating the inflammatory response and cell activation), on dendritic cells, and on the T-cell line. In particular, miR-21 has been implicated in the regulation of the PTEN/PI3K/AKT pathway, affecting the expression of PTEN, which acts as an inhibitor of the PI3K/AKT pathway involved in cell survival and proliferation. MiR-21 can also influence the regulation of genes and proteins involved in blood–brain barrier permeability, indirectly affecting the inflammatory response and repair capacity. Recent studies have demonstrated high levels of miR-21 expression after TBI, and treatment with antago-miR-21 has been proposed as a potential therapy to reduce blood–brain barrier (BBB) damage [56,57]. A particular over-regulation of miR-21 has also been observed in the serum of patients with severe TBI (sTBI) compared to those with mild TBI (mTBI), at very early times and up to 15 days after the trauma. Furthermore, no increase was found in patients with musculoskeletal injuries without TBI, which is why miR-21 has been considered a potential new biomarker for TBI and a future therapeutic target [58].
MiR-23a [49] has been found to play a suppressive role in neuronal apoptosis and the inflammatory response in murine models of TBI. PTEN has been identified as a potential target gene of miR-23a. Specifically, studies have shown that miR-23a negatively regulates the expression levels of PTEN mRNA in primary cortical neurons, suppressing its expression both in vitro and in vivo. Since PTEN is a negative regulator of the AKT/mTOR pathway, it has been hypothesized that miR-23a plays a protective role in TBI by acting on the PTEN/AKT/mTOR pathway. Studies have shown reduced expression levels of miR-23a in TBI cases compared to controls, and the potential role of agomiR-23a as a therapeutic target has been evaluated.
MiR-130a [50,51], a micro-RNA involved in cellular and pathological processes, appears to play an important role in the context of traumatic brain injury (TBI). Recent studies have suggested that miR-130a may influence various aspects of the brain response to traumatic damage. Some of the target genes of this miRNA in the context of TBI include those involved in the regulation of inflammation, such as tumour necrosis factor alpha (TNF-α) and interleukin-6 (IL-6), as well as genes that regulate cell proliferation and cell death. miR-130a can influence the gene expression of PTEN, Homeobox Hox-A5, and AQP4 (aquaporin 4), leading to apoptosis, BBB damage, and brain oedema. A study conducted to investigate the role of miR-130a in BBB damage found an increase in its expression levels in microvascular endothelial cells and a corresponding increase in BBB permeability and brain oedema. It has been shown that the use of Antagomir-130a, an antagonist of miR-130a, could attenuate brain oedema, reduce BBB permeability, reduce brain lesion volume, and improve neurological function.
MiR-155 [52,53] has been implicated in the regulation of macrophage signalling mediated by Toll-like receptors (TLRs) 3 and 4, as well as interferon (IFN)-γ. This miRNA plays a key role in the modulation of neurotoxicity, macrophage and microglial activation, and in the regulation of the release of inflammatory mediators such as nitric oxide, cytokines, interleukins, and chemokine signalling. Recent studies have shown that experimentally induced traumatic brain injury (TBI) increases miR-155 expression in the damaged cortex and hippocampus [59,60]. Additionally, these injuries induce neuroinflammatory responses mediated by microglial cells, which are associated with neuronal loss and persistent neurological deficits [61,62]. Given the documented pro-inflammatory role of miR-155 in neurodegenerative diseases, its alteration in microglia induced by TBI may contribute to the chronicity of neuroinflammation and related neurodegeneration.
The data from the analyses performed in this study showed significantly different expression levels of miR-16-5p, miR-21-5p, miR-23a-3p, miR-130a-3p, and miR-155-5p between cases and controls (Figure 3). Conversely, no statistically significant differences were found between the study group and the control group for miR-19a-3p (Figure 3).
Therefore, according to the analysis of the data obtained in the present study, it can be argued that the upregulation of miR-16-5p, miR-21-5p, miR-130a-3p, and miR-155-5p confirms the role of these miRNAs with pro-inflammatory, pro-apoptotic, and regulatory effects in signalling pathways involved in cell permeability and blood–brain barrier damage (Figure 5).
The downregulation of miR-23a-3p was consistent with the literature studies highlighting a potential protective role of this miRNA in TBI, confirming its suppressive effect on neuronal cell apoptosis and the inflammatory response (Figure 5).
Regarding the survival time associated with TBI, the significantly higher expression levels of miR-21-5p in the short-survival subgroup compared to the fatal TBI and middle-survival subgroups suggest that miR-21-5p may be associated with a rapid and specific response to severe injury. The approximately six-fold increase in miR-16-5p expression levels in the short-survival group and the approximately four-fold increase in the middle- and long-survival subgroups may indicate a key role of miR-16-5p in the response to TBI and short-term survival. Finally, the significant increase in miR-130a expression levels in TBI cases with short and middle survival suggests that miR-130a may be involved in the initial pathophysiological response following trauma.
In relation to trauma severity, the significant increase in miR-16-5p and miR-21-5p expression levels in the fatal–critical TBI subgroups (AIS 5-6) compared to the mild–moderate TBI (AIS 1-2) and severe TBI (AIS 3-4) subgroups suggests that these miRNAs may be involved in specific responses to severe injuries and trauma severity.
Overall, the results obtained from the data analysis suggest that miR-21-5p, miR-16-5p, and miR-130a may play an important role in the response to TBI and in determining the survival time and trauma severity in TBI patients.
4. Materials and Methods
4.1. Selection of Study Population
This multicentre collaborative study was carried out by the University of Salerno, the Sapienza University of Rome, and the University of Foggia.
The study population was selected from the cases that underwent autopsies on the orders of the Judicial Authority at the Forensic Medicine Departments, in a period between 2019 and 2023. In particular, in all the selected autopsy cases, tissue samples were taken and subsequently fixed in formalin and embedded in paraffin (FFPE) for subsequent histo-pathological examination.
A study population consisting of 40 cases of subjects with TBI-related deaths (study group) and 10 cases of subjects deceased suddenly from non-traumatic causes (control group) was then selected.
The study and control groups were selected based on specific inclusion and exclusion criteria (Table 3).
4.2. Definition of Subgroups
The study group (40 cases) was selected, and 4 subgroups were subsequently defined. Each subgroup consisted of cases distributed on the basis of survival time and divided into fatal TBI, TBI with short survival, TBI with medium survival, and TBI with long survival (Table 4).
The study group (40 cases) was stratified in parallel according to trauma severity. The definition of trauma severity was based on criteria derived from the Abbreviated Injury Scale (AIS) score [63,64], which assesses documented clinical parameters and injuries sustained at the time of trauma (Table 5).
The study group was further characterised on the basis of a number of parameters derived from medical records and/or autopsy and/or histo-pathological findings. For each case, the following parameters were taken into account: age, sex, cause of death, traumatic mechanism of death, type of brain injury found, postmortem interval (PMI), and whether surgical treatment was performed.
