1. Introduction
Eriocheir japonica sinensis, commonly known as the river crab, belongs to Arthropoda, Crustacea, Decapoda, Grapsidae, Varuninae, and Eriocheir [1,2]. This species is a migratory crustacean that grows and matures in freshwater lakes but reproduces in seawater [3]. Known for its high quality and economic value, E. j. sinensis plays a pivotal role in aquaculture [4,5]. As an omnivorous crustacean [6], it thrives in freshwater rivers characterized by clear waters and abundant aquatic plants [7].
The aquaculture water environment significantly affects the growth of the Chinese mitten crab, with ammonia and other water quality factors playing a central role [8]. Intensive farming practices often result in the breakdown of protein feed and heterotrophic bacterial metabolites, with decreased dissolved oxygen (DO) levels impairing the nitrifying bacterial activity, thus limiting ammonia degradation. Consequently, ammonia accumulation is a critical factor influencing river crab cultivation. Ammonia is one of the primary environmental stressors in aquaculture, leading to reduced growth rates, tissue damage, and high mortality in E. j. sinensis [9].
As water temperatures decrease and gonadal development begins, crabs initiate migration, during which the hepatopancreas supplies essential energy and materials. In crustaceans, the hepatopancreas is vital for digestion and detoxification [10,11]. It serves as the primary site for lipid and carbohydrate metabolism, energy storage and expenditure, and the digestion, absorption, and secretion of nutrients [12]. Previous research has demonstrated that high ammonia concentrations elevate oxygen consumption, impair osmoregulation, affect molting frequency, and damage the hepatopancreas, resulting in increased mortality in crustaceans [9,13]. Several studies have also reported that varying ammonia levels impact the immune function and tissue structure of the hepatopancreas in E. j. sinensis [7,14], with similar findings observed in Portunus trituberculatus [15] and Scylla paramamosain [16]. These insights emphasize the importance of maintaining optimal water conditions during river crab cultivation to support healthy growth.
Given the absence of immunoglobulin-mediated adaptive immunity in fish and crustaceans, their defense mechanisms primarily rely on phagocytosis and encapsulation by hemocytes. Hemocytes are the primary cellular components of the crustacean immune system, responsible for clearing pathogens through adhesion, phagocytosis, and the production of reactive oxygen species (ROS) [17]. Elevated ammonia concentrations reduce blood lymphocyte counts and hemocyanin levels, inhibit hemocyte phagocytic activity, and diminish lysozyme and phenol oxidase activity, ultimately compromising the immune defense system, including non-specific immune cells and hemolymph immune response factors [18,19,20]. The fluctuation of antioxidant indices in hemolymph and the hepatopancreas is an indicator of the overall health status of aquatic species [21]. Numerous studies have explored the effects of high ammonia exposure on aquatic organisms, including Marsupenaeus japonicas [13], Litopenaeus vannamei [22], Dicentrarchus labrax [23,24], Macrobrachium acanthurus [25], Portunus trituberculatus, and E. j. sinensis [26]. However, molecular studies examining the hepatopancreas and hemolymph of E. j. sinensis under ammonia stress remain limited. This research holds substantial value in elucidating the autoimmune mechanisms of E. j. sinensis and contributing to its sustainable aquaculture, providing essential data for ensuring the species’ healthy cultivation.
2. Materials and Methods
2.1. Laboratory Animals and Temporary Management
The experimental animal is E. j. sinensis, which was purchased from a market in Yancheng, Jiangsu Province, China. Twenty Chinese mitten crabs were randomly selected and dried with filter paper to measure their body weight and length. The average wet weight and length was 44.96 ± 4.84 g and 4.5 ± 0.27 cm, respectively. Before the start of the experiment, the Chinese mitten crabs were temporarily raised in a plastic bucket (measuring 860 mm in length, 630 mm in width, and 480 mm in height) for 15 days. During the temporary cultivation period, the water was changed daily. The water used in the experiment was tap water that had been left to stand for 24 h. The natural light period was maintained, they were fed at a fixed time every day using TONGWEI FEED from China, and they were provided with sufficient oxygen. The health of the Chinese mitten crabs was observed daily, and any dead crabs were removed promptly.
2.2. Acute Ammonia Stress Experiment
Firstly, 10 ± 0.01 g of NH4Cl (Sinopharm Chemical Reagent Co., Ltd., Shanghai, China) were weighed. The fully aerated tap water was then dissolved in a 500 mL beaker, and the volume was adjusted in a 1 L capacity bottle to create a 10 g/L solution. Based on pre-experiment, the 96 h semi-lethal concentration of NH4Cl was calculated, determining the safe concentration to be 249.13 mg/L. At this concentration, ammonia levels were set to 0, 100 mg/L, 300 mg/L and 600 mg/L. One hundred and eighty Chinese mitten crabs of similar size, with normal, healthy, lively bodies, and intact appendages were selected. They were divided into four groups of 45 crabs each. These 45 crabs were placed into three white plastic pots (46 cm in length, 32 cm in width, and 15 cm in height) and exposed to varying concentrations of ammonia for 96 h. Throughout the experiment, the solution in the containers was replaced daily with a new solution containing the same concentration of ammonium chloride. Feed was given at scheduled times, and sufficient oxygen was provided. The health of the Chinese mitten crabs was monitored daily, and any dead crabs were removed promptly.
2.3. Sampling and Preservation
The duration of the ammonia stress experiment was 4 d, with samples taken at 24 h, 48 h, 72 h, and 96 h. Six Chinese mitten crabs were randomly selected from each group for sampling. After removing the river crab, hemolymph was collected from the base of the third step, and the extracted hemolymph was immediately mixed with anticoagulant using a 1 mL syringe in a 1:1 ratio. The anticoagulant consisted of NaCl 0.14 mol/L, citric acid 0.03 mol/L, trisodium citrate 0.026 mol/L, glucose 0.1 mol/L, EDTA· Na2 0.01 mol/L, with a pH of 4.6, and sterilized at 121.3 °C for 20 min. The mixture was then centrifuged at 5000× g for 10 min at 4 °C to separate blood cells and blood cell suspensions, which were stored in a cryogenic refrigerator at −80 °C. Blood cells were used for mRNA extraction, while blood cell suspensions were utilized for enzyme activity tests. The hepatopancreas of the crab was promptly removed and stored in a cryogenic refrigerator at −80 °C for further mRNA and enzyme activity experiments, and ensure three biological repeats.
2.4. Histopathological Section
After 96 h of ammonia stress, three hepatopancreases of E. j. sinensis were randomly selected from the control group and the 300 mg/L concentration group, and fixed with 4% formaldehyde for 24 h. The paraffin blocks were cut into 5 μm slices using a slicer (Leica CM1950, Nussloch, Germany), stained with hematoxylin and eosin, fixed with neutral gum, observed under a microscope (Motic, Xiamen, China), and tissue section photos were collected.
2.5. TUNEL Assay
The fresh hepatopancreatic tissue was sliced, then dried and covered with protease K working solution before being placed in an incubator at 37 °C for 22 min. The tissue was washed and decolorized three times for 5 min each using PBS. To create the TUNEL detection solution, TDT enzyme, dUTP, and buffer were mixed at a ratio of 1:5:50 and incubated at 37 °C for 2 h. After incubation, the slices were washed with PBS three times for 5 min each, then DAPI staining solution was added, and they were then incubated in the dark for 10 min. The sections were washed three times for 5 min each with PBS and then sealed with anti-fluorescence quenching before being dried. Finally, the sections were observed under a fluorescence microscope (Leica, Germany) and the images were collected [27].
2.6. Determination of Nonspecific Enzyme Activity
2.6.1. Sample Pretreatment
Three hepatopancreatic tissues of E. j. sinensis were randomly selected from each group after 96 h of ammonia stress. An appropriate amount of hepatopancreas tissue was weighed, and physiological saline was added according to the ratio of weight (g) to volume (mL) of 1:9. The tissue was then mechanically homogenized under ice water bath conditions to create a 10% tissue homogenate. The homogenate was centrifuged at 4 °C and 2500 rpm for 10 min, and the supernatant was taken for detection. The hemolymph was placed on ice to await testing.
2.6.2. Biochemical Analysis
The acid phosphatase (ACP), alkaline phosphatase (AKP), alanine aminotransferase (ALT), triglyceride (TG), catalase (CAT), and total antioxidant capacity (T-AOC) in the hepatopancreatic tissue and hemolymph of E. j. sinensis were determined using the corresponding kit (Jiancheng, Ltd., Nanjing, China) according to the manufacturer’s instructions.
2.7. RNA Extraction, Library Construction, and Illumina Sequencing
According to the manufacturer’s instructions, each hepatopancreas tissue sample was ground with a mortar, and then total RNA was extracted using Trizol reagent (Vazyme, Nanjing, China). The RNA was then analyzed using 1% agarose gel electrophoresis for detection. The isolated RNA was further examined for purity, concentration, and integrity using a Nano Drop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) and an Agient2100/Lab Chip GX bioanalyzer (Agilent, Santa Clara, CA, USA).
