1. Introduction
The amount of inorganic salts and organic matter input into an estuary increases sharply as a result of human activity, and this induces seasonal hypoxia in the estuary area and adjacent sea areas [1,2]. Hypoxia refers to a dissolved oxygen (DO) level of less than 2.0 mg/L in a marine environment [3], which affects organisms’ movement, metabolism, and reproductive behavior, and can even lead to death [4]. Therefore, mollusks inhabiting estuarine areas often face the threat of a hypoxic environment because of their poor mobility [5].
Crassostrea hongkongensis (C. hongkongensis) is one of the three most commonly cultivated oyster species with economic importance, distributed throughout the South China Sea [6]. C. hongkongensis is a sessile bivalve inhabiting the intertidal zone. The oyster is distributed in coastal estuaries in the south of China, where human activities are intense, and industry and agriculture are concentrated [7]. Thus, C. hongkongensis, an intertidal sessile model species, may suffer from hypoxia during low tides. One study showed that during hot and foggy weather in July and August, the DO in seawater decreased by 45.5% (DO 1.94 mg/L) in the Maowei Sea, Qinzhou, China, which led to the mortality rate of C. hongkongensis reaching 60%; while utilizing the oxygenation function of an aerator, the mortality of C. hongkongensis significantly reduced. The results indicated that low oxygen has become an important environmental factor restricting marine aquaculture [2].
Shellfish generally have well-developed hypoxia tolerance, through responses such as actively reducing their own metabolic rate when facing hypoxia stress [8]. In a hypoxic environment, the feeding rate and excretion rate of Ruditapes decussatus decreased, along with its energy metabolism rate [9]; Crassostrea virginica limited the activity of metabolic enzymes through protein phosphorylation modifications, thereby reducing its basal metabolic rate [10]. The exposure to hypoxia is always relevant to the change in the antioxidant and enzyme activities related to energy metabolism in bivalves. Wei et al. examined the hypoxia stress enzyme activities of C. hongkongensis, such as superoxide dismutase (SOD) and catalase (CAT) [11]. Exposed to hypoxia, the kinetic properties of both phosphofructokinase (PFK) and pyruvate kinase (PK) changed in Littorina littorea [12], and the level of phosphoenolpyruvate carboxykinase (PEPCK) increased in Crassostrea gigas [13]. Transcriptome sequencing has been widely used for understanding the molecular mechanisms of shellfish against environmental stress, including metal stress, temperature stress, and salinity stress [14,15,16]. Some reports have noted the effects of hypoxia stress on the metabolism and transcriptional regulation in bivalves. A transcriptomic analysis related to the regulation of Mytilus edulis exposed to acute hypoxia has been conducted [17]. Yang et al. performed an integrated analysis of transcriptomics and metabolomics to reveal the response of Pinctada fucata martensii to long-term hypoxia [18]. To date, data on hypoxia-responsive transcriptomics in C. hongkongensis remain limited.
Little is known about the tolerance of C. hongkongensis to hypoxia. Therefore, in this study, the goal was to evaluate the antioxidant response, energy metabolism, and transcriptomic response of C. hongkongensis under hypoxic stress, as well as to gain knowledge concerning how C. hongkongensis initiates a response to low oxygen levels. We integrated analyses of antioxidant capacity and enzyme activities related to energy metabolism in normoxic, hypoxic, and reoxygenated conditions with a transcriptomic analysis to identify the differentially expressed genes and the KEGG pathways related to the hypoxic response. These data enhance our understanding of the mechanisms governing the responses to hypoxia in C. hongkongensis.
2. Materials and Methods
2.1. Hypoxia Experiment
Two-year-old C. hongkongensis specimens were obtained from an oyster-breeding area in Lianzhou Bay (Beihai, China), where the conditions were as follows: temperature at 30 ± 2 °C, salinity 20 ± 1‰, dissolved oxygen (DO) 5.6 ± 0.2 mg/L, and pH 7.8 ± 0.2. These oysters had a mean body weight of 89.07 ± 10.47 g, mean shell height of 87.62 ± 7.66 mm, and mean shell length of 50.30 ± 4.40 mm. The experiment was performed in the laboratory of the Beihai aquaculture base of the Guangxi Academy of Fishery Sciences (E109°7′35″, N21°29′13″). Before the hypoxia experiment, oysters were reared at an average temperature of 30 °C and a salinity of 22‰ for one week. Oysters were fed with algal liquid (Dicrateria sp, Chaetoceros, and Platymonas mix) in the morning and evening.
Based on our team’s previous research data regarding hypoxia, we selected 120 experimental oysters and placed oysters into normoxia (DO 6.0 ± 0.2 mg/L) and hypoxia (DO 1.5 ± 0.2 mg/L) conditions. The 120 oysters were evenly distributed among six 500 L tanks of filtered seawater and were evenly divided into control and experimental groups. After 72 h of hypoxic treatment, the conditions were recovered to normoxia for 24 h (reoxygenation DO 6.0 ± 0.2 mg/L). Normoxic conditions were maintained by continuously supplying oxygen to the seawater, and hypoxic conditions were maintained by supplying nitrogen to the seawater [10]. The air and nitrogen aeration rates of containers were individually controlled through a gas flow meter to maintain the concentration of dissolved oxygen. A YSI Professional Plus (YSI, Yellow Springs, OH, USA) was used as the dissolved oxygen detection instrument (Figure 1). To avoid the exchange of oxygen between the seawater and air, we sealed the buckets containing seawater with plastic film and rubber bands after the DO was reduced to the target concentration. The DO of the aquaculture seawater was detected using YSI Professional Plus.
2.2. Antioxidant Capacity and Enzyme Activity Determination
The gill and adductor muscle tissue of two alive oysters from each tank (six tanks) were collected at time points (0 h, 6 h, 48 h, and 72 h hypoxia, as well as reoxygenation). A total of 60 oysters were sampled, and all samples were stored at −80 °C. The total antioxidant capacity (T-AOC), glycogen content, and enzyme activities of PFK, PK, and PEPCK were determined. T-AOC was determined using oyster gill tissue, following the method of Zhang et al. [19], with three replicates per time point (0 h, 6 h, 48 h, 72 h, and 96 h), while glycogen content, PFK enzyme activity, PK enzyme activity, and PEPCK enzyme activity were determined using adductor muscle, with three replicates per time point. T-AOC, glycogen content, PFK enzyme activity, PK enzyme activity, and PEPCK enzyme activity were determined according to the instructions of the reagent kit (T-AOC: D799276-0100, glycogen content: D799398-0100, PFK: D799442-0100, PK: D799444-0100, Sangon Biotechnology Co., Ltd., Shanghai, China; PEPCK: G0830W, Grace Biotechnology Co., Ltd., Suzhou, China). A total of 30 oysters (60 tissue samples) in the control and experimental groups were used for antioxidant capacity and enzyme activity determination.
The experimental data were subjected to a one-way ANOVA and Duncan’s test using SPSS 23.0 software, with a significance level of 0.05 (p < 0.05) for data statistics. The software Excel 2013 was used for plotting.