4.3. Sample Collection
For each case, a sample of brain tissue taken at autopsy was examined, fixed in formalin, and then embedded in paraffin (FFPE).
A total of 50 formalin-fixed, paraffin-embedded (FFPE) brain tissue samples were then processed, of which 40 belonged to the study group (corresponding for each case to the area of brain tissue most affected by the traumatic injury, selected on the basis of the findings of both macroscopic and microscopic autopsy examinations performed in all cases selected for this study) and 10 belonged to the control group.
4.4. miRNA Selection
The selection of miRNAs was based on a thorough literature review, which identified a panel of miRNAs potentially related to damage mechanisms in different brain cell populations, as well as to mechanisms of neuroprotection and neurodegeneration (Table 6).
Consequently, the following miRNAs were selected: hsa-miR-16-5p, hsa-miR-19a-3p, hsa-miR-21-5p, hsa-miR-23a-3p, hsa-miR-130a-3p, and hsa-miR-155-5p.
4.5. Total RNA Extraction
Four 10 μm thick sections were obtained from each formalin-fixed, paraffin-embedded (FFPE) tissue sample, and total RNA was isolated using the miRNeasy FFPE kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions.
Briefly, the protocol included an initial deparaffinization phase in which 1 mL of xylene and then 1 mL of ethanol were added to the tissue sections. The sample was digested with 240 μL PKD buffer and 10 μL of Proteinase K, incubated at 56 °C for 15 min and then at 80 °C for 15 min. It was then treated with DNase Booster Buffer in an amount equal to one-tenth of the total sample volume (approximately 16 μL) and with 10 μL of DNase stock solution and incubated at room temperature for 15 min. The sample was then treated with 320 μL RBC buffer, and 1120 μL of ethanol was added to the total lysate. Finally, the entire sample was transferred in two steps through the RNeasy MinElute spin column and centrifuged for 15 s at ≥8000× g (≥10,000 rpm). Total RNA was eluted in 17 μL of nuclease-free water. The RNA concentration was measured using a Nanodrop spectrophotometer with 1 μL of isolated RNA. Samples were stored at −80 °C.
4.6. Reverse Transcription and Real-Time PCR Assay of miRNA
For miRNA detection, 10 ng of total RNA, assessed using NanoDrop spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE, USA), was processed using cDNA Synthesis Kit for reverse transcription (RT) of the miRNAs.
Real-time PCR (RT-qPCR) was performed for each miRNA (Table 7), using Taq DNA Polymerase and miRNA Assays Kits. Reverse-transcribed cDNA was diluted at a 1:10 ratio, and a total reaction volume of 20 µL was used and incubated at 95 °C for 20 seconds, 95 °C for 3 s (for 40 cycles), and 60 °C for 30 s (for 40 cycles). Each reaction was performed in duplicate.
For relative quantification, the 2-∆Ct method was applied, using the geometric means of miRNA hsa-miR-92a-3p as housekeeping.
4.7. Statistical Analysis
To achieve reproducibility and statistical significance, analyses were performed in duplicate for cases and controls. For normally distributed variables, a t-test or ANOVA was used. The association of the relationship between the miRNAs studied and the categorical variables was analysed using the Kruskal–Wallis test. A p-value of p < 0.05 was considered statistically significant. The statistical programme IBM SPSS STATISTICS was used for data analysis.
5. Conclusions
The results of this study provide significant evidence for the potential of the miRNAs studied as highly predictive biomarkers in distinguishing TBI cases from controls. These miRNAs could open up new perspectives for the postmortem diagnosis of TBI, offering the possibility of determining survival and severity.
Furthermore, the differential expression of the miRNAs studied according to trauma severity and survival time suggests that these miRNAs may also be valuable therapeutic targets. Indeed, since miRNAs are crucial regulators of many biological processes, including inflammation, apoptosis, and tissue repair, they could be modulated to develop new therapeutic strategies. In this sense, several studies in mouse models have already highlighted the potential role of miRNAs as therapeutic targets in TBI. However, the translation of basic research findings into clinical practice will require further studies, particularly to better understand the safety and efficacy of miRNA modulation in vivo.
In conclusion, the significant predictive power of these miRNAs could revolutionise the approach to the postmortem diagnosis of TBI, greatly improving the ability to identify and assess such injuries. These results suggest that miRNA analysis could become an essential tool in forensic investigations in the future, providing more accurate and detailed information about the nature and extent of TBI. The predictive power in relation to the timing and severity of trauma could ultimately contribute to the definition of the circumstances of death.
Conceptualization, F.C. and A.S.; methodology, A.S.; validation, L.C., V.F. and A.S.; formal analysis, M.P. and F.C.; investigation, F.C. and A.S.; resources, F.C., M.P., M.S., D.M. and A.S.; data curation, F.C.; writing—original draft preparation, F.C. and A.S.; writing—review and editing, V.F. and A.S.; supervision, V.F. and A.S.; project administration, A.S. All authors have read and agreed to the published version of the manuscript.
Ethical review and approval were waived for this study because judicial cases are involved. The processing of the reported personal data was carried out in accordance with the provisions of the Declaration of Helsinki and the requirements for the processing of personal data carried out for scientific research purposes (Auth. Gen. no. 9/2016) of the GPDP—Guarantor for the Protection of Personal Data (adopted with a provision published in the Official Gazette General Series no. 176 of 29 July 2019)—in the case of subjects who are already deceased. The data collected have also been adequately anonymized and processed in accordance with the GDPR—General Data Protection Regulation EU/2016/679—and the Privacy Code (Legislative Decree 30 June 2003, n. 196 and subsequent amendments).
Not applicable.
The data are included in legal cases in Italy, and for this reason, they are not available.
The authors declare no conflicts of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 2. Distribution of study group by severity of trauma, as defined by AIS score parameters.
Enlarge this image.Figure 3. Box plot showing miRNA expression levels analysed in cases and controls: (A) hsa-miR-16-5p, (B) hsa-miR-19a-3p, (C) hsa-miR-21-5p, (D) hsa-miR-23a-3p, (E) hsa-miR-130a-3p, and (F) hsa-miR-155-5p.
Enlarge this image.Figure 4. Clustered heat map showing the differential expression of the 5 miRNAs in the 3 subgroups defined on the basis of survival time (left figure) and on the basis of trauma severity (right figure). The coloured boxes represent the relative expression of the group (measured by Pearson’s distance metric), and the miRNAs are clustered in the heat map using a comprehensive clustering algorithm.
Enlarge this image.Figure 5. Expressivity (up- and downregulation) of the miRNAs examined in this study and their correlation with pathways, pathophysiological effects, and target cell populations.