Once the samples were qualified, three samples were synthesized from three hepatopancreatic tissues in the treatment group to construct the cDNA library, and then three samples were synthesized from three hepatopancreatic tissues with a concentration of 300 mg/L to construct the cDNA library. The process involved separating mRNA from total RNA using magnetic beads, fragmenting the mRNA with fragmentation buffer, transcribing the mRNA into cDNA using reverse transcriptase, synthesizing the first and second cDNA chains, purifying the cDNA, adding appropriate connectors A-tail and sequencing linker, selecting the fragment size with AM Pure XP beads, and amplifying and enriching the cDNA through polymerase chain reaction to create the cDNA library. After passing the quality inspection, the cDNA library was sequenced in PE150 format using the Illumina Nova Seq 6000 sequencing platform (Illumina, San Diego, CA, USA).
2.8. Transcriptome Analysis and Functional Annotation of Unigenes
The cDNA library was sequenced using the Illumina transcriptome sequencing platform, resulting in the generation of a large amount of raw data. After undergoing a series of quality control procedures, high-quality Clean Data were obtained and provided in FASTQ format to ensure the accuracy of subsequent analyses. The specific filtering methods employed included ensuring that the Reads were of high quality and implementing strict data quality control measures. This involved removing reads containing adapters and filtering out low-quality reads (including those with an N ratio greater than 10% and reads where the Q value was less than or equal to 10 accounting for more than 50% of the read) [28].
Reads obtained by RNA-seq were short fragments of randomly interrupted mRNA, and the obtained high-quality Clean Reads were compared with the reference genome to determine which genes transcribe these Reads. We used the designated as a reference for sequence alignment and subsequent analysis. Version information of reference genome: E. j. sinensis. ASM2467909v1.genome.fa. We used the HISAT2 [29] software (Version 2.2.1) to quickly and accurately compare Clean Reads with the reference genome, and obtained the positioning information of Reads on the reference genome. Then, the reads on the database were assembled using StringTie comparison, and the transcriptome was reconstructed for subsequent analysis.
The output of RNA-seq was sequence fragments (Reads), and the expression level of the gene was calculated according to the number (Count) of each transcript compared with the sequencing reads. We then normalized the number of Mapped Reads and transcript length in the sample. StringTie was used to standardize using the maximum flow algorithm and FPKM [30] (Fragments Per Kilobase of transcript per Million fragments mapped) as an index to measure the expression level of transcripts or genes.
Gene function annotation was carried out using various databases including the National Biotechnology Information Center (NCBI) Non-redundant Protein (NR) database, which links nucleic acid data with protein data; the NCBI Non-redundant Nucleotide Sequence (NT) database; the Swiss-Prot database [31]; the Protein family (PFAM) database [32]; the Protein linear cluster/eukaryote cluster (COG/KOG) database [33]; the Gene ontology (GO) database [34]; and the Kyoto Encyclopedia of Genes and Genomes (KEGG) [35]. Blast2GO software (Version 4.5.1) was utilized to assign GO annotations [36].
2.9. Identification of Differentially Expressed Genes and Gene Enrichment Analysis
By utilizing the TMs method to calculate the expression of a single gene and estimating the gene expression level of each sample, differentially expressed genes (DEGs) between the two libraries were identified. The DESeqR package (1.12.10) was used to analyze the differentially expressed genes in the two libraries [37]. The Count values of genes in different samples were used to screen for differentially expressed genes using differential analysis software, with the screening criteria of a differential multiple being log2(FC) ≥ 1 and p ≤ 0.05.
The DEGs identified above were then analyzed using GOSeqR [38] and KOBAS [39] successively for GO function enrichment and KEGG pathway analysis. Gene enrichment analysis is a method of analyzing gene expression information, which primarily includes gene function enrichment (GO enrichment analysis) and metabolic pathway enrichment analysis (KEGG enrichment analysis).
2.10. Quantitative Real-Time PCR (qRT-PCR)
According to the data obtained from the sequencing of the transcriptome previously submitted for inspection, the RNA extracted from hepatopancreas samples was first reverse transcribed into cDNA using a reverse transcription kit (Vazyme, Nanjing, China). The cDNA, along with the β-actin gene as a reference gene, was then used as a template [40]. Seven differential genes were randomly selected from the sequencing results, and the qRT-PCR method was conducted following established protocols [41]. Gene-specific primers were designed using Primer Premier 5.0 (Table 1) and synthesized by biological companies (GENERAL BIOL, Chuzhou, Anhui, China). The qRT-PCR reaction was performed in a 10 µL volume, containing 5 µL of 2 × SYBR Green qPCR Mix, 0.5 µL of each upstream and downstream primers, 2 µL of cDNA template, and 2 µL of sterilized water. The cycling conditions were as follows: 95 °C for 15 s, 55 °C for 20 s, and 72 °C for 30 s, for a total of 40 cycles. All reactions were performed in triplicate. Gene expression levels were quantified using the 2−ΔΔCT method [42].
2.11. Data Processing
The results are presented as means ± SE. The normality of the experimental data was assessed using SPSS Statistics (Version 20), and differences between groups were evaluated through independent sample t-tests. Statistical significance is indicated by p-values, where p < 0.001 denotes extremely significant differences, p < 0.01 indicates highly significant differences, and p < 0.05 indicates significant differences. Graphs were created using GraphPad Prism 9, with data analysis and statistical evaluations performed using Excel and IBM SPSS Statistics 23.
3. Results and Discussion
3.1. Effect of Ammonia on Histopathology of Hepatopancreas of E. j. sinensis
The histological results of the hepatopancreatic tissue sections are presented in Figure 1. In the control group, the hepatopancreas of E. j. sinensis exhibited a well-preserved structure, with normal hepatic tubules, clear and well-defined boundaries, and an intact basement membrane. The epithelial cells were uniformly arranged, and the epithelium adhered tightly to the underlying cells. Vacuoles were minimal, and the lumen displayed a clear, star-shaped structure. In contrast, in the 300 mg/L ammonia stress group, significant tissue damage was observed. The hepatic tubule morphology was disrupted, the basement membrane was compromised, and the epithelium became detached from the epithelial cells. Both the number and size of vacuoles increased markedly, the stellate structure of the lumen disappeared, and fragmented particulate matter was visible within the lumen. These results indicate that ammonia stress induced notable hepatopancreatic damage in E. j. sinensis, impairing the physiological functions of the organ.
Similar to other aquatic species, the hepatopancreas in E. j. sinensis, as a major immune organ, plays a critical role in detoxification and immune responses. It primarily consists of B cells (secretory cells), E cells (embryonic cells), and R cells (storage cells) [43]. Studies have demonstrated that the hepatopancreas is highly sensitive to external toxins, and the extent of tissue damage often correlates with the severity of toxin exposure. The greater the toxicity, the more severe the damage to hepatopancreatic tissue structure [44]. In this experiment, the hepatopancreas sustained considerable injury. Similar histopathological alterations have been reported by Wang et al. [45], who observed damage in the hepatopancreas of Penaeus vannamei exposed to aflatoxin B1. Additionally, research on Carassius auratus has shown that ammonia stress can cause hepatocyte alterations, such as vacuolization, nuclear shrinkage and dissolution, and blurred cell membrane boundaries [43].
3.2. Effects of Ammonia Stress on Nonspecific Enzyme Activities in Hepatopancreas of E. j. sinensis
Figure 2 illustrates the impact of ammonia exposure on the activities of alkaline phosphatase (AKP, A) and acid phosphatase (ACP, B) in the hepatopancreas of E. j. sinensis. Compared with the control group, the activities of both enzymes initially increased, followed by a decline, and then rose again. However, at a concentration of 300 mg/L ammonia, a significant reduction in enzyme activity was observed (p < 0.05). As ammonia concentration increased, catalase (CAT, C) activity in the hepatopancreas also showed a dose-dependent increase, with significantly higher activity in the treatment group compared to the control (p < 0.05). As ammonia concentration increased, malondialdehyde (MDA, D) levels rose in a concentration-dependent manner. Alanine aminotransferase (ALT, E) activity in the hepatopancreas of E. j. sinensis gradually increased after 96 h of ammonia stress, peaking at 300 mg/L, before declining. Nevertheless, ALT activity remained higher than in the control group. In Figure 2F, triglyceride (TG) levels in the hepatopancreas of E. j. sinensis decreased progressively over 96 h of ammonia stress and were significantly lower than those in the control group (p < 0.05).
AKP and ACP play vital roles in the non-specific immune defense of crustaceans, participating in hydrolysis processes by transferring and metabolizing phosphate groups to eliminate foreign substances and maintain health [46]. Molina et al. demonstrated that ACP and AKP activities in the liver of Oreochromis mossambicus significantly increased after exposure to Microcystis aeruginosa for 21 days [47]. Similarly, Qin et al. reported that ACP activity in the hemolymph of Sinopotamon henanensis initially rose and then decreased under acute cadmium exposure [48]. The fluctuations in AKP and ACP activities observed in this study suggest that ammonia stress could compromise the non-specific immune defenses of E. j. sinensis. We further hypothesize that the abnormal activity levels of these enzymes may indicate hepatopancreatic damage and dysfunction.
CAT is a crucial enzyme in cellular antioxidant defense mechanisms and plays a vital role in the biological defense system. Predominantly found in peroxisomes and microsomes, CAT decomposes hydrogen peroxide (H2O2) into molecular oxygen and water, preventing H2O2 from reacting with O2− to form harmful hydroxyl radicals (·OH). This action protects against the peroxidation of unsaturated fatty acids in biological membranes, reducing the fluidity of the cell membrane and preventing damage to nucleic acids and chromosomes [44,49]. Similar findings have been observed in other aquatic species. For example, in Pelteobagrus fulvidraco, hepatic CAT activity increased after 96 h of ammonia stress [50], and after 24 h of ammonia exposure, liver CAT activity also showed an increase [51]. These results align with those of the present study, where CAT activity in the hepatopancreas of E. j. sinensis increased following ammonia exposure. This suggests that changes in ammonia concentration in the aquatic environment induce oxidative stress in aquatic organisms, leading to excessive production or accumulation of ROS, which can cause cellular damage. In response, the organism’s antioxidant defense system is activated, including an increase in antioxidant enzyme activity such as CAT.