2.3. RNA Extraction and Sequencing
We selected three oysters at the 72 h normoxic condition, 72 h hypoxic condition, and 24 h after recovery to the normoxic condition, respectively. The gill tissue of nine oysters was sampled. For each sampled individual, a portion of the gill tissue was immediately frozen in liquid nitrogen for RNA sequencing and a portion immersed in RNAlater (QianGen, Hilden, Germany) for real-time quantitative polymerase chain reaction (RT-qPCR) analysis. Then, all samples were stored at −80 °C. Total RNA was extracted from the nine gill samples using TRI Reagent Solution TR118 (Ambion, Austin, TX, USA). The separated RNA concentrations and purity were measured with NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA). We determined RNA integrity with the Agilent Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). The cDNA libraries were sequenced on an Illumina Novaseq 6000 platform (NEB, Ipswich, MA, USA).
2.4. Sequence Processing and Functional Annotation
Raw data were first processed by removing adapters and sequences containing poly-N, and low-quality reads were excluded from the raw reads to obtain clean data. We subsequently calculated the Q30 values and guanine-cytosine (GC)-content levels of the clean data. The clean data were then compared with the reference genome (CNGB BioProject number PRJCA013250) with Hisat2 (2.0.4). To optimize the annotation information of a genome, we achieved the discovery of novel transcripts and genes by StringTie on the basis of the reference genome [20]. The mapped reads were compared with the annotations of the genome. The transcript regions without annotation were defined as novel transcripts. Novel genes were annotated by DIAMOND against several databases, including NR, Swiss-Prot, KOG, COG, GO, and KEGG databases [21,22,23,24,25,26].
2.5. Analysis of DEGs
To identify DEGs under normoxic, hypoxic, and reoxygenation conditions, we estimated the quantification of gene expression level by fragments per kilobase of transcript per million fragments mapped (FPKM). The DEGs among the three libraries were distinguished with DEseq2 software. We determined the threshold of the p-value with the false-discovery rate (FDR). In this study, genes with an FDR ≤ 0.05 and fold change ≥ 2 were identified as DEGs.
In addition, we conducted GO and KEGG enrichment analyses for DEGs. GO enrichment analysis of the DEGs was carried out with the GOseq R packages [27]. The KOBAS program [28] was used to detect the enrichment of DEGs in KEGG pathways.
2.6. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
To validate the expression trends of DEGs under the hypoxic and reoxygenation conditions of C. hongkongensis, we selected five significant DEGs for qPCR. The primer sequences of two hypoxic downregulated and three hypoxic upregulated genes are listed in Table 1. We used GAPDH as the internal reference gene. We conducted qPCR on an Applied Biosystems StepOnePlusTM Real-Time System with SYBR Select Master Mix (ABI, Los Angeles, CA, USA). The RT-qPCR program was as follows: 30 s at 95 °C; then, proceed with 40 cycles for 10 s at 95 °C; and 30 s at 60 °C. Each sample was tested three times. The expression levels of genes were calculated by the 2−ΔΔCT method. StepOne Software v2.3 and BioRadCFXManager (3.1) were used for data analysis.
3. Results
3.1. Antioxidant Capacity, Glycogen Content, and Enzyme Activities
In the hypoxic treatment, the T-AOC was depressed at 6 h; at 72 h, the T-AOC increased, reaching the maximum value with a significant difference compared to the normoxic group (p < 0.05) (Figure 2A). After 24 h of reoxygenation, the T-AOC decreased. In the hypoxic treatment, the glycogen content showed a trend of first decreasing and then increasing (Figure 2B). After 6 h and 48 h of hypoxic treatment, the glycogen content decreased, and that of the hypoxia group was significantly less than that of the normoxic group (p < 0.05), while the glycogen content during 48 h to 72 h of hypoxia and 24 h of reoxygenation significantly increased compared to that at 48 h hypoxia (p < 0.05) (Figure 2B).
Exposed to hypoxic stress, the PFK (Figure 2C), PK (Figure 2D), and PEPCK (Figure 2E) enzyme activity of C. hongkongensis decreased at 6 h; the PFK enzyme activity of oysters exposed to 48 h hypoxia decreased compared to that of oysters exposed to 6 h, but the PK and PEPCK enzyme activity significantly increased. The PK and PEPCK enzyme activity of C. hongkongensis exposed to 72 h hypoxia was significantly higher than normoxia (p < 0.05), while PFK was lower. After 24 h reoxygenation, the PEPCK enzyme activity increased significantly compared to normoxia, while the PFK and PK enzyme activity was significantly depressed (p < 0.05).
3.2. Sequencing, Sequence Assembly, and Annotation
In total, we constructed nine gill libraries, including normoxic (N), hypoxic (H), and reoxygenation (R) conditions of C. hongkongensis (each condition consisting of three libraries). After quality control, 197,812,420 clean reads remained from nine libraries. The GC content of the clean data exceeded 40%, and the Q30 percentage ranged from 95.26% to 95.75% (Table 2). The clean reads can be obtained from the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA; submission number SUB12304423). The clean reads were mapped to the C. hongkongensis genome with Hisat2, and the mapped reads exceeded 80.29%. We assembled the mapped reads using StringTie software (1.3.4d) [20] and compared the data with the original annotations of the genome. Eliminating short transcripts or those containing only one exon, we discovered 6097 novel genes, including 2079 genes annotated: NR (1864), Swiss-Prot (83), KOG (126), COG (39), GO (852), and KEGG (640).
3.3. Candidate Genes under Hypoxic Conditions
We identified a total of 352 DEGs between the N and H libraries, including 235 hypoxia-upregulated and 117 hypoxia-downregulated genes (Figure 3A,D; Table S1). In total, 292 DEGs were obtained in the R vs. N library comparison, including 134 reoxygenation-upregulated genes and 158 reoxygenation-downregulated genes (Figure 3B,D; Table S2), and 632 DEGs were identified (253 upregulated and 379 downregulated genes) in the R vs. H comparison group (Figure 3C,D; Table S3).
In this study, we identified some known hypoxic-tolerant genes in the DEGs of C. hongkongensis (Table 3), including the transient receptor potential cation channel subfamily M member 2 (TRPM2, CH1000250), tyramine beta-hydroxylase (TBH, CH1001282), superoxide dismutase (SOD, CH0900166), alternative oxidase (AOX, CH0502591), and globin isoform X3 (CH0200562). These genes including TRPM2, TBH, and SOD were significant DEGs both in the H vs. N and R vs. N comparison groups, whereas AOX was differentially expressed in the H vs. N comparison group, and globin isoform X3 was differentially expressed in the H vs. N and R vs. H comparison groups. We speculated that they might be hypoxic-tolerant candidate genes in C. hongkongensis.
3.4. Functional Annotation of DEGs under Hypoxic Conditions in C. hongkongensis
We conducted a GO functional analysis of DEGs. The results of the three comparison groups were consistent. In the biological process term, the DEGs were associated with the cellular and metabolic process. In the cellular component term, the DEGs were involved in the membrane and membrane parts. In the molecular function term, the DEGs were related to the functional categories of binding and molecular transducer activity (Figure 4).
In the top-20 enriched KEGG pathways, the biosynthesis of amino acids pathway, the ubiquinone and other terpenoid-quinone biosynthesis pathway, and the caffeine metabolism pathway were significantly enriched in all three comparison groups. The metabolism of xenobiotics by cytochrome P450 pathway was significantly enriched in both the H vs. N and R vs. N comparison groups (Figure 5). And several pathways were enriched in only one comparison group, such as the HIF-1 signaling pathway, which was only enriched in the H vs. N comparison group.