Study group characteristics.
| Case | Sex | Age | Cause of Death | Injury Mechanism | Brain Injury | PMI | Severity | Survival | Surgery |
|---|---|---|---|---|---|---|---|---|---|
| 1 | M | 57 | Major blunt-fracture trauma | Road traffic accident | SDH, SAH, and cerebral and cerebellar intraparenchymal haemorrhage | 74 h | AIS: 5 | 1 day | No |
| 2 | M | 19 | Major blunt-fracture trauma | Road traffic accident | SAH, cortical haemorrhages, and pontine haemorrhages of Duret | 60 h | AIS: 5 | 3:30 h | Yes |
| 3 | M | 64 | Cardiorespiratory failure due to intracranial hypertension | Fall from standing | SDH acute over chronic | 106 h | AIS: 1 | 16 days | Yes |
| 4 | M | 18 | Major blunt-fracture trauma | Train accident | Temporoparietal skull fracture and SAH | 52 h | AIS: 6 | 0 | No |
| 5 | M | 21 | Major blunt-fracture trauma | Road traffic accident | Anterior and middle skull base fractures, SAH, and cortical haemorrhages | 57 h | AIS: 6 | 0 | No |
| 6 | F | 65 | MODS | Road traffic accident | SDH, SAH, and cerebral laceration–contusive focus | 123 h | AIS: 2 | 1.5 year | No |
| 7 | M | 44 | Major blunt-fracture trauma | Fall from a height | Cerebral and cerebellar SAH and intraparenchymal haemorrhage | 108 h | AIS: 5 | ~2–3 h | No |
| 8 | M | 49 | Major blunt-fracture trauma | Train accident | SAH | 94 h | AIS: 6 | 0 | No |
| 9 | M | 17 | Major blunt-fracture trauma | Road traffic accident | Frontal, sphenoid, and maxillary skull fractures with haemosinus and SAH | 98 h | AIS: 6 | 0 | No |
| 10 | M | 63 | Major blunt-fracture trauma | Road traffic accident | SAH | 54 h | AIS: 3 | ~2–3 h | No |
| 11 | M | 65 | Closed head trauma | Road traffic accident | Closed cranial vault fracture, SDH, SAH, and intraparenchymal haemorrhage | 102 h | AIS: 5 | ~2 days | No |
| 12 | M | 62 | MODS | Road traffic accident | SDH | 75 h | AIS: 2 | 51 days | No |
| 13 | M | 60 | Major blunt-fracture trauma | Road traffic accident | SAH and intraparenchymal cerebral haemorrhages | 105 h | AIS: 3 | ~4 days | No |
| 14 | M | 12 | Closed head trauma | Fall from standing | Closed head trauma of the posterior cranial fossa with intraparenchymal haemorrhage and cerebellar SAH | 68 h | AIS: 6 | 0 | No |
| 15 | M | 34 | Major blunt-fracture trauma | Road traffic accident | Closed head trauma with fractures of the vault and skull base, SDH, cerebral and cerebellar SAH, and cerebral contusions | 77 h | AIS: 6 | 0 | No |
| 16 | F | 20 | Major blunt-fracture trauma | Road traffic accident | SAH and brain contusions | 54 h | AIS: 6 | 0 | No |
| 17 | M | 14 | Major blunt-fracture trauma | Road traffic accident | Splanchnocranium and skull base fractures and SAH | 80 h | AIS: 6 | 0 | No |
| 18 | M | 29 | Major blunt-fracture trauma | Road traffic accident | Maxillary sinus fracture with haemosinus and SAH | 74 h | AIS: 5 | ~9:30 h | No |
| 19 | M | 49 | Major blunt-fracture trauma | Road traffic accident | Closed posterior cranial fossa fracture, SDH, SAH, and cerebral and cerebellar lacerated–contused foci | 77 h | AIS: 3 | ~2 days | Yes |
| 20 | M | 60 | Closed head trauma | Road traffic accident | Fractures of the splanchnocranium and skull base and SDH | 53 h | AIS: 3 | ~2 days | No |
| 21 | F | 59 | Major blunt-fracture trauma | Road traffic accident | Neurocranium fractures, SDH, SAH, and laceration–contusive focus | 115 h | AIS: 3 | ~7 days | Yes |
| 22 | M | 20 | Major blunt-fracture trauma | Train accident | Splanchnocranium and neurocranium fractures, SDH, SAH, and cerebral and cerebellar parenchymal lacerations | 67 h | AIS: 6 | 0 | No |
| 23 | M | 37 | MODS | Road traffic accident | Splanchnocranium and skull base fractures, subdural blood layer, and subarachnoid spread | 92 h | AIS: 2 | ~25 days | No |
| 24 | F | 59 | Cardiorespiratory failure due to intracranial hypertension | Road traffic accident | Occipital fracture, SDH, and SAH | 102 h | AIS: 2 | ~27 days | Yes |
| 25 | M | 41 | Closed head trauma | Blunt trauma | Splanchnocranium and neurocranium fractures, SDH, and cerebral and cerebellar SAH | 73 h | AIS: 6 | 0 | No |
| 26 | M | 62 | Major blunt-fracture trauma | Fall from a height | SAH with tetrahaemoventricle | 56 h | AIS: 6 | 0 | No |
| 27 | M | 21 | Major blunt-fracture trauma | Road traffic accident | Fractures of the splanchnocranium, vault, and skull base, SDH and SAH layers, and contusion–haemorrhagic foci | 88 h | AIS: 4 | ~5 days | No |
| 28 | M | 62 | Closed head trauma | Road traffic accident | Fractures of the vault and skull base, SDH, SAH, and intraparenchymal haemorrhages | 75 h | AIS: 4 | ~3 days | No |
| 29 | M | 65 | Cardiorespiratory failure due to intracranial hypertension | Fall from standing | SDH, SAH, and intraparenchymal contusive foci | 98 h | AIS: 4 | ~6 days | No |
| 30 | F | 64 | Cardiorespiratory failure due to intracranial hypertension | Fall from standing | SDH and SAH | 85 h | AIS: 5 | ~6 days | No |
| 31 | F | 63 | Major blunt-fracture trauma | Road traffic accident | Neurocranium fracture, EDH, SDH, and SAH | 94 h | AIS: 5 | ~14 days | No |
| 32 | M | 58 | Cardiorespiratory failure due to intracranial hypertension | Fall from standing | Cranial vault fracture and cerebral and cerebellar SDH and SAH | 58 h | AIS: 6 | ~1:30 h | No |
| 33 | M | 42 | Cardiorespiratory failure due to intracranial hypertension from cerebral oedema | Fall from standing | Fractured floor of the orbit, flap of SDH, and SAH | 63 h | AIS: 6 | ~2 h | No |
| 34 | M | 63 | Major blunt-fracture trauma | Road traffic accident | Subacute SDH | 94 h | AIS: 2 | ~6 days | No |
| 35 | M | 16 | Major blunt-fracture trauma | Fall from a height | Cerebral and cerebellar SDH and SAH | 62 h | AIS: 5 | ~1 h | No |
| 36 | F | 19 | Major blunt-fracture trauma | Fall from a height | Splanchnocranium and neurocranium fractures and diffuse SAH | 64 h | AIS: 6 | 0 | No |
| 37 | F | 59 | Cardiorespiratory failure due to intracranial hypertension | Road traffic accident | Cranial vault fracture, bilateral SDH, and SAH | 112 h | AIS: 2 | ~11 days | No |
| 38 | F | 65 | Cardiorespiratory failure due to intracranial hypertension | Fall from standing | SDH | 74 h | AIS: 1 | ~6:30 h | No |
| 39 | M | 58 | Cardiorespiratory failure due to intracranial hypertension | Road traffic accident | Neurocranium fractures, bilateral SDH, and bilateral SAH | 78 h | AIS: 4 | ~13 days | No |
| 40 | M | 47 | Cardiorespiratory failure due to intracranial hypertension | Road traffic accident | Neurocranium fractures, bilateral SDH, and bilateral SAH | 70 h | AIS: 4 | ~4 days | Yes |
SDH: subdural haematoma. SAH: subarachnoid haemorrhage. AIS: Abbreviated Injury Scale. GOSE: Glasgow Outcome Scale—Extended. GCS: Glasgow Coma Scale. MODS: Multiple Organ Dysfunction Syndrome. ~: Indicates approximation.