MDA is a lipid peroxidation product that serves as an indicator of oxidative damage in organisms [52]. The findings of this study indicate that ammonia stress elevates MDA levels in the hepatopancreas of E. j. sinensis. Increased MDA content suggests that the organism is under oxidative stress, and the antioxidant system is unable to adequately remove excess ROS, resulting in severe lipid membrane peroxidation and subsequent tissue and cellular damage [53]. Similar observations have been made in other aquatic studies. For instance, Li et al. demonstrated that MDA content in the liver of Pelteobagrus fulvidraco increased after both 96 h and 56 days of ammonia stress [54,55]. These results are consistent with the upward trend in MDA levels observed in E. j. sinensis under ammonia stress in this study, all of which suggest that environmental stress leads to elevated MDA levels in aquatic organisms, reflecting oxidative stress and tissue damage.
ALT primarily resides in the cytoplasm of hepatocytes. As a key biomarker for liver function, ALT levels are instrumental in preliminarily assessing hepatopancreatic damage and the extent of liver dysfunction [56]. A marked increase in ALT levels is indicative of significant hepatopancreatic injury and heightened cellular permeability [57]. In this experiment, ALT levels increased notably following 96 h of ammonia exposure at a concentration of 300 mg/L, suggesting that ammonia stress may lead to hepatopancreatic tissue damage and increased membrane permeability. This finding aligns with previous studies, where ammonia exposure elevated ALT levels in Paramud and Cyprinus carpio [58,59].
Lipids are a key energy source for E. j. sinensis. In a study by Wang et al., diets supplemented with FDPA freeze-dried powder significantly reduced TG levels in the hepatopancreas of Penaeus vannamei compared to a control diet [60]. Similarly, Xu et al. demonstrated that stimulating mouse adipocytes with endoplasmic reticulum stress-inducing agents inhibited TG decomposition [61]. It is hypothesized that, in response to increasing ammonia concentrations, the organism accelerates TG breakdown to generate more ATP, compensating for the hepatopancreatic damage caused by ammonia stress.
3.3. Detection of Apoptosis in TUNEL Cells
As depicted in Figure 3, the control group exhibited a small number of apoptotic cells in the hepatopancreas, with an apoptosis rate of 3.33%. In contrast, the group exposed to 300 mg/L ammonia showed a significantly higher proportion of apoptotic cells, with an apoptosis rate of 8.70%, representing an increase of 5.37%. These results indicate a substantial rise in apoptosis compared to the control group. It is hypothesized that ammonia stress at 300 mg/L may impair antioxidant enzyme function and suppress the antioxidant defense system in E. j. sinensis, leading to elevated levels of the lipid peroxidation product MDA. This increase in MDA is believed to drive a significant rise in apoptosis, thereby causing damage to hepatopancreatic tissue and overall organ function.
TdT-mediated dUTP nick-end labeling (TUNEL) is an immunodetection method that visually displays the distribution of apoptotic cells within tissue and provides an intuitive means of quantifying cell apoptosis. Based on tissue dynamics research, the body has a natural mechanism for recognizing and eliminating apoptotic cells. When large numbers of apoptotic cells are present, phagocytes function to remove them in a timely manner, thus maintaining a certain level of regulation [44]. However, when this mechanism is compromised, apoptotic cells may accumulate within the body. Zou et al. demonstrated that exposure to perfluorooctanoic acid (PFOA) during pregnancy significantly induced apoptosis in the lung tissue cells of pregnant rats, with an apoptosis rate approaching 40% [62]. Similarly, cadmium exposure triggered the expression of the caspase-3A gene in carp, leading to apoptosis in liver cells [63]. Research by Rebecca and David further revealed that chemical and physical stress could induce apoptosis in sea urchin embryos [44], while Chang et al. found that temperature stress could lead to apoptosis in Litopenaeus vannamei [64]. Ammonia exposure induced oxidative stress (decreased SOD activity and increased MDA content) in Litopenaeus vannamei, which led to apoptosis of the hepatopancreas [65]. These results underscore the role of environmental stressors in causing oxidative stress and apoptosis, paralleling the observed effects of ammonia stress in E. j. sinensis in this study.
3.4. Effect of Ammonia Stress on Hemolymph Nonspecific Enzyme Activity of E. j. sinensis
Figure 4 shows the effect of ammonia exposure on the activities of AKP (A) and ACP (B) in the hemolymph of E. j. sinensis. Initially, AKP and ACP activities increased, then declined, followed by another rise. At a concentration of 300 mg/L ammonia, enzyme activity significantly decreased (p < 0.05).
Figure 4C illustrates the effect of ammonia stress on hemocyanin content in E. j. sinensis. Following 24 h of ammonia exposure, hemocyanin levels initially increased, then decreased, followed by another increase, all of which were significantly higher than those in the control group (p < 0.05). After 48 h of stress, hemocyanin levels first declined and then rose again, with significant differences observed across all concentrations. Notably, the 100 mg/L concentration was significantly lower than the control group. By the 72-h mark, hemocyanin levels in the treatment group were significantly higher than those in the control (p < 0.05), with an initial rise followed by a decline after 96 h of ammonia stress, once again significantly higher than the control. After 96 h, hemocyanin content first increased and then decreased, with a notable decrease at high ammonia concentrations.
In contrast to the control group, hemolymph CAT activity increased progressively with ammonia concentration, with CAT activities at 100 mg/L and 300 mg/L reaching the same level (Figure 4D), both significantly higher than the control (p < 0.05). Similarly, total antioxidant capacity (T-AOC) showed a concentration-dependent increase (Figure 4E), with activities at 300 mg/L and 600 mg/L also significantly higher than the control (p < 0.05). This suggests that increasing ammonia concentrations activate the antioxidant mechanisms in E. j. sinensis. Additionally, MDA levels in the hemolymph initially increased and then decreased with rising ammonia concentrations (Figure 4F), with the treatment group exhibiting significantly higher levels than the control (p < 0.05). MDA content peaked at 300 mg/L.
Foreign substances like ammonia can induce stress and damage to the hepatopancreas, subsequently inhibiting the release of AKP and ACP in hemolymph. Previous research has indicated that ammonia has a detrimental effect on the immune systems of aquatic organisms [66,67]. Tian et al. found that under salinity stress, ACP and AKP activities initially increased and then decreased, a trend that mirrors the low-concentration findings in this study [67]. These results suggest that when crustaceans encounter environmental fluctuations, their bodies detect external stressors and activate immune defense mechanisms, leading to an early rise in hemolymph ACP and AKP activities. However, as the stress persists and exceeds the tolerance levels of the crustaceans, it results in damage to the hepatopancreas, thereby inhibiting the release of these enzymes in hemolymph. Consequently, AKP and ACP activities decline during the later stages of stress. In this study, the increased AKP and ACP activities in E. j. sinensis under high-concentration ammonia stress could reflect the organism’s attempt to bolster immune defenses in response to injury and stress. This elevated enzyme activity in the hemolymph might represent the organism’s effort to restore and enhance immune function, compensating for the earlier immune decline caused by hepatopancreatic damage.
Hemocyanin is a unique respiratory protein found in the hemolymph of arthropods. As a multifunctional protein, hemocyanin contains Cu2+ as a cofactor and exhibits various functions, including antibacterial, antiviral, and phenoloxidase activity. It plays a critical role in the immune system and participates in other physiological and biochemical processes [68]. Numerous studies have demonstrated that hemocyanin expression increases in crustaceans under environmental stress [40], aligning with the findings in this study, where the hemocyanin content in E. j. sinensis initially increased after ammonia stress. This suggests that hemocyanin is likely involved in the response of crustaceans to environmental challenges. However, unlike other studies, the hemocyanin content in E. j. sinensis showed a declining trend later in the experiment. This decline may be attributed to the significant physiological stress experienced by E. j. sinensis, which could have impacted the stability or synthesis of hemocyanin, accelerating its breakdown and thereby reducing its overall content. Furthermore, medium and high concentrations of ammonia may interfere with the normal function of hemocyanin in oxygen transport and immune defense, prompting the organism to adjust hemocyanin levels in response to this adverse effect.
Previous studies, such as Liang et al., have reported an increase in MDA concentration in Penaeus vannamei following exposure to high levels of ambient ammonia. Similarly, Huang et al. observed a significant rise in MDA content in the hemolymph of river crabs under high concentrations of avermectin treatment [69]. These findings are consistent with the results of this study, wherein elevated MDA levels indicate that the organism is under oxidative stress, and its antioxidant system is unable to effectively eliminate excessive ROS, leading to severe lipid membrane peroxidation and subsequent tissue and cellular damage. The higher the MDA content, the greater the oxidative stress experienced. MDA can also compromise the crab’s antioxidant defense system, disrupting the function of antioxidant enzymes and causing further damage [53]. However, after exposure to high concentrations of ammonia, a decline in MDA levels was observed. This may be due to the activation of self-regulatory mechanisms in the later stages of ammonia stress, aimed at mitigating oxidative stress damage to tissues and cells.