3.5. KEGG Pathway Network Enriched by DEGs
To study the correlations between DEGs and KEGG pathways, five pathways with the lowest Q-values in the H vs. N, R vs. N, and R vs. H comparison groups were identified, respectively. Of these, several pathways were enriched in the same DEGs. In the H vs. N comparison, the five pathways were not enriched with common DEGs (Figure 6A). In the R vs. N comparison, the upregulated DEGs including glutathione S-transferase (CH0502351), S-crystallin SL11 (CH0202054), and S-crystallin SL11-like (CH0202058), working synergistically to perform biological functions in the four pathways of drug metabolism-cytochrome P450, metabolism of xenobiotics by cytochrome P450, glutathione metabolism, and arachidonic acid metabolism (Figure 6B). In the R vs. H comparison, the downregulated DEGs of xanthine dehydrogenase/oxidase-like (CH0201309, CH0203696) played a role in regulating the caffeine metabolism pathway and drug metabolism-other enzymes pathway (Figure 6C).
3.6. RT-qPCR Confirmation of DEGs
We selected five hypoxic-tolerant candidate genes from transcriptome sequencing data for RT-qPCR validation. The RT-qPCR results of most DEGs were consistent with the RNA sequencing (Figure 7). The results confirmed the credibility of the transcriptome sequencing data.
4. Discussion
Hypoxia is a common phenomenon for aquatic organisms [29,30,31]. To adapt to low-oxygen environments, shellfish spontaneously regulate their physiological response processes, including their respiration, protein regulation, oxidative metabolism, and immune system [32,33]. Thus, for this study, T-AOC, glycogen content, and the enzyme activities of C. hongkongensis exposed to hypoxia were determined, and the gill of C. hongkongensis was selected as the source of tissue for transcriptome analysis of the response to hypoxia.
T-AOC is a comprehensive indicator used to determine the antioxidant level of organisms [34]. Glycogen is one of the main energy sources of organisms and is closely related to energy metabolism. In the hypoxia group, the T-AOC and glycogen content of C. hongkongensis decreased at 6 h. As the duration of hypoxia prolonged, the T-AOC and glycogen content gradually increased. At 72 h, the T-AOC and glycogen content were significantly higher than at 48 h hypoxia (p < 0.05). After recovering to normoxia for 24 h, the T-AOC and glycogen content of C. hongkongensis exposed to hypoxia returned to normal levels. Under hypoxic conditions, T-AOC may display compensatory increases to regulate the antioxidant levels of C. hongkongensis. Glycogen, as a carbohydrate, is involved in catabolism via glycolysis to produce ATP [35]. The compensatory increase in ATP maintained the normal turnover needs in the organism.
Most marine invertebrates exposed to environmental stress will autonomously transfer energy metabolism toward glycolysis [36,37,38]. PFK, PK, and PEPCK, as important enzymes, play important roles in glycolysis. PFK is a metabolic enzyme that determines carbohydrate utilization, and the enzymes PK and PEPCK catalyze phosphoenolpyruvate (PEP) to produce ATP [35]. Under 6 h of hypoxia stimulation, the enzyme activities of PK, PFK, and PEPCK in C. hongkongensis rapidly decreased, indicating that the oysters immediately responded to hypoxia and altered their mode of energy metabolism. As the hypoxia duration prolonged, the enzyme activities of PK, PFK, and PEPCK gradually increased, which is generally consistent with the trend of glycogen content changing. These results indicated that C. hongkongensis had altered its metabolic process to anaerobic glycolysis, consistent with previous research. The PEP catabolism is accomplished via the catalysis of PK and PEPCK, which then further generates ATP for energy supply.
Under hypoxia, the expression levels of antioxidant genes and glycolysis-related genes may change, such as the SOD gene of C. gigas being significantly upregulated [39], and the expression levels of genes HK, PEPCK, and UCP2 increasing [40]. In this study, we identified several known hypoxia-tolerance genes in the DEGs of C. hongkongensis by transcriptome sequencing, including PEPCK, AOX, TBH, and SOD. In the R vs. H comparison groups, the PEPCK gene was upregulated under hypoxia, while the expression level decreased during reoxygenation. The mRNA levels and enzyme activity of PEPCK increased in C. hongkongensis exposed to hypoxia, indicating that PEPCK regulated the mechanism of hypoxia tolerance.
Under hypoxia, the enzyme activity and mRNA levels of AOX in juvenile ark shells (Anadara broughtonii) increased [41]. In freshwater bivalves, AOX was strongly upregulated during anoxia in the gills [42]. A previous study showed that AOX modulated during hypoxic stress in the brains of Atlantic croaker [43]. AOX expression played an essential role in avoiding hypoxia-induced superoxide and H2O2 levels [44]. In the RT-qPCR results of our study, the expression of the AOX gene in C. hongkongensis gill was downregulated under hypoxia, opposite to previous research. This finding maybe indicated the negative regulation of the AOX gene in C. hongkongensis against hypoxia.
Octopamine (OA) is an important neuroactive substance that regulates several physiological functions and behaviors of many invertebrate species. TBH promotes the last step in OA biosynthesis. TBH is considered as a biomarker of stress in insects [45]. Therefore, TBH catalyzes the conversion of tyramine to OA [46], a process critical for stress responses. In L. vanname, expression of the gene TBH was upregulated after a low-temperature and Vibrio alginolyticus challenge [47]. In the RT-qPCR results of our study, the gene TBH in C. hongkongensis gill was downregulated under hypoxia; after recovering to normoxia for 24 h, the expression level increased, indicating the crucial role of TBH in orchestrating hypoxic responses.
Hypoxia and reoxygenation are physiological stressors that result in an overproduction of reactive oxygen species (ROS) and oxidative stress [48]. The most common ROS are superoxide radicals that are converted to hydrogen peroxide and oxygen by the enzyme SOD; catalase and glutathione peroxidase then degrade hydrogen peroxide to oxygen and water [49]. It has been reported that the injury by hypoxia or hypoxia/reoxygenation could be prevented by SOD [50]. In Mytilus galloprovincialis, expression of SOD was upregulated after 72 h of hypoxia and returned to the normoxic level after 24 h of reoxygenation [51]. Under hypoxic conditions, the expressions levels of the SOD gene and the activity of the antioxidant enzyme (SOD) were upregulated compared to the control group in hybrid yellow catfish [52]. The RT-qPCR results of our study demonstrated that the SOD gene in the gill of C. hongkongensis was downregulated under hypoxic conditions, a result that was the opposite of previous research results. This finding may suggest the presence of a negative regulating hypoxic adaptation.
DEGs were enriched in the KEGG pathways; both coregulated the metabolic network and the molecular mechanisms of the organisms. In this study, the transcriptome analysis of C. hongkongensis gill responding to hypoxia indicated that the metabolism of xenobiotics by cytochrome P450 pathway and HIF-1 signaling pathway may be associated with hypoxia-related responses.
The DEGs of the S-crystallin family (S-crystallin SL11, S-crystallin SL11-like) and the glutathione S-transferase family (glutathione S-transferase, glutathione S-transferase P 1 isoform X1, GSTs) were related with the enzyme glutathione S-transferase of the metabolism of xenobiotics by cytochrome P450 pathway (Table 4). S-crystallin is involved in the evolution of glutathione S-transferase [53]. GST, as a cell housekeeping gene engaged in the detoxification of xenobiotics, is related to the stress response [54]. It has been observed that the GST genes of silver sillago (Sillago sihama) were differentially expressed under hypoxia, and the metabolism of xenobiotics by cytochrome P450 pathway was concerning to the hypoxic response [55]. In this study, the expression levels of the GST family were upregulated or downregulated according to the changes in oxygen concentration, thereby regulating the metabolism of xenobiotics by cytochrome P450 pathway involved in the response to hypoxia or reoxygenation.