Control group characteristics.
| Case | Sex | Age | Cause of Death |
|---|---|---|---|
| 1 | M | 51 | Sudden cardiac death (SCD) |
| 2 | M | 62 | Acute myocardial infarction (AMI) |
| 3 | F | 65 | Sudden cardiac death (SCD) |
| 4 | F | 55 | Sudden cardiac death (SCD) |
| 5 | F | 59 | Sudden cardiac death (SCD) |
| 6 | M | 53 | Arrhythmic-based acute heart failure secondary to arrhythmogenic cardiomyopathy (ARC) |
| 7 | F | 60 | Arrhythmic-based acute heart failure secondary to arrhythmogenic cardiomyopathy (ARC) |
| 8 | M | 47 | Sudden cardiac death (SCD) |
| 9 | M | 24 | Sudden cardiac death (SCD) |
| 10 | M | 56 | Acute pulmonary embolism (PE) |
Inclusion and exclusion criteria for the study population.
| Inclusion Criteria |
|---|
Study group:
|
Control group:
|
| Exclusion Criteria |
|
Definition of subgroups based on survival time.
| Fatal TBI | Head Injury without Survival |
|---|---|
| Short-survival TBI | Head injury with a survival time of less than 1 day |
| Middle-survival TBI | Head injury with a survival time of between 1 and 7 days |
| Long-survival TBI | Head injury with a survival time of more than 7 days |
Definition of subgroups based on severity of trauma.
| Minor–moderate TBI | AIS 1: light brain injuries with headache, vertigo, no loss of consciousness, light cervical injuries, whiplash, abrasion, and contusion. |
| Severe TBI | AIS 3: concussion with or without skull fracture, more than 15 min unconsciousness without severe neurological damages, closed and shifted or impressed skull fracture without unconsciousness or other injury indications in skull, loss of vision, shifted and/or open face bone fracture with antral or orbital implications, and cervical fracture without damage of spinal cord. |
| Critical–fatal TBI | AIS 5: concussion with or without skull fracture with more than 12 h unconsciousness with haemorrhage in skull and/or critical neurological indications. |
Characteristics of the miRNAs selected for this study.
| miRNA | Protein/Pathway | Described Effects | References |
|---|---|---|---|
| miR-16-5p | BCL-2 | Glial proliferation and apoptosis | Krell et al., 2019 [ |
| miR-19a-3p | AQP4, Cx43 | Oedema and expression of astrocytic aquaporin 4 | Julienne et al., 2018 [ |
| miR-21-5p | PTEN PDCD4/PI3K/AKT/GSK-3β pathway | Blood–brain barrier damage | Pinchi et al., 2018 [ |
| miR-23a-3p | PTEN/AKT/mTOR pathway | Apoptosis | Li et al., 2020 [ |
| miR-130a-3p | PTEN | Apoptosis | Wang et al., 2018 [ |
| miR-155-5p | Macrophage signalling mediated by Toll-like receptors (TLRs) 3 and 4 and interferon (IFN)-γ | Modulation of neurotoxicity | Henry et al., 2019 [ |
Micro-RNA sequences used in PCR.
| miRNA Name | Accession Number | Primer Sequence |
|---|---|---|
| hsa-miR-16-5p | MIMAT0000069 | UAGCAGCACGUAAAUAUUGGCG |
| hsa-miR-19a-3p | MIMAT0000073 | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-21-5p | MIMAT0000076 | UAGCUUAUCAGACUGAUGUUGA |
| hsa-miR-23a-3p | MIMAT0000078 | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-130a-3p | MIMAT0000425 | CAGUGCAAUGUUAAAAGGGCAU |
| hsa-miR-155-5p | MIMAT0000646 | UUAAUGCUAAUCGUGAUAGGGGUU |
References
1. Dewan, M.C.; Rattani, A.; Gupta, S.; Baticulon, R.E.; Hung, Y.C.; Punchak, M.; Agrawal, A.; Adeleye, A.O.; Shrime, M.G.; Rubiano, A.M. et al. Estimating the global incidence of traumatic brain injury. J. Neurosurg.; 2018; 130, pp. 1080-1097. [DOI: https://dx.doi.org/10.3171/2017.10.JNS17352] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29701556]
2. Brazinova, A.; Rehorcikova, V.; Taylor, M.S.; Buckova, V.; Majdan, M.; Psota, M.; Peeters, W.; Feigin, V.; Theadom, A.; Holkovic, L. et al. Epidemiology of Traumatic Brain Injury in Europe: A Living Systematic Review. J. Neurotrauma; 2021; 38, pp. 1411-1440. [DOI: https://dx.doi.org/10.1089/neu.2015.4126]
3. Iaccarino, C.; Carretta, A.; Nicolosi, F.; Morselli, C. Epidemiology of severe traumatic brain injury. J. Neurosurg. Sci.; 2018; 62, pp. 535-541. [DOI: https://dx.doi.org/10.23736/S0390-5616.18.04532-0]
4. GBD 2016 Traumatic Brain Injury and Spinal Cord Injury Collaborators. Global, regional, and national burden of traumatic brain injury and spinal cord injury, 1990–2016: A systematic analysis for the Global Burden of Disease Study 2016. Lancet Neurol.; 2019; 18, pp. 56-87. [DOI: https://dx.doi.org/10.1016/S1474-4422(18)30415-0]
5. Ng, S.Y.; Lee, A.Y.W. Traumatic Brain Injuries: Pathophysiology and Potential Therapeutic Targets. Front. Cell. Neurosci.; 2019; 13, 528. [DOI: https://dx.doi.org/10.3389/fncel.2019.00528] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31827423]
6. Orr, T.J.; Lesha, E.; Kramer, A.H.; Cecia, A.; Dugan, J.E.; Schwartz, B.; Einhaus, S.L. Traumatic Brain Injury: A Comprehensive Review of Biomechanics and Molecular Pathophysiology. World Neurosurg.; 2024; 185, pp. 74-88. [DOI: https://dx.doi.org/10.1016/j.wneu.2024.01.084]
7. Khatri, N.; Sumadhura, B.; Kumar, S.; Kaundal, R.K.; Sharma, S.; Datusalia, A.K. The Complexity of Secondary Cascade Consequent to Traumatic Brain Injury: Pathobiology and Potential Treatments. Curr. Neuropharmacol.; 2021; 19, pp. 1984-2011. [DOI: https://dx.doi.org/10.2174/1570159X19666210215123914] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33588734]
8. Jarrahi, A.; Braun, M.; Ahluwalia, M.; Gupta, R.V.; Wilson, M.; Munie, S.; Ahluwalia, P.; Vender, J.R.; Vale, F.L.; Dhandapani, K.M. et al. Revisiting Traumatic Brain Injury: From Molecular Mechanisms to Therapeutic Interventions. Biomedicines; 2020; 8, 389. [DOI: https://dx.doi.org/10.3390/biomedicines8100389]