3.5. Construction and Analysis of Transcriptome Library
In this study, the control group generated 20,791,412, 19,925,204, and 23,122,701 clean reads, corresponding to 6,226,997,816, 5,968,030,201, and 6,924,535,291 nucleotides, respectively. Meanwhile, the treatment groups produced 20,552,156, 20,324,902, and 20,327,981 clean reads, corresponding to 6,151,444,046, 6,084,546,375, and 6,083,545,895 nucleotides, respectively (Table 2).
3.6. Functional Annotations and Classification
To obtain comprehensive functional gene information, 76,091 genes were annotated across seven databases: NR, SwissProt, PFAM, KOG, GO, COG, and KEGG. The number of genes annotated in each database was as follows: NR: 14,602 (19.2%); SwissProt: 7944 (10.4%); PFAM: 14,805 (19.5%); KOG: 10,175 (13.4%); GO: 14,180 (18.6%); COG: 4096 (5.4%); and KEGG: 10,289 (13.5%) (Table 3).
3.7. Identification and Analysis of DEGs
A volcano plot was generated based on these results, showing 4007 differentially expressed genes (DEGs) between the control and treatment groups, with 1838 upregulated and 2169 downregulated genes (Figure 5). In the volcano plot, red dots represent upregulated genes, blue dots represent downregulated genes, and gray dots represent genes with no significant differential expression [70].
The GO classification categorizes gene functions into three primary domains: cellular components (CC), molecular functions (MF), and biological processes (BP). Using the Blast program, 2864 DEGs were classified into these three main categories and further subdivided into 36 additional groups. Within the BP category, the predominant genes were associated with cellular processes, metabolic processes, and biological regulation. For MF, binding and catalytic activity constituted the largest groups, while in CC, most genes were linked to cellular anatomical entities and intracellular structures (Figure 6A).
The KEGG database provides a framework linking genomic and functional information. To further explore the role of DEGs in the immune response of E. j. sinensis to ammonia, KEGG was employed to analyze the enrichment of relevant pathways. In this study, 2608 DEGs were mapped to 249 pathways, which were grouped into four distinct categories (Figure 6B). In the metabolism category, oxidative phosphorylation (54 DEGs) and carbon metabolism (44 DEGs) were most prominent. For genetic information processing, protein processing in the endoplasmic reticulum (36 DEGs) was the most enriched. The environmental information processing category highlighted ECM-receptor interaction and MAPK signaling pathway-fly (25 DEGs). Lastly, the cellular processes category was dominated by lysosome (68 DEGs) and endocytosis (48 DEGs).
The results of KEGG pathway enrichment are illustrated through the KEGG bubble diagram (Figure 7A), displaying the top 20 pathways with the lowest q-values. Notably, the oxidative phosphorylation (ko00190) and lysosome (ko04142) pathways were of particular interest. Gene set enrichment analysis (GSEA) [71] revealed that oxidative phosphorylation was upregulated (Figure 7B), while the lysosome pathway was downregulated (Figure 7C).
Oxidative phosphorylation represents the coupling of ADP and inorganic phosphate to synthesize ATP, driven by the energy released during cellular oxidation through the respiratory chain. This process constitutes the final stage of cellular respiration [72]. Mitochondria, often termed the “powerhouses” of eukaryotic cells, rely heavily on oxidative phosphorylation as a key metabolic function. Among crustaceans, dysfunction in any of the five primary protein complexes (I–IV) is often lethal [73,74] or, at the very least, severely compromises environmental adaptability due to their critical role in energy production [75]. The oxidative phosphorylation pathway is located in the inner mitochondrial membrane and consists of the electron transport chain and ATP synthase, including five complexes: NADH dehydrogenase, succinate dehydrogenase, cytochrome c reductase, cytochrome c oxidase, and ATP synthase (Figure 8A).
Crustaceans, including E. j. sinensis, lack an adaptive immune system and thus predominantly rely on innate immunity to withstand environmental challenges. Innate immunity comprises both cellular and humoral defenses, the latter involving the production of ROS [76]. While low ROS levels exhibit antibacterial effects, elevated ROS levels can damage lipids, proteins, and DNA [77,78]. ROS generation primarily occurs in the mitochondrial oxidative phosphorylation pathway [79], with some ROS production involving cytochrome c oxidase, influencing both mitochondrial oxidative phosphorylation capacity and innate immune responses [80,81].
The lysosomal pathway plays a pivotal role in material metabolism, energy regulation, immune defense, and cellular homeostasis [68,82]. During environmental stress, endocytosis allows the organism to engulf pathogens, transporting them to early endosomes, which subsequently mature into late endosomes. These then fuse with phagosomes and autophagosomes to enter lysosomes for degradation (Figure 8B). Throughout this process, ATP and V-ATPase, provided by metabolic pathways, are indispensable. Studies indicate that V-ATPase hydrolyzes one ATP for every two protons transferred [83]. KEGG pathway enrichment analysis indicated an upregulation of the oxidative phosphorylation pathway, a result corroborated by GSEA analysis (Figure 7B). Oxidative phosphorylation converts the chemical energy of organic molecules into ATP. These results suggest an increase in ATP synthesis, potentially enhancing the proton transfer efficiency of V-ATPase to phagocytes. However, despite this, the lysosomal pathway was downregulated. This downregulation could be attributed to oxidative damage caused by ammonia stress, impairing other metabolic pathways and reducing lysosomal energy supply, thereby compromising immune function.
3.8. qRT-PCR Results
In the oxidative phosphorylation pathway, the core genes are predominantly associated with NADH dehydrogenase subunits (Ndufb11, NuoB, Ndufs4, Ndufv2, Ndufa5, etc.), cytochrome c oxidase subunits (COX7A, COX11, COX6B, COX4, etc.), and the mitochondrial ATP synthase complex (ATP5MF, ATP6V1F, ATPeV0E, etc.) (Figure 8A). Seven genes were randomly selected for validation of differential expression, showing upregulation of Ndufs4, Ndufv2, Ndufa5, COX6A, ATP5MF, and ATPeV0E, while COX11 was downregulated (Figure 9A). Notably, Ndufs4 and ATPeV0E exhibited upregulation by 2.13- and 2.25-fold, respectively, consistent with the KEGG bubble plot trends in the transcriptome. The upregulation of most genes is speculated to enhance ATP production through the oxidative phosphorylation pathway, maintaining immune efficiency. Six immune-related genes—crustin-2, lectin, ALF3, chitinase 3, PPAF2, and CTSB—were also randomly selected, with most showing downregulation by more than two-fold (Figure 9B). This downregulation likely contributes to the observed repression of the lysosomal pathway.
NADH dehydrogenase (ubiquinone) Fe-S protein 4 (Ndufs4), NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), and NADH dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 5 (Ndufa5) are integral components of the NADH dehydrogenase family within mitochondrial respiratory chain complex I, the largest and primary complex responsible for electron transfer via the electron transport chain. These enzymes facilitate the transfer of electrons to FMN, oxidizing NADH to NAD+ while reducing FMN to FMNH2, ultimately transferring electrons to coenzyme Q (UQ), a process essential for cellular energy metabolism [84,85]. The COX complex plays a critical role in electron transfer within the oxidative phosphorylation process and is responsible for generating approximately 90% of the ATP required for muscle energy [86]. Cytochrome c oxidase assembly protein subunit 11 (COX11) and cytochrome c oxidase subunit 6A (COX6A) are key subunits of cytochrome c oxidase. The F-type H+-transporting ATPase subunit f (ATP5MF) and V-type proton ATPase subunit e-like (ATPeV0E) are localized within the mitochondrial inner membrane, facilitating ATP synthesis by promoting ADP phosphorylation under the proton gradient across the membrane [87].
In studies examining the impact of Tralopyril on zebrafish, the downregulation of genes such as Ndufs4 suggested that TP impairs metabolism by disrupting mitochondrial function [88]. Similarly, research on the effects of nano-plastics on zebrafish intestines demonstrated that nano-plastic ingestion induced electron transfer dysfunction and inhibition of mitochondrial oxidative phosphorylation (OXPHOS), leading to Ndufs4 downregulation [89]. In zebrafish embryos, COX6A expression was significantly upregulated after 24 h of PBDE exposure [90]. The seawater-domesticated fish subjected to low-temperature stress exhibit enhanced oxidative phosphorylation to increase energy production [91]. Tine et al. reported the overexpression of oxidative phosphorylation-related genes in the gill tissues of fish exposed to high salinity [92]. These findings align with the results of the current study, where the majority of mitochondrial oxidative phosphorylation core genes in E. j. sinensis were upregulated. It is hypothesized that ammonia stress in E. j. sinensis induces damage to the hepatopancreas and triggers oxidative stress, resulting in excessive ROS production. Mitochondria, being the primary site of ROS production, are particularly susceptible to ROS-induced damage. To mitigate this damage, the organism likely upregulates the oxidative phosphorylation pathway, generating substantial ATP to counteract cellular injury, maintain immune function, and bolster antioxidant capacity.