The HIF-1 signaling pathway, enriched in the H vs. N comparison group (Figure 5A), is crucial for the maintenance of oxygen homeostasis in aquatic animals, such as R. philippinarum, Siniperca chuatsi, and Paralichthys olivaceus [56,57,58]. Under hypoxic stress, the HIF-1 signaling pathway in organisms is activated [59]. Hypoxia-inducible factors (HIFs) are the master regulator of the cellular response to hypoxic stress in the HIF-1 signaling pathway [60]. Under normoxia, hypoxia-inducible factor prolyl hydroxylase (PHD) recognizes hydroxyl and uses molecular oxygen as a substrate to degrade HIF-α by ubiquitin-mediated proteolysis (Table 4). Egl nine homolog 1 isoform X2 (EGLN1), also known as PHD2, was an oxygen sensor in the HIF-1 signaling pathway, targeting two HIF-1α proteins for degradation under normoxic conditions [61]. In this study, under hypoxia, the mRNA expression level of EGLN1 was upregulated in C. hongkongensis and negatively correlated with oxygen concentration. In HIF-α degradation, nitric oxide (NO) as an inhibitor of PHD competes with O2 for combining to iron, resulting in a redistribution of intracellular oxygen that activates EGLN1 and causes HIF degradation [62]. Therefore, the HIF-1 signaling pathway in C. hongkongensis under hypoxia was activated to promote an adaptive response.
5. Conclusions
In this study, hypoxia tolerance, recovery ability after reoxygenation, and molecular mechanisms governing the responses to hypoxia were investigated in C. hongkongensis. Hypoxia significantly affected the antioxidant capacity and enzyme activities related to the energy metabolism of C. hongkongensis. However, at 24 h after recovery to the normoxic condition, the T-AOC, glycogen content, and enzyme activities of PK and PFK returned to close to the initial level. The results indicate that 72 h hypoxia (DO 1.5 ± 0.2 mg/L) did not cause serious damage to C. hongkongensis, and its organism function can be restored after 24 h reoxygenation. Then, DEGs such as PEPCK, AOX, TBH, SOD, GST, and EGLN1, as well as two KEGG pathways involved in hypoxic stress including the metabolism of xenobiotics by cytochrome P450 pathway and HIF-1 signaling pathway, were identified as being involved in the response. The results revealed the molecular mechanisms involved in the responses of C. hongkongensis exposed to normoxia, hypoxia, and reoxygenation.
P.H.: experimental operation, data curation, writing—original draft preparation; W.L.: data curation, writing—review and editing; P.W.: software; Y.M. and Y.Z.: experimental operation; J.G.: sample collection; Y.C.: formal analysis; L.J. and L.Z.: funding acquisition; X.Z. and J.P.: writing—review and editing. All authors have read and agreed to the published version of the manuscript.
All of the treatment procedures of oysters were executed with the permission of the animal experiment ethics committee of the Guangxi Academy of Fisheries Sciences (GAFS2023009), Nanning, China.
Not applicable.
The data presented in this study are openly available in NCBI under BioProject number SUB12304423.
The authors declare no conflicts of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
![View Image - Figure 2. The total antioxidant capacity (T-AOC) (A), glycogen content (B), and enzyme activities of PFK (C), PK (D), and PEPCK (E) of C. hongkongensis exposed to 0 h, 6 h, 48 h, and 72 h hypoxic treatment, as well as 96 h treatment (72 h hypoxia + 24 h reoxygenation). The control group (normoxia) is represented by gray bars and the experimental groups (hypoxia) by purple. Means with the same letter have no significant differences (p [greater than] 0.05). The significance of the difference between treatments at the same time point is indicated by the lowercase letters a and b, and differences between different time points in the same treatment group are indicated by the capital letters A, B, C, and D (p [less than] 0.05).](https://media.proquest.com/media/hms/THUM/4/by44a?_a=ChgyMDI1MDgxNzEyNDgxMzUwMzo5MDY3NDUSBzEzODMzMjMaCk9ORV9TRUFSQ0giDTIxNi43My4yMTYuMTgqBzIwMzI0MzUyCjMxMTAyOTQxMzE6C0lubGluZUltYWdlQgEwUgZPbmxpbmVaA0lMSWIEVEhVTWoKMjAyNC8wMS8wMXIKMjAyNC8xMi8zMXoAggEgUC0xMDAwMDg0LTIwMTM5NS1TVEFGRi1udWxsLW51bGySAQZPbmxpbmXKAWdNb3ppbGxhLzUuMCBBcHBsZVdlYktpdC81MzcuMzYgKEtIVE1MLCBsaWtlIEdlY2tvOyBjb21wYXRpYmxlOyBDbGF1ZGVCb3QvMS4wOyArY2xhdWRlYm90QGFudGhyb3BpYy5jb20p0gESU2Nob2xhcmx5IEpvdXJuYWxzmgIHUHJlUGFpZKoCG09TOkVNUy1GdWxsVGV4dC1nZXRGdWxsVGV4dMoCD0FydGljbGV8RmVhdHVyZeICAU7yAgD6AgFZggMDV2ViigMcQ0lEOjIwMjUwODE3MTI0ODEzNTAzOjgxODUxNg%3D%3D&_s=8EUKBu8emfPIV3UAHttcRXzfvBE%3D "View Image - Figure 2. The total antioxidant capacity (T-AOC) (A), glycogen content (B), and enzyme activities of PFK (C), PK (D), and PEPCK (E) of C. hongkongensis exposed to 0 h, 6 h, 48 h, and 72 h hypoxic treatment, as well as 96 h treatment (72 h hypoxia + 24 h reoxygenation). The control group (normoxia) is represented by gray bars and the experimental groups (hypoxia) by purple. Means with the same letter have no significant differences (p [greater than] 0.05). The significance of the difference between treatments at the same time point is indicated by the lowercase letters a and b, and differences between different time points in the same treatment group are indicated by the capital letters A, B, C, and D (p [less than] 0.05).")
Enlarge this image.Figure 2. The total antioxidant capacity (T-AOC) (A), glycogen content (B), and enzyme activities of PFK (C), PK (D), and PEPCK (E) of C. hongkongensis exposed to 0 h, 6 h, 48 h, and 72 h hypoxic treatment, as well as 96 h treatment (72 h hypoxia + 24 h reoxygenation). The control group (normoxia) is represented by gray bars and the experimental groups (hypoxia) by purple. Means with the same letter have no significant differences (p [greater than] 0.05). The significance of the difference between treatments at the same time point is indicated by the lowercase letters a and b, and differences between different time points in the same treatment group are indicated by the capital letters A, B, C, and D (p [less than] 0.05).
Enlarge this image.Figure 3. Indentification of DEG: (A) Volcano plot of DEGs in hypoxia (H) vs. normoxia (N); (B) Volcano plot of DEGs in reoxygenation (R) vs. normoxia (N); (C) Volcano plot of DEGs in reoxygenation (R) vs. hypoxia (H). Red: upregulated genes; Green: downregulated genes; (D) Statistic of DEGs of C. hongkongensis, the blue bar represents the number of up-regulatedDEGs, and the red bar represents the number of down-regulated DEGs.