9. Mustafa, A.G.; Alshboul, O.A. Pathophysiology of traumatic brain injury. Neurosciences; 2013; 18, pp. 222-234.
10. Kaur, P.; Sharma, S. Recent Advances in Pathophysiology of Traumatic Brain Injury. Curr. Neuropharmacol.; 2018; 16, pp. 1224-1238. [DOI: https://dx.doi.org/10.2174/1570159X15666170613083606]
11. Palmieri, M.; Frati, A.; Santoro, A.; Frati, P.; Fineschi, V.; Pesce, A. Diffuse Axonal Injury: Clinical Prognostic Factors, Molecular Experimental Models and the Impact of the Trauma Related Oxidative Stress. An Extensive Review Concerning Milestones and Advances. Int. J. Mol. Sci.; 2021; 22, 10865. [DOI: https://dx.doi.org/10.3390/ijms221910865] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34639206]
12. He, L.; Zhang, R.; Yang, M.; Lu, M. The role of astrocyte in neuroinflammation in traumatic brain injury. Biochim. Biophys. Acta Mol. Basis Dis.; 2024; 1870, 166992. [DOI: https://dx.doi.org/10.1016/j.bbadis.2023.166992] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/38128844]
13. Bertozzi, G.; Maglietta, F.; Sessa, F.; Scoto, E.; Cipolloni, L.; Di Mizio, G.; Salerno, M.; Pomara, C. Traumatic Brain Injury: A Forensic Approach: A Literature Review. Curr. Neuropharmacol.; 2020; 18, pp. 538-550. [DOI: https://dx.doi.org/10.2174/1570159X17666191101123145]
14. Frati, A.; Cerretani, D.; Fiaschi, A.I.; Frati, P.; Gatto, V.; La Russa, R.; Pesce, A.; Pinchi, E.; Santurro, A.; Fraschetti, F. et al. Diffuse Axonal Injury and Oxidative Stress: A Comprehensive Review. Int. J. Mol. Sci.; 2017; 18, 2600. [DOI: https://dx.doi.org/10.3390/ijms18122600]
15. Adams, J.H.; Doyle, D.; Graham, D.I.; Lawrence, A.E.; McLellan, D.R. Microscopic diffuse axonal injury in cases of head injury. Med. Sci. Law; 1985; 25, pp. 265-269. [DOI: https://dx.doi.org/10.1177/002580248502500407]
16. Zwirner, J.; Kulakofsky, R.; Fitzek, A.; Schröder, A.S.; Bohnert, S.; Franke, H.; Renné, T.; Tse, R.; Ondruschka, B. Forensic biomarkers of lethal traumatic brain injury. Int. J. Leg. Med.; 2022; 136, pp. 871-886. [DOI: https://dx.doi.org/10.1007/s00414-022-02785-2]
17. Czyżewski, W.; Mazurek, M.; Sakwa, L.; Szymoniuk, M.; Pham, J.; Pasierb, B.; Litak, J.; Czyżewska, E.; Turek, M.; Piotrowski, B. et al. Astroglial Cells: Emerging Therapeutic Targets in the Management of Traumatic Brain Injury. Cells; 2024; 13, 148. [DOI: https://dx.doi.org/10.3390/cells13020148]
18. Kattan, D.; Barsa, C.; Mekhijian, S.; Shakkour, Z.; Jammoul, M.; Doumit, M.; Zabala, M.C.P.; Darwiche, N.; Eid, A.H.; Mechref, Y. et al. Inflammasomes as biomarkers and therapeutic targets in traumatic brain injury and related-neurodegenerative diseases: A comprehensive overview. Neurosci. Biobehav. Rev.; 2023; 144, 104969. [DOI: https://dx.doi.org/10.1016/j.neubiorev.2022.104969] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36423707]
19. Martinez, B.; Peplow, P.V. MicroRNAs as diagnostic markers and therapeutic targets for traumatic brain injury. Neural Regen. Res.; 2017; 12, pp. 1749-1761.