Antimicrobial peptides such as ALFs and crustins are critical components of the immune defense in crustaceans. The antimicrobial activity of crustin-2 is mediated by its mature peptide region at the C-terminus. In E. j. sinensis, the crustin-2 gene and its recombinant protein exhibit antibacterial properties, with potential applications in drug production, feed additives, preservatives, and as agents to extend product shelf life. Anti-lipopolysaccharide factor 3 (ALF3) and Chitinase 3 play an immunomodulatory role, contributing to the immune response against pathogens. Phenoloxidase-activating factor 2-like (PPAF2) and Lectin, acting as model protein receptors in humoral immunity, provide protection against bacterial invasion and help maintain the body’s physiological integrity. Cathepsin B (CTSB), a key gene in the lysosomal pathway, is involved in immune regulation through its role in antigen processing and presentation, which aids in the initiation of immune responses. Additionally, CTSB influences the regulation of apoptosis by modulating the hydrolytic activity of apoptosis-related proteins.
Research has demonstrated that the expression levels of crustin-2 and lectin mRNA in crayfish infected with White Spot Syndrome Virus (WSSV) are reduced [93]. Conversely, gene expression levels of anti-lipopolysaccharide factors (ALFs) and crustin in Macrobrachium rosenbergii are upregulated following baicalin treatment or Vibrio parahaemolyticus infection [94]. In studies where N-acetylcysteine (NAC) protects E. j. sinensis from T-2 toxin, the mRNA expression of antimicrobial peptides such as ALF3 and crustin-2 is significantly elevated [95]. Additionally, the expression of CTSB mRNA increases substantially in Litopenaeus vannamei after 120 h of starvation [96]. These trends in immune gene regulation within the lysosomal pathways across various crustacean tissues contrast with the findings of the current study. The observed downregulation of immune-related genes in this study may be attributed to oxidative damage induced by ammonia stress, which likely suppresses other metabolic pathways, leading to insufficient energy supply for lysosomal function. As a result, the organism may be unable to sustain its response to damage, causing a downregulation of lysosomal pathways, thereby impairing their associated immune functions.
4. Conclusions
This study identified a substantial number of DEGs through transcriptome analysis and examined the impact of ammonia stress on the immune and antioxidant functions of the hepatopancreas and hemolymph in E. j. sinensis via histopathology, TUNEL assays, and humoral enzyme activity measurements, offering insights into the crustacean immune system. After 96 h of ammonia stress, in order to maintain immune function and antioxidant capacity in response to hepatopancreatic damage caused by excessive ROS, the corresponding reaction mechanism was made. In contrast, the downregulation of immune-related genes and tissue damage appears to be linked to the suppression of the lysosomal pathway, impairing the organism’s ability to sustain its immune response. These findings contribute to a deeper understanding of energy metabolism and immune mechanisms in E. j. sinensis under ammonia stress and provide essential data for supporting the sustainable development of its industry.
X.-R.Z.: conceptualization, methodology writing—original draft. Y.J.: conceptualization and data curation. X.Z.: methodology and investigation. B.-P.T.: conceptualization, supervision, project administration, resources. Q.-N.L.: conceptualization, supervision, project administration, writing—review & editing. All authors have read and agreed to the published version of the manuscript.
The animal study protocol was approved by School of Wetlands, Yancheng Teachers University (20230905).
Not applicable.
The original transcriptome data has been submitted to the NCBI database with the accession number PRJNA1108422.
The authors declare that they have no conflicts of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 1. HE staining of hepatopancreatic tissue structure of E. j. sinensis under ammonia stress. (A), control group; (B), medium-concentration stress group (300 mg/L); Bm, basement membrane; Bc, secretory cell; Ec, embryonic cell; Va, vacuole; Lu, lumen.
![View Image - Figure 2. Effects of ammonia stress on non-specific enzyme activity in E. j. sinensis. (A) AKP in hepatopancreas; (B) ACP in hepatopancreas; (C) CAT in hepatopancreas; (D) MDA in hepatopancreas; (E) ALT in hepatopancreas; (F) TG in hepatopancreas. Different letters (a, b, c, d) indicate significant differences (p [less than] 0.05).](https://media.proquest.com/media/hms/THUM/4/wk5Ma?_a=ChgyMDI1MDUyNzIyMjYwMzgyODo0NDY5NDQSBzEzODMzMjMaCk9ORV9TRUFSQ0giDTIxNi43My4yMTYuNzYqBzIwMzI0MzgyCjMxMjA1MTAyNzg6C0lubGluZUltYWdlQgEwUgZPbmxpbmVaA0lMSWIEVEhVTWoKMjAyNC8wMS8wMXIKMjAyNC8xMi8zMXoAggEgUC0xMDAwMDg0LTIwMTM5NS1TVEFGRi1udWxsLW51bGySAQZPbmxpbmXKAWdNb3ppbGxhLzUuMCBBcHBsZVdlYktpdC81MzcuMzYgKEtIVE1MLCBsaWtlIEdlY2tvOyBjb21wYXRpYmxlOyBDbGF1ZGVCb3QvMS4wOyArY2xhdWRlYm90QGFudGhyb3BpYy5jb20p0gESU2Nob2xhcmx5IEpvdXJuYWxzmgIHUHJlUGFpZKoCG09TOkVNUy1GdWxsVGV4dC1nZXRGdWxsVGV4dMoCD0FydGljbGV8RmVhdHVyZeICAU7yAgD6AgFZggMDV2ViigMcQ0lEOjIwMjUwNTI3MjIyNjAzODI4OjI2NzcwMg%3D%3D&_s=askZMPj51EByOsDXPB5HrbLWGY0%3D "View Image - Figure 2. Effects of ammonia stress on non-specific enzyme activity in E. j. sinensis. (A) AKP in hepatopancreas; (B) ACP in hepatopancreas; (C) CAT in hepatopancreas; (D) MDA in hepatopancreas; (E) ALT in hepatopancreas; (F) TG in hepatopancreas. Different letters (a, b, c, d) indicate significant differences (p [less than] 0.05).")
Enlarge this image.Figure 2. Effects of ammonia stress on non-specific enzyme activity in E. j. sinensis. (A) AKP in hepatopancreas; (B) ACP in hepatopancreas; (C) CAT in hepatopancreas; (D) MDA in hepatopancreas; (E) ALT in hepatopancreas; (F) TG in hepatopancreas. Different letters (a, b, c, d) indicate significant differences (p [less than] 0.05).
![View Image - Figure 4. Effect of ammonia stress on non-specific enzyme activity in E. j. sinensis. (A) AKP in hemolymph; (B) ACP in hemolymph; (C) hemocyanin content; (D) CAT in hemolymph; (E) T-AOC in hemolymph; (F) MDA in hemolymph. Different letters (a, b, c, d) indicate significant differences (p [less than] 0.05).](https://media.proquest.com/media/hms/THUM/8/wk5Ma?_a=ChgyMDI1MDUyNzIyMjYwMzgyODo0NDY5NDQSBzEzODMzMjMaCk9ORV9TRUFSQ0giDTIxNi43My4yMTYuNzYqBzIwMzI0MzgyCjMxMjA1MTAyNzg6C0lubGluZUltYWdlQgEwUgZPbmxpbmVaA0lMSWIEVEhVTWoKMjAyNC8wMS8wMXIKMjAyNC8xMi8zMXoAggEgUC0xMDAwMDg0LTIwMTM5NS1TVEFGRi1udWxsLW51bGySAQZPbmxpbmXKAWdNb3ppbGxhLzUuMCBBcHBsZVdlYktpdC81MzcuMzYgKEtIVE1MLCBsaWtlIEdlY2tvOyBjb21wYXRpYmxlOyBDbGF1ZGVCb3QvMS4wOyArY2xhdWRlYm90QGFudGhyb3BpYy5jb20p0gESU2Nob2xhcmx5IEpvdXJuYWxzmgIHUHJlUGFpZKoCG09TOkVNUy1GdWxsVGV4dC1nZXRGdWxsVGV4dMoCD0FydGljbGV8RmVhdHVyZeICAU7yAgD6AgFZggMDV2ViigMcQ0lEOjIwMjUwNTI3MjIyNjAzODI4OjI2NzcwMg%3D%3D&_s=VylnxCaaBeCSDC%2BH5IffJCDZ8FM%3D "View Image - Figure 4. Effect of ammonia stress on non-specific enzyme activity in E. j. sinensis. (A) AKP in hemolymph; (B) ACP in hemolymph; (C) hemocyanin content; (D) CAT in hemolymph; (E) T-AOC in hemolymph; (F) MDA in hemolymph. Different letters (a, b, c, d) indicate significant differences (p [less than] 0.05).")
Enlarge this image.Figure 4. Effect of ammonia stress on non-specific enzyme activity in E. j. sinensis. (A) AKP in hemolymph; (B) ACP in hemolymph; (C) hemocyanin content; (D) CAT in hemolymph; (E) T-AOC in hemolymph; (F) MDA in hemolymph. Different letters (a, b, c, d) indicate significant differences (p [less than] 0.05).