Enlarge this image.Figure 4. GO terms for DEGs: (A) hypoxia (H) vs. normoxia (N); (B) reoxygenation (R) vs. normoxia (N); (C) reoxygenation (R) vs. hypoxia (H).
Enlarge this image.Figure 5. Top-20 significantly enriched KEGG pathways: (A) hypoxia (H) vs. normoxia (N); (B) reoxygenation (R) vs. normoxia (N); (C) reoxygenation (R) vs. hypoxia (H).
Enlarge this image.Figure 6. KEGG pathway enrichment network of DEGs in the H vs. N (A), R vs. N (B), and R vs. H (C) comparison groups.
Enlarge this image.Figure 7. Comparison of DEG expression data between RNA-seq (black bars) and RT-qPCR (red bars). The x-axis presents the comparison groups, and the y-axis presents the fold change in DEG expression.
Primer sequences used in RT-qPCR.
| mRNA | Sequence (5′–3′) | Length (bp) | |
|---|---|---|---|
| CH1000250 | Fwd | AAGGTGACTTCAACACATCCG | 220 |
| Rev | CCTACTTGGTTTTGCTCGTTAT | ||
| CH1001282 | Fwd | AGAAATGGGGTCAAGGTCG | 119 |
| Rev | TAGCAGGTTCAGGTAACATACAA | ||
| CH0900166 | Fwd | TCCACCATAGGGTCCACG | 242 |
| Rev | CCATTTCCAAAGGTCCGTC | ||
| CH0502591 | Fwd | GGTTATTTAGAAGTGGCGTCA | 102 |
| Rev | GTGTGTACCAGTCCTACTGTCCT | ||
| CH0200562 | Fwd | CAACAATAGAGAGATTCCCGAT | 210 |
| Rev | CTACCTTAAAGTCCTCCGAGC | ||
| GAPDH | Fwd | GGATTGGCGTGGTGGTAGAG | 184 |
| Rev | GTATGATGCCCCTTTGTTGAGTC |
Sequencing data statistics.
| Sample | Number of Clean Reads | Number of Clean Bases | GC (%) | % ≥ Q30 |
|---|---|---|---|---|
| N1 | 25,206,800 | 7,511,666,510 | 40.8 | 95.56 |
| N2 | 19,802,452 | 5,893,526,304 | 41.43 | 95.32 |
| N3 | 20,465,606 | 6,087,523,020 | 41.01 | 95.31 |
| H1 | 20,647,843 | 6,150,256,584 | 41.19 | 95.32 |
| H2 | 24,095,305 | 7,170,772,744 | 41.7 | 95.47 |
| H3 | 24,502,902 | 7,288,089,524 | 41.72 | 95.65 |
| R1 | 20,244,717 | 6,033,282,358 | 41.11 | 95.45 |
| R2 | 21,361,892 | 6,362,961,796 | 40.9 | 95.26 |
| R3 | 21,484,903 | 6,389,008,412 | 41.5 | 95.75 |
Differentially expressed genes involved in hypoxia tolerance (“-” means Log2.Fold change <1 or DEGs not expressed).
| ID | Gene Description | Log2.Fold Change (H/N) | Log2.Fold Change (R/N) | Log2.Fold Change (R/H) |
|---|---|---|---|---|
| CH0900239 | cytochrome P450 3A11 isoform X2 | 2.07 | - | −1.08 |
| CH0603576 | egl nine homolog 1 isoform X2 (EGLN1) | 2.4 | - | −2.50 |
| CH1000250 | transient receptor potential cation channel subfamily M member 2 (TRPM2) | −2.41 | −2.23 | - |
| CH1001282 | tyramine beta-hydroxylase (TBH) | 1.23 | 2.05 | - |
| CH0900166 | superoxide dismutase (SOD) | −1.09 | −1.27 | - |
| CH0502591 | alternative oxidase, mitochondrial (AOX) | 1.75 | - | - |
| CH0200562 | globin isoform X3 | 4.16 | - | −4.22 |
| CH0502351 | glutathione S-transferase (GST) | - | 1.39 | 1.95 |
| CH0202054 | S-crystallin SL11 | 1.21 | 1.24 | - |
| CH0202058 | S-crystallin SL11-like | - | 1.19 | - |
| CH0102986 | glutathione S-transferase P 1 isoform X1 (GST) | - | −1.01 | - |
| CH0403890 | Phosphoenolpyruvate carboxykinase (PEPCK) | - | - | −1.05 |
| CH0301448 | methionine adenosyltransferase 2 subunit beta (MAT2A) | −1.38 | - | - |
| CH0900455 | asparagine synthetase (ASNS) | 1.55 | - | |
| CH1000346 | cytoplasmic aconitate hydratase isoform X2 | 1.04 | - | −1.52 |
| CH0403169 | carbonyl reductase (CR) | 1.34 | - | |
| CH0201309 | xanthine dehydrogenase/oxidase-like | 1.641 | - | −1.65 |
| CH0302869 | uricase-like | 1.18 | - | −1.11 |
| CH0303655 | senecionine N-oxygenase (SNO) | - | 1.03 | - |
| CH0601326 | xanthine dehydrogenase/oxidase | - | −1.33 | - |
| CH0203696 | xanthine dehydrogenase | - | - | −1.83 |
Differentially expressed genes (DEGs) enriched in KEGG pathways in hypoxia (H) vs. normoxia (N), reoxygenation (R) vs. normoxia (N), reoxygenation (R) vs. hypoxia (H).
| Pathway ID | Pathway Term | DEGs Name |
|---|---|---|
| Hypoxia (H) vs. Normoxia (N) | ||
| ko01230 | biosynthesis of amino acids | MAT2A; ASNS; cytoplasmic aconitate hydratase isoform X2 |
| ko00232 | caffeine metabolism | xanthine dehydrogenase/oxidase-like; uricase-like |
| ko00980 | metabolism of xenobiotics by cytochrome P450 | S-crystallin SL11; CR |
| ko04066 | HIF-1 signaling pathway | EGLN1 |
| Reoxygenation (R) vs. Normoxia (N) | ||
| ko00982 | drug metabolism-cytochrome P450 | glutathione S-transferase P 1 isoform X1; S-crystallin SL11; S-crystallin SL11-like; SNO; glutathione S-transferase |
| ko00980 | metabolism of xenobiotics by cytochrome P450 | glutathione S-transferase P 1 isoform X1; S-crystallin SL11; S-crystallin SL11-like; glutathione S-transferase |
| ko00232 | caffeine metabolism | xanthine dehydrogenase/oxidase |
| Reoxygenation (R) vs. Hypoxia (H) | ||
| ko00232 | caffeine metabolism | xanthine dehydrogenase/oxidase-like; xanthine dehydrogenase; uricase-like |
Supplementary Materials
The following supporting information can be downloaded at
References
1. Gong, S.B.; Gao, A.G.; Ni, G.T.; Zhu, X.X.; Zhang, Y.P.; Hou, Y.T. Progress in Research of Hypoxia in Estuaries and Coastal Areas in China. Water Resour. Prot. China; 2017; 33, pp. 62-69.
2. Wang, T. The Molecular Mechanism of Hypoxia Signal Pathway in the Pacific Oyster (Crassostrea gigas). Ph.D. Thesis; Institute of Oceanology, Chinese Academy of Sciences: Beijing, China, 2017.