20. Feng, X.; Hu, J.; Zhan, F.; Luo, D.; Hua, F.; Xu, G. MicroRNA-138-5p Regulates Hippocampal Neuroinflammation and Cognitive Impairment by NLRP3/Caspase-1 Signaling Pathway in Rats. J. Inflamm. Res.; 2021; 14, pp. 1125-1143. [DOI: https://dx.doi.org/10.2147/JIR.S304461]
21. Appel, D.; Hummel, R.; Weidemeier, M.; Endres, K.; Gölz, C.; Schäfer, M.K.E. Pharmacologic Inhibition of ADAM10 Attenuates Brain Tissue Loss, Axonal Injury and Pro-inflammatory Gene Expression Following Traumatic Brain Injury in Mice. Front. Cell Dev. Biol.; 2021; 9, 661462. [DOI: https://dx.doi.org/10.3389/fcell.2021.661462]
22. Adlakha, Y.K.; Saini, N. Brain microRNAs and insights into biological functions and therapeutic potential of brain enriched miRNA-128. Mol. Cancer; 2014; 13, 33. [DOI: https://dx.doi.org/10.1186/1476-4598-13-33] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24555688]
23. Ziats, M.N.; Rennert, O.M. Identification of differentially expressed microRNAs across the developing human brain. Mol. Psychiatry; 2014; 19, pp. 848-852. [DOI: https://dx.doi.org/10.1038/mp.2013.93]
24. Wang, W.; Kwon, E.J.; Tsai, L.H. MicroRNAs in learning, memory, and neurological diseases. Learn. Mem.; 2012; 19, pp. 359-368. [DOI: https://dx.doi.org/10.1101/lm.026492.112] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22904366]
25. Ghaith, H.S.; Nawar, A.A.; Gabra, M.D.; Abdelrahman, M.E.; Nafady, M.H.; Bahbah, E.I.; Ebada, M.A.; Ashraf, G.M.; Negida, A.; Barreto, G.E. A Literature Review of Traumatic Brain Injury Biomarkers. Mol. Neurobiol.; 2022; 59, pp. 4141-4158. [DOI: https://dx.doi.org/10.1007/s12035-022-02822-6]
26. Sun, P.; Liu, D.Z.; Jickling, G.C.; Sharp, F.R.; Yin, K.J. MicroRNA-based therapeutics in central nervous system injuries. J. Cereb. Blood Flow Metab.; 2018; 38, pp. 1125-1148. [DOI: https://dx.doi.org/10.1177/0271678X18773871]
27. Zhang, Y.; Zhang, Y.; Chopp, M.; Pang, H.; Chen, L.; Zhang, Z.G.; Mahmood, A.; Xiong, Y. Therapeutic Role of microRNAs of Small Extracellular Vesicles from Human Mesenchymal Stromal/Stem Cells in Treatment of Experimental Traumatic Brain Injury. J. Neurotrauma; 2023; 40, pp. 758-771. [DOI: https://dx.doi.org/10.1089/neu.2022.0296]
28. Pinchi, E.; Frati, P.; Arcangeli, M.; Volonnino, G.; Tomassi, R.; Santoro, P.; Cipolloni, L. MicroRNAs: The New Challenge for Traumatic Brain Injury Diagnosis. Curr. Neuropharmacol.; 2020; 18, pp. 319-331. [DOI: https://dx.doi.org/10.2174/1570159X17666191113100808] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31729300]
29. Zhang, J.G.; Xu, C.; Zhang, L.; Zhu, W.; Shen, H.; Deng, H.W. Identify gene expression pattern change at transcriptional and post-transcriptional levels. Transcription; 2019; 10, pp. 137-146. [DOI: https://dx.doi.org/10.1080/21541264.2019.1575159]
30. Albano, G.D.; Stassi, C.; Argo, A.; Zerbo, S. An Overview on the Use of miRNAs as Possible Forensic Biomarkers for the Diagnosis of Traumatic Brain Injury. Int. J. Mol. Sci.; 2023; 24, 6503. [DOI: https://dx.doi.org/10.3390/ijms24076503]
31. Redell, J.B.; Moore, A.N.; Ward, N.H., III; Hergenroeder, G.W.; Dash, P.K. Human traumatic brain injury alters plasma microRNA levels. J. Neurotrauma; 2010; 27, pp. 2147-2156. [DOI: https://dx.doi.org/10.1089/neu.2010.1481]
32. Bhomia, M.; Balakathiresan, N.S.; Wang, K.K.; Papa, L.; Maheshwari, R.K. A Panel of Serum MiRNA Biomarkers for the Diagnosis of Severe to Mild Traumatic Brain Injury in Humans. Sci. Rep.; 2016; 6, 28148. [DOI: https://dx.doi.org/10.1038/srep28148] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27338832]
33. Di Pietro, V.; Ragusa, M.; Davies, D.; Su, Z.; Hazeldine, J.; Lazzarino, G.; Hill, L.J.; Crombie, N.; Foster, M.; Purrello, M. et al. MicroRNAs as Novel Biomarkers for the Diagnosis and Prognosis of Mild and Severe Traumatic Brain Injury. J. Neurotrauma; 2017; 34, pp. 1948-1956. [DOI: https://dx.doi.org/10.1089/neu.2016.4857]
34. Qin, X.; Li, L.; Lv, Q.; Shu, Q.; Zhang, Y.; Wang, Y. Expression profile of plasma microRNAs and their roles in diagnosis of mild to severe traumatic brain injury. PLoS ONE; 2018; 13, e0204051. [DOI: https://dx.doi.org/10.1371/journal.pone.0204051]
35. Yan, J.; Bu, X.; Li, Z.; Wu, J.; Wang, C.; Li, D.; Song, J.; Wang, J. Screening the expression of several miRNAs from TaqMan Low Density Array in traumatic brain injury: miR-219a-5p regulates neuronal apoptosis by modulating CCNA2 and CACUL1. J. Neurochem.; 2019; 150, pp. 202-217. [DOI: https://dx.doi.org/10.1111/jnc.14717]
36. Sabirzhanov, B.; Zhao, Z.; Stoica, B.A.; Loane, D.J.; Wu, J.; Borroto, C.; Dorsey, S.G.; Faden, A.I. Downregulation of miR-23a and miR-27a following experimental traumatic brain injury induces neuronal cell death through activation of proapoptotic Bcl-2 proteins. J. Neurosci.; 2014; 34, pp. 10055-10071. [DOI: https://dx.doi.org/10.1523/JNEUROSCI.1260-14.2014] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25057207]
37. Sun, L.; Zhao, M.; Wang, Y.; Liu, A.; Lv, M.; Li, Y.; Yang, X.; Wu, Z. Neuroprotective effects of miR-27a against traumatic brain injury via suppressing FoxO3a-mediated neuronal autophagy. Biochem. Biophys. Res. Commun.; 2017; 482, pp. 1141-1147. [DOI: https://dx.doi.org/10.1016/j.bbrc.2016.12.001] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27919684]
38. Sun, L.; Zhao, M.; Zhang, J.; Liu, A.; Ji, W.; Li, Y.; Yang, X.; Wu, Z. MiR-144 promotes beta-amyloid accumulation-induced cognitive impairments by targeting ADAM10 following traumatic brain injury. Oncotarget; 2017; 8, pp. 59181-59203. [DOI: https://dx.doi.org/10.18632/oncotarget.19469]
39. Tian, F.; Yuan, C.; Yue, H. MiR-138/SIRT1 axis is implicated in impaired learning and memory abilities of cerebral ischemia/reperfusion injured rats. Exp. Cell Res.; 2018; 367, pp. 232-240. [DOI: https://dx.doi.org/10.1016/j.yexcr.2018.03.042]
40. Pinchi, E.; Frati, A.; Cipolloni, L.; Aromatario, M.; Gatto, V.; La Russa, R.; Pesce, A.; Santurro, A.; Fraschetti, F.; Frati, P. et al. Clinical-pathological study on β-APP, IL-1β, GFAP, NFL, Spectrin II, 8OHdG, TUNEL, miR-21, miR-16, miR-92 expressions to verify DAI-diagnosis, grade and prognosis. Sci. Rep.; 2018; 8, 2387. [DOI: https://dx.doi.org/10.1038/s41598-018-20699-1]