![View Image - Figure 5. Volcano plot of differentially expressed genes (DEGs) from the transcriptomes of the control and treatment groups. For each unigene, the ratio of expression levels was plotted against the -log error rate. The x-axis represents the fold-change between the 300 mg/L ammonia and PBS control groups, and the y-axis indicates the significance of differential expression. Gray dots indicate genes with no significant difference, while red and blue dots indicate upregulated and downregulated unigenes, respectively (q-value [less than] 0.05 and |log2 (fold-change)| [greater than] 1).](https://media.proquest.com/media/hms/THUM/10/wk5Ma?_a=ChgyMDI1MDUyNzIyMjYwMzgyODo0NDY5NDQSBzEzODMzMjMaCk9ORV9TRUFSQ0giDTIxNi43My4yMTYuNzYqBzIwMzI0MzgyCjMxMjA1MTAyNzg6C0lubGluZUltYWdlQgEwUgZPbmxpbmVaA0lMSWIEVEhVTWoKMjAyNC8wMS8wMXIKMjAyNC8xMi8zMXoAggEgUC0xMDAwMDg0LTIwMTM5NS1TVEFGRi1udWxsLW51bGySAQZPbmxpbmXKAWdNb3ppbGxhLzUuMCBBcHBsZVdlYktpdC81MzcuMzYgKEtIVE1MLCBsaWtlIEdlY2tvOyBjb21wYXRpYmxlOyBDbGF1ZGVCb3QvMS4wOyArY2xhdWRlYm90QGFudGhyb3BpYy5jb20p0gESU2Nob2xhcmx5IEpvdXJuYWxzmgIHUHJlUGFpZKoCG09TOkVNUy1GdWxsVGV4dC1nZXRGdWxsVGV4dMoCD0FydGljbGV8RmVhdHVyZeICAU7yAgD6AgFZggMDV2ViigMcQ0lEOjIwMjUwNTI3MjIyNjAzODI4OjI2NzcwMg%3D%3D&_s=0gl0JqFl0N5G76UCie8cJsSKfMk%3D "View Image - Figure 5. Volcano plot of differentially expressed genes (DEGs) from the transcriptomes of the control and treatment groups. For each unigene, the ratio of expression levels was plotted against the -log error rate. The x-axis represents the fold-change between the 300 mg/L ammonia and PBS control groups, and the y-axis indicates the significance of differential expression. Gray dots indicate genes with no significant difference, while red and blue dots indicate upregulated and downregulated unigenes, respectively (q-value [less than] 0.05 and |log2 (fold-change)| [greater than] 1).")
Enlarge this image.Figure 5. Volcano plot of differentially expressed genes (DEGs) from the transcriptomes of the control and treatment groups. For each unigene, the ratio of expression levels was plotted against the -log error rate. The x-axis represents the fold-change between the 300 mg/L ammonia and PBS control groups, and the y-axis indicates the significance of differential expression. Gray dots indicate genes with no significant difference, while red and blue dots indicate upregulated and downregulated unigenes, respectively (q-value [less than] 0.05 and |log2 (fold-change)| [greater than] 1).
Enlarge this image.Figure 6. DEG enrichment analysis: (A) GO classification of unigenes from the hepatopancreas transcriptome of E. j. sinensis. Each annotated sequence is assigned to at least one GO term under the categories of biological process, cellular component, or molecular function. (B) KEGG pathway analysis of DEGs in E. j. sinensis hepatopancreas.
Enlarge this image.Figure 7. KEGG enrichment bubble diagram (A) and GSEA results (B,C) of DEG analysis.
![View Image - Figure 9. Validation of RNA-seq data by qRT-PCR. (A) Relative expression profiles of seven selected oxidative phosphorylation pathway genes in the hepatopancreas after ammonia stress compared to the control group. (B) Relative expression profiles of six immune-related genes in the hepatopancreas after ammonia stress. Statistical significance: * p [less than] 0.05; ** p [less than] 0.01; *** p [less than] 0.001.](https://media.proquest.com/media/hms/THUM/18/wk5Ma?_a=ChgyMDI1MDUyNzIyMjYwMzgyODo0NDY5NDQSBzEzODMzMjMaCk9ORV9TRUFSQ0giDTIxNi43My4yMTYuNzYqBzIwMzI0MzgyCjMxMjA1MTAyNzg6C0lubGluZUltYWdlQgEwUgZPbmxpbmVaA0lMSWIEVEhVTWoKMjAyNC8wMS8wMXIKMjAyNC8xMi8zMXoAggEgUC0xMDAwMDg0LTIwMTM5NS1TVEFGRi1udWxsLW51bGySAQZPbmxpbmXKAWdNb3ppbGxhLzUuMCBBcHBsZVdlYktpdC81MzcuMzYgKEtIVE1MLCBsaWtlIEdlY2tvOyBjb21wYXRpYmxlOyBDbGF1ZGVCb3QvMS4wOyArY2xhdWRlYm90QGFudGhyb3BpYy5jb20p0gESU2Nob2xhcmx5IEpvdXJuYWxzmgIHUHJlUGFpZKoCG09TOkVNUy1GdWxsVGV4dC1nZXRGdWxsVGV4dMoCD0FydGljbGV8RmVhdHVyZeICAU7yAgD6AgFZggMDV2ViigMcQ0lEOjIwMjUwNTI3MjIyNjAzODI4OjI2NzcwMg%3D%3D&_s=PA9YjMbqkx5ltjyAhEqMJAL0st0%3D "View Image - Figure 9. Validation of RNA-seq data by qRT-PCR. (A) Relative expression profiles of seven selected oxidative phosphorylation pathway genes in the hepatopancreas after ammonia stress compared to the control group. (B) Relative expression profiles of six immune-related genes in the hepatopancreas after ammonia stress. Statistical significance: * p [less than] 0.05; ** p [less than] 0.01; *** p [less than] 0.001.")
Enlarge this image.Figure 9. Validation of RNA-seq data by qRT-PCR. (A) Relative expression profiles of seven selected oxidative phosphorylation pathway genes in the hepatopancreas after ammonia stress compared to the control group. (B) Relative expression profiles of six immune-related genes in the hepatopancreas after ammonia stress. Statistical significance: * p [less than] 0.05; ** p [less than] 0.01; *** p [less than] 0.001.
Primer Names.
| Primer Names | Sequences (5′–3′) |
|---|---|
| β-actin-F | GCATCCACGAGACCACTTACA |
| β-actin-R | CTCCTGCTTGCTGATCCACATC |
| Ndufs4-F | AATCTGGCACTCACAATC |
| Ndufs4-R | AAGCAATGGCATCCTC |
| Ndufv2-F | AAAACAACCCAGATACTTCC |
| Ndufv2-R | AGTTCCCGACCTGACG |
| Ndufa5-F | GATGCCCTCAGATGCT |
| Ndufa5-R | CCACTTCCACTGTCCCT |
| COX6A-F | CGCTCCATTTCCACCG |
| COX6A-R | CCACTAGCAGGGACACCAT |
| COX11-F | CACAGCACAGAGCGAGTC |
| COX11-R | CGCCCGCAGGTAAAGT |
| ATP5MF-F | GGAGAACTTGGTGCCT |
| ATP5MF-R | CATCTTGCCGTAGTTTAT |
| ATPeV0E-F | GATGACTGGTGGTGGG |
| ATPeV0E-R | GTATGGCGATGATGGTT |
| crustin-2-F | GCGACAGGAACCAGAAG |
| crustin-2-R | AAGCGTCACAGCAGCAC |
| Lectin-F | GGCGGCTGCTTCTACTT |
| Lectin-R | ACGTCCACGAACCCTCA |
| ALF3-F | TCTGGTCTATGGCACAACG |
| ALF3-R | AGTCCCGAGTGGCTTCC |
| chitinase 3-F | GCGAACCTCGACCTCAT |
| chitinase 3-R | TCCCTGGGCAATCTTTT |
| PPAF2-F | CCATCGGCTTCAACAAT |
| PPAF2-R | TGATGACGGGATTCTTACA |
| CTSB-F | CGGGCGGAACTTCAACA |
| CTSB-R | CGGTGCGGGAATCAAAC |
Quality of transcriptomic sequencing data of Eriocheir japonica sinensis.
| Samples | Clean Reads | Clean Bases | GC Content | %≥Q30 |
|---|---|---|---|---|
| Es-He-CK1 | 20,791,412 | 6,226,997,816 | 50.96% | 95.57% |
| Es-He-CK2 | 19,925,204 | 5,968,030,201 | 51.08% | 95.48% |
| Es-He-CK3 | 23,122,701 | 6,924,535,291 | 50.83% | 95.34% |
| Es-He-3001 | 20,552,156 | 6,151,444,046 | 49.16% | 95.15% |
| Es-He-3002 | 20,324,902 | 6,084,546,375 | 49.16% | 95.74% |
| Es-He-3003 | 20,327,981 | 6,083,545,895 | 49.29% | 95.75% |
Statistics of annotation success rates.
| Annotation | Number of Genes | Percentage (%) |
|---|---|---|
| Annotated in NR | 14,602 | 19.2 |
| Annotated in SwissProt | 7944 | 10.4 |
| Annotated in PFAM | 14,805 | 19.5 |
| Annotated in KOG | 10,175 | 13.4 |
| Annotated in GO | 14,180 | 18.6 |
| Annotated in COG | 4096 | 5.4 |
| Annotated in KEGG | 10,289 | 13.5 |
| Total | 76,091 | 100 |
References
1. Liu, X.H. The biological characteristics and feeding technique of Eriocheir sinensis. Hubei Agric. Sci.; 2009; 48, pp. 158-160.