3. Rabalais, N.N.; Turner, R.E.; Wiseman, W.J., Jr. Hypoxia in the Gulf of Mexico. J. Environ. Qual.; 2001; 30, pp. 320-329. [DOI: https://dx.doi.org/10.2134/jeq2001.302320x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11285891]
4. Jeppesen, R.M.; Rodriguez, M.; Rinde, J.; Haskins, J.; Hughes, B.B.; Mehner, L.; Wasson, K. Effects of Hypoxia on Fish Survival and Oyster Growth in a Highly Eutrophicestuary. Estuar. Coasts; 2016; 41, pp. 89-98. [DOI: https://dx.doi.org/10.1007/s12237-016-0169-y]
5. Vaquer-Sunyer, R.; Duarte, C.M. Thresholds of Hypoxia for Marine Biodiversity. Proc. Natl. Acad. Sci. USA; 2008; 105, pp. 15452-15457. [DOI: https://dx.doi.org/10.1073/pnas.0803833105]
6. Lam, K.; Morto, B. The Oysters of Hong Kong (Bivalvia: Ostreidae and Gryphaeidae). Raffles Bull. Zool.; 2004; 52, pp. 11-28.
7. Li, X. Studies on the Nutrient Budgets and Characteristics of Hypoxia in the Changjiang Estuary Key Laboratory of Marine Ecology and Environmental Science. Ph.D. Thesis; Institute of Oceanology, Chinese Academy of Sciences: Beijing, China, 2011.
8. Zhang, W.B.; Lu, Z.B.; Zhang, Y.; Chen, J.Q.; Li, F.; Zheng, L.; Cong, X.R. Influence of Hypoxia Stress on Physiological Metabolism of Ruditapes philippinarum. Chin. J. Ecol.; 2014; 33, 6.
9. Sobral, P.; Widdows, J. Influence of Hypoxia and Anoxia on the Physiological Responses of the Clam Ruditapes decussatus from Southern Portugal. Mare Biol.; 1997; 127, pp. 455-461. [DOI: https://dx.doi.org/10.1007/s002270050033]
10. Baker, S.M.; Mann, R. Effects of Hypoxia and Anoxia on Larval Settlement, Juvenile Growth, and Juvenile Survival of the Oyster Crassostrea virginica. Biol. Bull.; 1992; 182, pp. 265-269. [DOI: https://dx.doi.org/10.2307/1542120]
11. Wei, S.S.; Xie, Z.; Liu, C.H.; Sokolova, I.; Sun, B.Y.; Mao, Y.R.; Xiong, K.; Peng, J.X.; Fang, J.K.H.; Hu, M.H. et al. Antioxidant Response of the Oyster Crassostrea hongkongensis Exposed to Diel-cycling Hypoxia under Different Salinities. Mar. Environ. Res.; 2022; 179, 105705. [DOI: https://dx.doi.org/10.1016/j.marenvres.2022.105705]
12. Greenway, S.C.; Storey, K.B. Effects of Seasonal Change and Prolonged Anoxia on Metabolic Enzymes of Littorina littorea. Can. J. Zool.; 2001; 79, pp. 907-915. [DOI: https://dx.doi.org/10.1139/z01-056]
13. Le Moullac, G.; Bacca, H.; Huvet, A.; Moal, J.; Pouvreau, S.; Van Wormhoudt, A. Transcriptional Regulation of Pyruvate Kinase and Phosphoenolpyruvate Carboxykinase in the Adductor Muscle of the Oyster Crassostrea gigas during Prolonged Hypoxia. J. Exp. Zool. A Ecol. Genet. Physiol.; 2007; 307, pp. 371-382. [DOI: https://dx.doi.org/10.1002/jez.390]
14. Yan, L.L.; Li, Y.C.; Wang, Z.P.; Su, J.Q.; Yu, R.H.; Yan, X.W.; Ma, P.Z.; Cui, Y.T. Stress Response to Low Temperature: Transcriptomic Characterization in Crassostrea sikamea × Crassostrea angulata Hybrids. Aquac. Res.; 2018; 49, pp. 3374-3385. [DOI: https://dx.doi.org/10.1111/are.13801]
15. Meng, X.L.; Liu, M.; Jiang, K.Y.; Wang, B.J.; Tian, X.; Sun, S.J.; Luo, Z.Y.; Qiu, C.W.; Wang, L. De Novo Characterization of Japanese Scallop Mizuhopecten yessoensis Transcriptome and Analysis of Its Gene Expression Following Cadmium Exposure. PLoS ONE; 2013; 8, e64485. [DOI: https://dx.doi.org/10.1371/journal.pone.0064485]
16. Li, W.; Zhang, X.Z.; He, P.P.; Jiang, L.Y.; Zhang, L.; Guan, J.L.; Chen, Y.X.; Zheng, Y.S.; Wei, P.Y.; Peng, J.X. Transcriptional Responses of Crassostrea hongkongensis under High and Low Salinity Stress. Comp. Biochem. Physiol. Part. D Genom. Proteom.; 2024; 49, 101188. [DOI: https://dx.doi.org/10.1016/j.cbd.2024.101188]
17. Hall, S.; Méthé, D.; Stewart-Clark, S.; Clark, F. Size and Site Specific Transcriptomic Responses of Blue Mussel (Mytilus Edulis) to Acute Hypoxia. Mar. Genom.; 2023; 71, 101060. [DOI: https://dx.doi.org/10.1016/j.margen.2023.101060] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37567081]
18. Yang, C.Y.; Wu, H.L.; Chen, J.Y.; Liao, Y.S.; Mkuye, R.; Deng, Y.W.; Du, X.D. Integrated Transcriptomic and Metabolomic Analysis Reveals the Response of Pearl Oyster (Pinctada fucata martensii) to Long-term Hypoxia. Mar. Environ. Res.; 2023; 191, 106133. [DOI: https://dx.doi.org/10.1016/j.marenvres.2023.106133] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37586225]
19. Zhang, Q.; Lu, Y.Q.; Zheng, H.P.; Liu, H.L.; Li, S.K. Differential Immune Response of Vitellogenin Gene to Vibrio Anguillarum in Noble Scallop Chlamys nobilis and Its Correlation with Total Carotenoid Content. Fish Shellfish Immunol.; 2016; 50, pp. 11-15. [DOI: https://dx.doi.org/10.1016/j.fsi.2016.01.001]
20. Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie Enables Improved Reconstruction of a Transcriptome from RNA-seq Reads. Nat. Biotechnol.; 2015; 33, pp. 290-295. [DOI: https://dx.doi.org/10.1038/nbt.3122]
21. Buchfink, B.; Xie, C.; Huson, D.H. Fast and Sensitive Protein Alignment using DIAMOND. Nat. Methods; 2015; 12, pp. 59-60. [DOI: https://dx.doi.org/10.1038/nmeth.3176]
22. Deng, Y.Y.; Li, J.Q.; Wu, S.F.; Zhu, Y.P.; Chen, Y.W.; He, F.C. Integrated Nr Database in Protein Annotation System and Its Localization. Chin. J. Comput. Eng.; 2006; 32, pp. 71-74.