41. Bonin, S.; D’Errico, S.; Medeot, C.; Moreschi, C.; Ciglieri, S.S.; Peruch, M.; Concato, M.; Azzalini, E.; Previderè, C.; Fattorini, P. Evaluation of a Set of miRNAs in 26 Cases of Fatal Traumatic Brain Injuries. Int. J. Mol. Sci.; 2023; 24, 10836. [DOI: https://dx.doi.org/10.3390/ijms241310836]
42. Werner, C.; Engelhard, K. Pathophysiology of traumatic brain injury. Br. J. Anaesth.; 2007; 99, pp. 4-9. [DOI: https://dx.doi.org/10.1093/bja/aem131] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17573392]
43. Freire, M.A.M.; Rocha, G.S.; Bittencourt, L.O.; Falcao, D.; Lima, R.R.; Cavalcanti, J.R.L.P. Cellular and Molecular Pathophysiology of Traumatic Brain Injury: What Have We Learned So Far?. Biology; 2023; 12, 1139. [DOI: https://dx.doi.org/10.3390/biology12081139] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37627023]
44. Bouras, M.; Asehnoune, K.; Roquilly, A. Immune modulation after traumatic brain injury. Front. Med.; 2022; 9, 995044. [DOI: https://dx.doi.org/10.3389/fmed.2022.995044] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36530909]
45. Defort, P.; Retkowska-Tomaszewska, N.; Kot, M.; Jarmużek, P.; Tylutka, A.; Zembron-Lacny, A. Inflammatory Predictors of Prognosis in Patients with Traumatic Cerebral Haemorrhage: Retrospective Study. J. Clin. Med.; 2022; 11, 705. [DOI: https://dx.doi.org/10.3390/jcm11030705]
46. Postolache, T.T.; Wadhawan, A.; Can, A.; Lowry, C.A.; Woodbury, M.; Makkar, H.; Hoisington, A.J.; Scott, A.J.; Potocki, E.; Benros, M.E. et al. Inflammation in Traumatic Brain Injury. J. Alzheimers Dis.; 2020; 74, pp. 1-28. [DOI: https://dx.doi.org/10.3233/JAD-191150] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32176646]
47. Lozano, D.; Gonzales-Portillo, G.S.; Acosta, S.; de la Pena, I.; Tajiri, N.; Kaneko, Y.; Borlongan, C.V. Neuroinflammatory responses to traumatic brain injury: Etiology, clinical consequences, and therapeutic opportunities. Neuropsychiatr. Dis. Treat.; 2015; 11, pp. 97-106.
48. Nguyen, A.; Nguyen, A.; Hsu, T.I.; Lew, H.D.; Gupta, N.; Nguyen, B.; Mandavalli, A.; Diaz, M.J.; Lucke-Wold, B. Neutrophil to Lymphocyte Ratio as a Predictor of Postoperative Outcomes in Traumatic Brain Injury: A Systematic Review and Meta-Analysis. Diseases; 2023; 11, 51. [DOI: https://dx.doi.org/10.3390/diseases11010051]
49. Zahorec, R. Neutrophil-to-lymphocyte ratio, past, present and future perspectives. Bratisl. Lek. Listy; 2021; 122, pp. 474-488. [DOI: https://dx.doi.org/10.4149/BLL_2021_078]
50. Atif, H.; Hicks, S.D. A Review of MicroRNA Biomarkers in Traumatic Brain Injury. J. Exp. Neurosci.; 2019; 13, 1179069519832286. [DOI: https://dx.doi.org/10.1177/1179069519832286]
51. Zhu, Z.; Huang, X.; Du, M.; Wu, C.; Fu, J.; Tan, W.; Wu, B.; Zhang, J.; Liao, Z.B. Recent advances in the role of miRNAs in post-traumatic stress disorder and traumatic brain injury. Mol. Psychiatry; 2023; 28, pp. 2630-2644. [DOI: https://dx.doi.org/10.1038/s41380-023-02126-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37340171]
52. O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol.; 2018; 9, 402. [DOI: https://dx.doi.org/10.3389/fendo.2018.00402] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30123182]
53. Macfarlane, L.A.; Murphy, P.R. MicroRNA: Biogenesis, Function and Role in Cancer. Curr. Genom.; 2010; 11, pp. 537-561. [DOI: https://dx.doi.org/10.2174/138920210793175895] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21532838]
54. Wyczechowska, D.; Harch, P.G.; Mullenix, S.; Fannin, E.S.; Chiappinelli, B.B.; Jeansonne, D.; Lassak, A.; Bazan, N.G.; Peruzzi, F. Serum microRNAs associated with concussion in football players. Front. Neurol.; 2023; 14, 1155479. [DOI: https://dx.doi.org/10.3389/fneur.2023.1155479]
55. Sun, Y.; Xiong, Y.; Yan, C.; Chen, L.; Chen, D.; Mi, B.; Liu, G. Downregulation of microRNA-16-5p accelerates fracture healing by promoting proliferation and inhibiting apoptosis of osteoblasts in patients with traumatic brain injury. Am. J. Transl. Res.; 2019; 11, pp. 4746-4760.
56. Ge, X.T.; Lei, P.; Wang, H.C.; Zhang, A.L.; Han, Z.L.; Chen, X.; Li, S.H.; Jiang, R.C.; Kang, C.S.; Zhang, J.N. miR-21 improves the neurological outcome after traumatic brain injury in rats. Sci. Rep.; 2014; 4, 6718. [DOI: https://dx.doi.org/10.1038/srep06718]
57. Ge, X.; Han, Z.; Chen, F.; Wang, H.; Zhang, B.; Jiang, R.; Lei, P.; Zhang, J. MiR-21 alleviates secondary blood-brain barrier damage after traumatic brain injury in rats. Brain Res.; 2015; 1603, pp. 150-157. [DOI: https://dx.doi.org/10.1016/j.brainres.2015.01.009] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25598202]
58. Ji, W.; Jiao, J.; Cheng, C.; Shao, J. MicroRNA-21 in the Pathogenesis of Traumatic Brain Injury. Neurochem. Res.; 2018; 43, pp. 1863-1868. [DOI: https://dx.doi.org/10.1007/s11064-018-2602-z]
59. Kumar, A.; Stoica, B.A.; Loane, D.J.; Yang, M.; Abulwerdi, G.; Khan, N.; Kumar, A.; Thom, S.R.; Faden, A.I. Microglial-derived microparticles mediate neuroinflammation after traumatic brain injury. J. Neuroinflamm.; 2017; 14, 47. [DOI: https://dx.doi.org/10.1186/s12974-017-0819-4]
60. Wang, W.X.; Visavadiya, N.P.; Pandya, J.D.; Nelson, P.T.; Sullivan, P.G.; Springer, J.E. Mitochondria-associated microRNAs in rat hippocampus following traumatic brain injury. Exp. Neurol.; 2015; 265, pp. 84-93. [DOI: https://dx.doi.org/10.1016/j.expneurol.2014.12.018]
61. Kabadi, S.V.; Stoica, B.A.; Byrnes, K.R.; Hanscom, M.; Loane, D.J.; Faden, A.I. Selective CDK inhibitor limits neuroinflammation and progressive neurodegeneration after brain trauma. J. Cereb. Blood Flow Metab.; 2012; 32, pp. 137-149. [DOI: https://dx.doi.org/10.1038/jcbfm.2011.117]
62. Loane, D.J.; Kumar, A.; Stoica, B.A.; Cabatbat, R.; Faden, A.I. Progressive neurodegeneration after experimental brain trauma: Association with chronic microglial activation. J. Neuropathol. Exp. Neurol.; 2014; 73, pp. 14-29. [DOI: https://dx.doi.org/10.1097/NEN.0000000000000021]
63. Committee on Medical Aspects of Automotive Safety. Rating the Severity of Tissue Damage: I. The Abbreviated Scale. JAMA; 1971; 215, pp. 277-280.