2. Wang, X.; Yao, Q.; Zhang, D.M.; Lei, X.Y.; Wang, S.; Wan, J.W.; Guo, Z.X. Effects of acute salinity stress on osmoregulation, antioxidant capacity and physiological metabolism of female Chinese mitten crabs (Eriocheir sinensis). Aquaculture; 2022; 552, 737989. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2022.737989]
3. Sui, L.; Zhang, F.; Wang, X.; Bossier, P.; Sorgeloos, P.; Hänfling, B. Genetic diversity and population structure of the Chinese mitten crab Eriocheir sinensis in its native range. Mar. Biol.; 2009; 156, pp. 1573-1583. [DOI: https://dx.doi.org/10.1007/s00227-009-1193-2]
4. Chen, D.W.; Zhang, M.; Shrestha, S. Compositional characteristics and nutritional quality of Chinese mitten crab (Eriocheir sinensis). Food Chem.; 2007; 103, pp. 1343-1349. [DOI: https://dx.doi.org/10.1016/j.foodchem.2006.10.047]
5. Wang, C.; Wang, X.; Xiao, S.; Bu, X.; Lin, Z.; Qi, C.; Chen, L. T-2 toxin in the diet suppresses growth and induces immunotoxicity in juvenile Chinese mitten crab (Eriocheir sinensis). Fish Shellfish Immunol.; 2020; 97, pp. 593-601. [DOI: https://dx.doi.org/10.1016/j.fsi.2019.12.085]
6. Whittamore, J.M. Osmoregulation and epithelial water transport: Lessons from the intestine of marine teleost fish. J. Comp. Physiol. B; 2012; 182, pp. 1-39. [DOI: https://dx.doi.org/10.1007/s00360-011-0601-3]
7. Wang, T.; Yang, C.; Zhang, S.; Rong, L.; Yang, X.; Wu, Z.; Sun, W. Metabolic changes and stress damage induced by ammonia exposure in juvenile Eriocheir sinensis. Ecotoxicol. Environ. Saf.; 2021; 223, 112608. [DOI: https://dx.doi.org/10.1016/j.ecoenv.2021.112608]
8. Wang, X.; Tjale, P.M.; Yao, Q.; Zhang, D.M.; Zhang, B.Y.; Chen, Y.K.; Guo, Z.X. Comparison of the growth performance and nutritional qualities of Chinese mitten crab (Eriocheir sinensis) with different stocking densities in rice-crab culture systems. Aquacult. Rep.; 2021; 20, 100761. [DOI: https://dx.doi.org/10.1016/j.aqrep.2021.100761]
9. Lu, X.; Luan, S.; Cao, B.; Meng, X.; Sui, J.; Dai, P.; Kong, J. Estimation of genetic parameters and genotype-by-environment interactions related to acute ammonia stress in Pacific white shrimp (Litopenaeus vannamei) juveniles at two different salinity levels. PLoS ONE; 2017; 12, e0173835. [DOI: https://dx.doi.org/10.1371/journal.pone.0173835]
10. Si, L.; Pan, L.; Wang, H.; Zhang, X. Transcriptomic response to ammonia-N stress in the hepatopancreas of swimming crab Portunus trituberculatus. Mar. Life Sci. Technol.; 2020; 2, pp. 135-145. [DOI: https://dx.doi.org/10.1007/s42995-020-00033-3]
11. Cheng, C.H.; Ma, H.L.; Deng, Y.Q.; Feng, J.; Chen, X.L.; Guo, Z.X. Transcriptome analysis and histopathology of the mud crab (Scylla paramamosain) after air exposure. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol.; 2020; 228, 108652. [DOI: https://dx.doi.org/10.1016/j.cbpc.2019.108652] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31683012]
12. Vogt, G. Functional cytology of the hepatopancreas of decapod crustaceans. J. Morphol.; 2019; 280, pp. 1405-1444. [DOI: https://dx.doi.org/10.1002/jmor.21040] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31298794]
13. Liang, C.; Liu, J.; Cao, F.; Li, Z.; Chen, T. Transcriptomic analyses of the acute ammonia stress response in the hepatopancreas of the kuruma shrimp (Marsupenaeus japonicus). Aquaculture; 2019; 513, 734328. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2019.734328]
14. Tang, D.; Wu, Y.; Wu, L.; Bai, Y.; Zhou, Y.; Wang, Z. The effects of ammonia stress exposure on protein degradation, immune response, degradation of nitrogen-containing compounds and energy metabolism of Chinese mitten crab. Mol. Biol. Rep.; 2022; 49, pp. 6053-6061. [DOI: https://dx.doi.org/10.1007/s11033-022-07393-2] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35344117]
15. Ren, Q.; Pan, L.; Zhao, Q.; Si, L.J. Ammonia and urea excretion in the swimming crab Portunus trituberculatus exposed to elevated ambient ammonia-N. Comp. Biochem. Physiol. Part A; 2015; 187, pp. 48-54. [DOI: https://dx.doi.org/10.1016/j.cbpa.2015.04.013]
16. Laura, M.; Dimitri, T.; Claire, L.É.; Sophie, H.; Emmanuel, C.; Thibaut, L.H.; Hervé, L.J.; Elliott, S. Diluted seawater and ammonia-N tolerance of two mangrove crab species. New insights to understand the vulnerability of pristine islands ecosystems organisms. Front. Ecol. Evol.; 2022; 10, 839160.
17. Valavanidis, A.; Vlahogianni, T.; Dassenakis, M.; Scoullos, M. Molecular biomarkers of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. Saf.; 2006; 64, pp. 178-189. [DOI: https://dx.doi.org/10.1016/j.ecoenv.2005.03.013]
18. Liu, S.; Pan, L.; Liu, M.; Yang, L. Effects of ammonia exposure on nitrogen metabolism in gills and hemolymph of the swimming crab Portunus trituberculatus. Aquaculture; 2014; 432, pp. 351-359. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2014.05.029]
19. Li, M.; Lai, H.; Li, Q.; Gong, S.; Wang, R. Effects of dietary taurine on growth, immunity and hyperammonemia in juvenile yellow catfish Pelteobagrus fulvidraco fed all-plant protein diets. Aquaculture; 2016; 450, pp. 349-355. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2015.08.013]
20. Chen, Y.Y.; Chen, J.C.; Lin, Y.C.; Yeh, S.T.; Huang, C.L. White shrimp Litopenaeus vannamei that have received Gracilaria tenuistipitata extract show early recovery of immune parameters after ammonia stressing. Mar. Drugs.; 2015; 13, pp. 3606-3624. [DOI: https://dx.doi.org/10.3390/md13063606]
21. Yang, X.; Song, X.; Zhang, C.; Pang, Y.; Song, Y.; Cheng, Y.; Zong, X. Effects of dietary melatonin on hematological immunity, antioxidant defense and antibacterial ability in the Chinese mitten crab, Eriocheir sinensis. Aquaculture; 2020; 529, 735578. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2020.735578]
22. Lu, X.; Luan, S.; Dai, P.; Meng, X.; Cao, B.; Luo, K.; Kong, J. ITRAQ-based comparative proteome analysis for molecular mechanism of defense against acute ammonia toxicity in Pacific White shrimp Litopenaeus vannamei. Fish Shellfish Immunol.; 2018; 74, pp. 52-61. [DOI: https://dx.doi.org/10.1016/j.fsi.2017.12.030] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29284148]
23. Lemarie, G.; Dosdat, A.; Covès, D.; Dutto, G.; Gasset, E.; Person-Le Ruyet, J. Effect of chronic ammonia exposure on growth of European seabass (Dicentrarchus labrax) juveniles. Aquaculture; 2004; 229, pp. 479-491. [DOI: https://dx.doi.org/10.1016/S0044-8486(03)00392-2]
24. Dosdat, A.; Person-Le Ruyet, J.; Covès, D.; Dutto, G.; Gasset, E.; Le Roux, A.; Lemarié, G. Effect of chronic exposure to ammonia on growth, food utilisation and metabolism of the European sea bass (Dicentrarchus labrax). Aquat. Living Resour.; 2003; 16, pp. 509-520. [DOI: https://dx.doi.org/10.1016/j.aquliv.2003.08.001]
25. Gomes Jr, R.S.; de Lima, J.P.V.; Cavalli, R.O.; Correia, E.D.S. Acute toxicity of ammonia and nitrite to painted river prawn, Macrobrachium carcinus, larvae. J. World Aquacult. Soc.; 2016; 47, pp. 239-247. [DOI: https://dx.doi.org/10.1111/jwas.12258]
26. Hong, M.; Chen, L.; Sun, X.; Gu, S.; Zhang, L.; Chen, Y. Metabolic and immune responses in Chinese mitten-handed crab (Eriocheir sinensis) juveniles exposed to elevated ambient ammonia. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol.; 2007; 145, pp. 363-369. [DOI: https://dx.doi.org/10.1016/j.cbpc.2007.01.003]
27. Moore, C.L.; Savenka, A.V.; Basnakian, A.G. TUNEL assay: A powerful tool for kidney injury evaluation. Int. J. Mol. Sci.; 2021; 22, 412. [DOI: https://dx.doi.org/10.3390/ijms22010412]
28. Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol.; 2011; 29, pp. 644-652. [DOI: https://dx.doi.org/10.1038/nbt.1883]
29. Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods; 2015; 12, pp. 357-360. [DOI: https://dx.doi.org/10.1038/nmeth.3317]
30. Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; Van Baren, M.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol.; 2010; 28, pp. 511-515. [DOI: https://dx.doi.org/10.1038/nbt.1621]
31. Apweiler, R.; Bairoch, A.; Wu, C.H.; Barker, W.C.; Boeckmann, B.; Ferro, S.; Yeh, L.S.L. UniProt: The universal protein knowledgebase. Nucleic Acids Res.; 2004; 32, pp. D115-D119. [DOI: https://dx.doi.org/10.1093/nar/gkh131] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/14681372]
32. Finn, R.D.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Mistry, J.; Mitchell, A.L.; Bateman, A. The Pfam protein families database: Towards a more sustainable future. Nucleic Acids Res.; 2016; 44, pp. D279-D285. [DOI: https://dx.doi.org/10.1093/nar/gkv1344] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26673716]
33. Tatusov, R.L.; Galperin, M.Y.; Natale, D.A.; Koonin, E.V. The COG database: A tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res.; 2000; 28, pp. 33-36. [DOI: https://dx.doi.org/10.1093/nar/28.1.33]
34. Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Goseq: Gene Ontology testing for RNA-seq datasets. R Bioconductor; 2012; 8, pp. 1-25.