23. Apweiler, R.; Bairoch, A.; Wu, C.H.; Barker, W.C.; Boeckmann, B.; Ferro, S.; Gasteiger, E.; Huang, H.Z.; Lopez, R.; Magrane, M. et al. UniProt: The Universal Protein Knowledgebase. Nucleic Acids Res.; 2004; 32, pp. D115-D119. [DOI: https://dx.doi.org/10.1093/nar/gkh131] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/14681372]
24. Tatusov, R.L.; Galperin, M.Y.; Natale, D.A. The COG database: A Tool for Genome Scale Analysis of Protein Functions and Evolution. Nucleic Acids Res.; 2000; 28, pp. 33-36. [DOI: https://dx.doi.org/10.1093/nar/28.1.33] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/10592175]
25. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T. et al. Gene Ontology: Tool for the Unification of Biology. The Gene Ontology Consortium. Nat. Genet.; 2000; 25, pp. 25-29. [DOI: https://dx.doi.org/10.1038/75556] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/10802651]
26. Koonin, E.V.; Fedorova, N.D.; Jackson, J.D.; Jacobs, A.R.; Krylov, D.M.; Makarova, K.S.; Mazumder, R.; Mekhedov, S.L.; Nikolskaya, A.N.; Rao, B.S. et al. A Comprehensive Evolutionary Classification of Proteins Encoded in Complete Eukaryotic Genomes. Genome Biol.; 2004; 5, R7. [DOI: https://dx.doi.org/10.1186/gb-2004-5-2-r7]
27. Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene Ontology Analysis for RNA-seq: Accounting for Selection Bias. Genome Biol.; 2010; 11, R14. [DOI: https://dx.doi.org/10.1186/gb-2010-11-2-r14]
28. Mao, X.Z.; Cai, T.; Olyarchuk, J.G.; Wei, L.P. Automated Genome Annotation and Pathway Identification Using the KEGG Orthology (KO) as a Controlled Vocabulary. Bioinformatics; 2005; 21, pp. 3787-3793. [DOI: https://dx.doi.org/10.1093/bioinformatics/bti430]
29. Lee, Y.; Byeon, E.; Kim, D.H.; Maszczyk, P.; Wang, M.; Wu, R.S.S.; Jeung, H.D.; Hwang, U.K.; Lee, J.S. Hypoxia in Aquatic Invertebrates: Occurrence and Phenotypic and Molecular Responses. Aquat. Toxicol.; 2023; 263, 106685. [DOI: https://dx.doi.org/10.1016/j.aquatox.2023.106685]
30. Collins, M.; Truebano, M.; Verberk, W.C.E.P.; Spicer, J.I. Do Aquatic Ectotherms Perform Better under Hypoxia After Warm Acclimation?. J. Exp. Biol.; 2021; 224, jeb232512. [DOI: https://dx.doi.org/10.1242/jeb.232512]
31. Mandic, M.; Flear, K.; Qiu, P.; Pan, Y.K.; Perry, S.F.; Gilmour, K.M. Aquatic Surface Respiration Improves Survival During Hypoxia in Zebrafish (Danio rerio) Lacking Hypoxia-Inducible Factor 1-α. Proc. Biol. Sci.; 2022; 289, 20211863. [DOI: https://dx.doi.org/10.1098/rspb.2021.1863]
32. David, E.; Tanguy, A.; Pichavant, K.; Moraga, D. Response of the Pacific Oyster Crassostrea gigas to Hypoxia Exposure under Experimental Conditions. FEBS J.; 2010; 272, pp. 5635-5652. [DOI: https://dx.doi.org/10.1111/j.1742-4658.2005.04960.x]
33. Li, Q.; Sun, S.; Zhang, F.; Wang, M.X.; Li, M.N. Effects of Hypoxia on Survival, Behavior, Metabolism and Cellular Damage of Manila Clam (Ruditapes philippinarum). PLoS ONE; 2019; 14, e0215158. [DOI: https://dx.doi.org/10.1371/journal.pone.0215158]
34. Jing, H.; Liu, Z.H.; Wu, B.; Tu, K.; Liu, Z.M.; Sun, X.J.; Zhou, L.Q. Physiological and Molecular Responses to Hypoxia Stress in Manila Clam Ruditapes philippinarum. Aquat. Toxicol.; 2023; 257, 106428. [DOI: https://dx.doi.org/10.1016/j.aquatox.2023.106428]
35. Larade, K.; Storey, K.B. A Profile of the Metabolic Responses to Anoxia in Marine Invertebrates. Cell Mol. Response Stress; 2002; 3, pp. 27-46.
36. Yang, C.Y.; Wang, X.B.; Zhou, K.; Jiang, D.L.; Shan, Y.; Wang, L.L.; Song, L.S. Effect of High Temperature Stress on Glycogen Metabolism in Gills of Yesso Scallop Patinopecten yessoensis. Fish Shellfish Immunol.; 2023; 138, 108786. [DOI: https://dx.doi.org/10.1016/j.fsi.2023.108786] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37169110]
37. Meng, J.; Wang, T.; Li, L.; Zhang, G. Inducible Variation in Anaerobic Energy Metabolism Reflects Hypoxia Tolerance Across the Intertidal and Subtidal Distribution of the Pacific Oyster (Crassostrea gigas). Mar. Environ. Res.; 2018; 138, pp. 135-143. [DOI: https://dx.doi.org/10.1016/j.marenvres.2018.04.002]
38. Xu, S.Y.; Mo, Y.H.; Liu, Y.J.; Wang, X.; Li, H.Y.; Yang, W.D. Physiological and Genetic Responses of the Benthic Dinoflagellate Prorocentrum Lima to Polystyrene Microplastics. Harmful Algae; 2024; 136, 102652. [DOI: https://dx.doi.org/10.1016/j.hal.2024.102652]
39. Andreyeva, A.Y.; Gostyukhina, O.L.; Kladchenko, E.S.; Vodiasova, E.A.; Chelebieva, E.S. Acute Hypoxic Exposure: Effect on Hemocyte Functional Parameters and Antioxidant Potential in Gills of the Pacific Oyster, Crassostrea gigas. Mar. Environ. Res.; 2021; 169, 105389. [DOI: https://dx.doi.org/10.1016/j.marenvres.2021.105389] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34171591]
40. Amorim, K.; Piontkivska, H.; Zettler, M.L.; Sokolov, E.; Hinzke, T.; Nair, A.M.; Sokolova, I.M. Transcriptional Response of Key Metabolic and Stress Response Genes of a Nuculanid Bivalve, Lembulus Bicuspidatus from an Oxygen Minimum Zone Exposed to Hypoxia-Reoxygenation. Comp. Biochem. Physiol. B Biochem. Mol. Biol.; 2021; 256, 110617. [DOI: https://dx.doi.org/10.1016/j.cbpb.2021.110617]
41. Wang, Y.H.; Zhang, X.M. The Critical Roles of Mitochondrial Alternative Chains in Juvenile Ark Shells (Anadara broughtonii) Exposed to Acute Hypoxia with or without Sulfide. Aquat. Toxicol.; 2021; 241, 105996. [DOI: https://dx.doi.org/10.1016/j.aquatox.2021.105996]
42. Yusseppone, M.S.; Rocchetta, I.; Sabatini, S.E.; Luquet, C.M.; Ríos de Molina, M.D.C.; Held, C.; Abele, D. Corrigendum: Inducing the Alternative Oxidase Forms Part of the Molecular Strategy of Anoxic Survival in Freshwaterbivalves. Front. Physiol.; 2018; 9, 330. [DOI: https://dx.doi.org/10.3389/fphys.2018.00330]