64. The Association for the Advancement of Automotive Medicine. Abbreviated Injury Scale (AIS) 2015; The Association for the Advancement of Automotive Medicine: Chicago, IL, USA, 2016.
65. Krell, A.; Wolter, M.; Stojcheva, N.; Hertler, C.; Liesenberg, F.; Zapatka, M.; Weller, M.; Malzkorn, B.; Reifenberger, G. MiR-16-5p is frequently down-regulated in astrocytic gliomas and modulates glioma cell proliferation, apoptosis and response to cytotoxic therapy. Neuropathol. Appl. Neurobiol.; 2019; 45, pp. 441-458. [DOI: https://dx.doi.org/10.1111/nan.12532] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30548945]
66. Kim, Y.J.; Kim, S.H.; Park, Y.; Park, J.; Lee, J.H.; Kim, B.C.; Song, W.K. miR-16-5p is upregulated by amyloid β deposition in Alzheimer’s disease models and induces neuronal cell apoptosis through direct targeting and suppression of BCL-2. Exp. Gerontol.; 2020; 136, 110954. [DOI: https://dx.doi.org/10.1016/j.exger.2020.110954]
67. Jullienne, A.; Fukuda, A.M.; Ichkova, A.; Nishiyama, N.; Aussudre, J.; Obenaus, A.; Badaut, J. Modulating the water channel AQP4 alters miRNA expression, astrocyte connectivity and water diffusion in the rodent brain. Sci. Rep.; 2018; 8, 4186. [DOI: https://dx.doi.org/10.1038/s41598-018-22268-y] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29520011]
68. Vandebroek, A.; Yasui, M. Regulation of AQP4 in the Central Nervous System. Int. J. Mol. Sci.; 2020; 21, 1603. [DOI: https://dx.doi.org/10.3390/ijms21051603] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32111087]
69. Feng, M.G.; Liu, C.F.; Chen, L.; Feng, W.B.; Liu, M.; Hai, H.; Lu, J.M. MiR-21 attenuates apoptosis-triggered by amyloid-β via modulating PDCD4/ PI3K/AKT/GSK-3β pathway in SH-SY5Y cells. Biomed. Pharmacother.; 2018; 101, pp. 1003-1007. [DOI: https://dx.doi.org/10.1016/j.biopha.2018.02.043]
70. Xu, G.; Ao, R.; Zhi, Z.; Jia, J.; Yu, B. miR-21 and miR-19b delivered by hMSC-derived EVs regulate the apoptosis and differentiation of neurons in patients with spinal cord injury. J. Cell Physiol.; 2019; 234, pp. 10205-10217. [DOI: https://dx.doi.org/10.1002/jcp.27690]
71. Bai, X.; Bian, Z. MicroRNA-21 Is a Versatile Regulator and Potential Treatment Target in Central Nervous System Disorders. Front. Mol. Neurosci.; 2022; 15, 842288. [DOI: https://dx.doi.org/10.3389/fnmol.2022.842288]
72. Li, Z.; Xu, R.; Zhu, X.; Li, Y.; Wang, Y.; Xu, W. MicroRNA-23a-3p improves traumatic brain injury through modulating the neurological apoptosis and inflammation response in mice. Cell Cycle; 2020; 19, pp. 24-38. [DOI: https://dx.doi.org/10.1080/15384101.2019.1691763] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31818176]
73. Wang, Y.; Wang, M.D.; Xia, Y.P.; Gao, Y.; Zhu, Y.Y.; Chen, S.C.; Mao, L.; He, Q.W.; Yue, Z.Y.; Hu, B. MicroRNA-130a regulates cerebral ischemia-induced blood-brain barrier permeability by targeting Homeobox A5. FASEB J.; 2018; 32, pp. 935-944. [DOI: https://dx.doi.org/10.1096/fj.201700139RRR] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29070584]
74. Sepramaniam, S.; Ying, L.K.; Armugam, A.; Wintour, E.M.; Jeyaseelan, K. MicroRNA-130a represses transcriptional activity of aquaporin 4 M1 promoter. J. Biol. Chem.; 2012; 287, pp. 12006-12015. [DOI: https://dx.doi.org/10.1074/jbc.M111.280701] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22334710]
75. Henry, R.J.; Doran, S.J.; Barrett, J.P.; Meadows, V.E.; Sabirzhanov, B.; Stoica, B.A.; Loane, D.J.; Faden, A.I. Inhibition of miR-155 Limits Neuroinflammation and Improves Functional Recovery After Experimental Traumatic Brain Injury in Mice. Neurotherapeutics; 2019; 16, pp. 216-230. [DOI: https://dx.doi.org/10.1007/s13311-018-0665-9]
76. Li, Z.; Wang, Y.; Zeng, G.; Zheng, X.; Wang, W.; Ling, Y.; Tang, H.; Zhang, J. Increased miR-155 and heme oxygenase-1 expression is involved in the protective effects of formononetin in traumatic brain injury in rats. Am. J. Transl. Res.; 2017; 9, pp. 5653-5661. [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29312517]
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Scopetti, Matteo 2
; Donato Morena 2
; Cipolloni, Luigi 3
; Fineschi, Vittorio 2
; Santurro, Alessandro 1
1 Department of Medicine, Surgery and Dentistry “Schola Medica Salernitana”, University of Salerno, 84081 Baronissi, Italy;
2 Department of Anatomical, Histological, Forensic and Orthopaedic Sciences, Sapienza University of Rome, 00161 Rome, Italy;
3 Department of Clinical and Experimental Medicine, University of Foggia, 71100 Foggia, Italy;