43. Rahman, M.S.; Thomas, P. Molecular Characterization and Expression of Cytochrome P450 Aromatase in Atlantic Croaker Brain: Regulation by Antioxidant Status and Nitric Oxide Synthase During Hypoxia Stress. Front. Physiol.; 2021; 12, 720200. [DOI: https://dx.doi.org/10.3389/fphys.2021.720200]
44. Zafari, S.; Vanlerberghe, G.C.; Igamberdiev, A.U. The Role of Alternative Oxidase in the Interplay between Nitric Oxide, Reactiveoxygen Species, and Ethylene in Tobacco (Nicotiana tabacum L.) Plants Incubated under Normoxic and Hypoxic Conditions. Int. J. Mol. Sci.; 2022; 23, 7153. [DOI: https://dx.doi.org/10.3390/ijms23137153]
45. Châtel, A.; Murillo, L.; Bourdin, C.M.; Quinchard, S.; Picard, D.; Legros, C. Characterization of Tyramine β-hydroxylase, an Enzyme Upregulated by Stress in Periplaneta americana. J. Mol. Endocrinol.; 2013; 50, pp. 91-102. [DOI: https://dx.doi.org/10.1530/JME-12-0202]
46. Kuo, H.W. Tyramine Beta Hydroxylase-mediated Octopamine Synthesis Pathway in Litopenaeus vannamei Under Thermal, Salinity, and Vibrio Alginolyticus Infection Stress. Fish Shellfish Immunol.; 2023; 142, 109096. [DOI: https://dx.doi.org/10.1016/j.fsi.2023.109096]
47. Kuo, H.W.; Cheng, W. Cloning and Characterization of a Key Enzyme in Octopaminergic Pathway: Tyramine Beta-hydroxylase from Litopenaeus vannamei, as Expressed During Vibrio Alginolytics Infection and Hypothermal Stress. Fish Shellfish Immunol.; 2021; 119, pp. 1-10. [DOI: https://dx.doi.org/10.1016/j.fsi.2021.09.036] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34600115]
48. Guzy, R.D.; Schumacker, P.T. Oxygen Sensing by Mitochondria at Complex III: The Paradox of Increased Reactive Oxygen Species During Hypoxia. Exp. Physiol.; 2006; 91, pp. 807-819. [DOI: https://dx.doi.org/10.1113/expphysiol.2006.033506] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16857720]
49. Fridovich, I. The Biology of Oxygen Radicals. Science; 1978; 201, pp. 875-880. [DOI: https://dx.doi.org/10.1126/science.210504] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/210504]
50. Qian, Z.M.; Xu, M.F.; Tang, P.L. Superoxide Dismutase Does Protect the Cultured Rat Cardiac Myocytes Against Hypoxia/Reoxygenation Injury. Free Radic. Res.; 1997; 27, pp. 13-21. [DOI: https://dx.doi.org/10.3109/10715769709097833]
51. Gostyukhina, O.L.; Yu, A.A.; Chelebieva, E.S.; Vodiasova, E.A.; Lantushenko, A.O.; Kladchenko, E.S. Adaptive Potential of the Mediterranean Mussel Mytilus galloprovincialis to Short-term Environmental Hypoxia. Fish Shellfish Immunol.; 2022; 131, pp. 654-661. [DOI: https://dx.doi.org/10.1016/j.fsi.2022.10.052]
52. Pei, X.Y.; Chu, M.X.; Tang, P.; Zhang, H.Y.; Zhang, X.Y.; Zheng, X.; Li, J.; Mei, J.; Wang, T.; Yin, S.W. Effects of Acute Hypoxia and Reoxygenation on Oxygen Sensors, Respiratory Metabolism, Oxidative Stress, and Apoptosis in Hybrid Yellow Catfish "Huangyou-1". Fish Physiol. Biochem.; 2021; 47, pp. 1429-1448. [DOI: https://dx.doi.org/10.1007/s10695-021-00989-8]
53. Tomarev, S.I.; Zinovieva, R.D.; Piatigorsky, J. Characterization of Squid Crystallin Genes. Comparison with Mammalian Glutathione S-transferase Genes. J. Biol. Chem.; 1992; 267, pp. 8604-8612. [DOI: https://dx.doi.org/10.1016/S0021-9258(18)42486-6] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/1373730]
54. Laborde, E. Glutathione Transferases as Mediators of Signaling Pathways Involved in Cell Proliferation and Cell Death. Cell Death Differ.; 2010; 17, pp. 1373-1380. [DOI: https://dx.doi.org/10.1038/cdd.2010.80] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20596078]
55. Saetan, W.; Tian, C.; Yu, J.; Lin, X.; He, F.; Huang, Y.; Shi, H.; Zhang, Y.; Li, G. Comparative Transcriptome Analysis of Gill Tissue in Response to Hypoxia in Silver Sillago (Sillago sihama). Animals; 2020; 10, 628. [DOI: https://dx.doi.org/10.3390/ani10040628] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32268576]
56. Nie, H.T.; Wang, H.M.; Jiang, K.Y.; Yan, X.W. Transcriptome Analysis Reveals Differential Immune Related Genes Expression in Ruditapes philippinarum Under Hypoxia Stress: Potential HIF and NF-κB Crosstalk in Immune Responses in Clam. BMC Genom.; 2020; 21, 318. [DOI: https://dx.doi.org/10.1186/s12864-020-6734-6]
57. Yu, Y.; He, J.; Liu, W.H.; Li, Z.M.; Weng, S.P.; He, J.G.; Guo, C.J. Molecular Characterization and Functional Analysis of Hypoxia-Responsive Factor Prolyl Hydroxylase Domain 2 in Mandarin Fish (Siniperca chuatsi). Animals; 2023; 13, 1556. [DOI: https://dx.doi.org/10.3390/ani13091556]
58. Liu, B.H.; Wen, H.S.; Yang, J.; Li, X.H.; Li, G.L.; Zhang, J.R.; Wu, S.X.; Butts, I.A.; He, F. Hypoxia affects HIF-1/LDH-A Signaling Pathway by Methylation Modification and Transcriptional Regulation in Japanese Flounder (Paralichthys olivaceus). Biology; 2022; 11, 1233. [DOI: https://dx.doi.org/10.3390/biology11081233]
59. Xiao, W. The Hypoxia Signaling Pathway and Hypoxic Adaptation in Fishes. Sci. China Life Sci.; 2015; 58, pp. 148-155. [DOI: https://dx.doi.org/10.1007/s11427-015-4801-z]
60. Schofield, C.J.; Ratcliffe, P.J. Oxygen Sensing by HIF Hydroxylases. Nat. Rev. Mol. Cell. Biol.; 2004; 5, pp. 343-354. [DOI: https://dx.doi.org/10.1038/nrm1366]
61. Zhang, E.H.; Zhang, J.H.; Jin, J.; Qin, J.; Li, H.J.; Huang, L. Variants of the Low Oxygen Sensors EGLN1 and HIF-1AN Associated with Acute Mountain Sickness. Int. J. Mol. Sci.; 2014; 15, pp. 21777-21787. [DOI: https://dx.doi.org/10.3390/ijms151221777]
62. Nguyen, T.L.; Durán, R.V. Prolyl Hydroxylase Domain Enzymes and Their Role in Cell Signaling and Cancer Metabolism. Int. J. Biochem. Cell Biol.; 2016; 80, pp. 71-80. [DOI: https://dx.doi.org/10.1016/j.biocel.2016.09.026]
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Peng, Jinxia