35. Kanehisa, M.; Goto, S.; Kawashima, S.; Okuno, Y.; Hattori, M. The KEGG resource for deciphering the genome. Nucleic Acids Res.; 2004; 32, pp. D277-D280. [DOI: https://dx.doi.org/10.1093/nar/gkh063]
36. Conesa, A.; Götz, S.; García-Gómez, J.M.; Terol, J.; Talón, M.; Robles, M. Blast2GO: A universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics; 2005; 21, pp. 3674-3676. [DOI: https://dx.doi.org/10.1093/bioinformatics/bti610]
37. Wang, L.; Feng, Z.; Wang, X.; Wang, X.; Zhang, X. DEGseq: An R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics; 2010; 26, pp. 136-138. [DOI: https://dx.doi.org/10.1093/bioinformatics/btp612]
38. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Sherlock, G. Gene ontology: Tool for the unification of biology. Nat. Genet.; 2000; 25, pp. 25-29. [DOI: https://dx.doi.org/10.1038/75556] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/10802651]
39. Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics; 2005; 21, pp. 3787-3793. [DOI: https://dx.doi.org/10.1093/bioinformatics/bti430]
40. Huang, S.; Chen, X.; Wang, J.; Chen, J.; Yue, W.; Lu, W.; Wang, C. Selection of appropriate reference genes for qPCR in the Chinese mitten crab, Eriocheir sinensis (Decapoda, Varunidae). Crustaceana; 2017; 90, pp. 275-296. [DOI: https://dx.doi.org/10.1163/15685403-00003651]
41. Liu, Y.; Cao, G.; Zhao, N.; Mulligan, K.; Ye, X. Improve ground-level PM2.5 concentration mapping using a random forests-based geostatistical approach. Environ. Pollut.; 2018; 235, pp. 272-282. [DOI: https://dx.doi.org/10.1016/j.envpol.2017.12.070] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29291527]
42. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods; 2001; 25, pp. 402-408. [DOI: https://dx.doi.org/10.1006/meth.2001.1262] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11846609]
43. Ren, Q.; Li, M.; Yuan, L.; Song, M.; Xing, X.; Shi, G.; Meng, F.; Wang, R. Acute ammonia toxicity in crucian carp Carassius auratus and effects of taurine on hyperammonemia. Comp. Biochem. Physiol. C Toxicol. Pharmacol.; 2016; 190, pp. 9-14. [DOI: https://dx.doi.org/10.1016/j.cbpc.2016.08.001]
44. Sampaio, F.G.; de Lima Boijink, C.; Oba, E.T.; dos Santos, L.R.B.; Kalinin, A.L.; Rantin, F.T. Antioxidant defenses and biochemical changes in pacu (Piaractus mesopotamicus) in response to single and combined copper and hypoxia exposure. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol.; 2008; 147, pp. 43-51. [DOI: https://dx.doi.org/10.1016/j.cbpc.2007.07.009]
45. Hoseini, S.M.; Yousefi, M.; Hoseinifar, S.H.; Van Doan, H. Antioxidant, enzymatic and hematological responses of common carp (Cyprinus carpio) fed with myrcene-or menthol-supplemented diets and exposed to ambient ammonia. Aquaculture; 2019; 506, pp. 246-255. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2019.03.048]
46. Muta, T.; Iwanaga, S. The role of haemolymph coagulation innate immunity. Curr. Opin. Immunol.; 1996; 8, pp. 41-47. [DOI: https://dx.doi.org/10.1016/S0952-7915(96)80103-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/8729445]
47. Molina, R.; Moreno, I.; Pichardo, S.; Jos, A.; Moyano, R.; Monterde, J.G.; Cameán, A. Acid and alkaline phosphatase activities and pathological changes induced in Tilapia fish (Oreochromis sp.) exposed subchronically to microcystins from toxic cyanobacterial blooms under laboratory conditions. Toxicon; 2005; 46, pp. 725-735. [DOI: https://dx.doi.org/10.1016/j.toxicon.2005.07.012]
48. Qin, Q.; Qin, S.; Wang, L.; Lei, W. Immune responses and ultrastructural changes of hemocytes in freshwater crab Sinopotamon henanense exposed to elevated cadmium. Aquat. Toxicol.; 2012; 106, pp. 140-146. [DOI: https://dx.doi.org/10.1016/j.aquatox.2011.08.013]
49. Winston, G.W.; Di Giulio, R.T. Prooxidant and antioxidant mechanisms in aquatic organisms. Aquat. Toxicol.; 1991; 19, pp. 137-161. [DOI: https://dx.doi.org/10.1016/0166-445X(91)90033-6]
50. Zhang, M.; Li, M.; Wang, R.; Qian, Y. Effects of acute ammonia toxicity on oxidative stress, immune response and apoptosis of juvenile yellow catfish Pelteobagrus fulvidraco and the mitigation of exogenous taurine. Fish Shellfish Immunol.; 2018; 79, pp. 313-320. [DOI: https://dx.doi.org/10.1016/j.fsi.2018.05.036]
51. Zhao, L.; Cui, C.; Liu, Q.; Sun, J.; He, K.; Adam, A.A.; Yang, S. Combined exposure to hypoxia and ammonia aggravated biological effects on glucose metabolism, oxidative stress, inflammation and apoptosis in largemouth bass (Micropterus salmoides). Aquat. Toxicol.; 2020; 224, 105514. [DOI: https://dx.doi.org/10.1016/j.aquatox.2020.105514] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32502847]
52. Livingstone, D.R. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms. Mar. Pollut. Bull.; 2001; 42, pp. 656-666. [DOI: https://dx.doi.org/10.1016/S0025-326X(01)00060-1] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11525283]
53. Trenzado, C.E.; Morales, A.E.; Palma, J.M.; de la Higuera, M. Blood antioxidant defenses and hematological adjustments in crowded/uncrowded rainbow trout (Oncorhynchus mykiss) fed on diets with different levels of antioxidant vitamins and HUFA. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol.; 2009; 149, pp. 440-447. [DOI: https://dx.doi.org/10.1016/j.cbpc.2008.10.105]
54. Li, C.; Zhang, M.; Li, M.; Zhang, Q.; Qian, Y.; Wang, R. Effect of dietary alanyl-glutamine dipeptide against chronic ammonia stress induced hyperammonemia in the juvenile yellow catfish (Pelteobagrus fulvidraco). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol.; 2018; 213, pp. 55-61. [DOI: https://dx.doi.org/10.1016/j.cbpc.2018.08.001]
55. Li, S.; Zheng, L.; Zhang, J.; Liu, X.; Wu, Z. Inhibition of ferroptosis by up-regulating Nrf2 delayed the progression of diabetic nephropathy. Free Radic. Biol. Med.; 2021; 162, pp. 435-449. [DOI: https://dx.doi.org/10.1016/j.freeradbiomed.2020.10.323] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33152439]
56. Wang, A.R.; Ran, C.; Ringø, E.; Zhou, Z.G. Progress in fish gastrointestinal microbiota research. Rev. Aquacult.; 2018; 10, pp. 626-640. [DOI: https://dx.doi.org/10.1111/raq.12191]
57. Zhang, C.; Zhang, Q.; Pang, Y.; Song, X.; Zhou, N.; Wang, J.; Yang, X. The protective effects of melatonin on oxidative damage and the immune system of the Chinese mitten crab (Eriocheir sinensis) exposed to deltamethrin. Sci. Total Environ.; 2019; 653, pp. 1426-1434. [DOI: https://dx.doi.org/10.1016/j.scitotenv.2018.11.063]
58. Zhang, Y.L.; Zhang, H.L.; Wang, L.Y.; Gu, B.Y.; Fan, Q.X. Changes of ammonia, urea contents and transaminase activity in the body during aerial exposure and ammonia loading in Chinese loach Paramisgurnus dabryanus. Fish Physiol. Biochem.; 2017; 43, pp. 631-640. [DOI: https://dx.doi.org/10.1007/s10695-016-0317-0]
59. Fırat, Ö.; Cogun, H.Y.; Yüzereroğlu, T.A.; Gök, G.; Fırat, Ö.; Kargin, F.; Kötemen, Y. A comparative study on the effects of a pesticide (cypermethrin) and two metals (copper, lead) to serum biochemistry of Nile tilapia, Oreochromis niloticus. Fish Physiol. Biochem.; 2011; 37, pp. 657-666. [DOI: https://dx.doi.org/10.1007/s10695-011-9466-3]
60. Wang, T.; Shan, H.W.; Geng, Z.X.; Yu, P.; Ma, S. Dietary supplementation with freeze-dried Ampithoe sp. enhances the ammonia-N tolerance of Litopenaeus vannamei by reducing oxidative stress and endoplasmic reticulum stress and regulating lipid metabolism. Aquacult. Rep.; 2020; 16, 100264. [DOI: https://dx.doi.org/10.1016/j.aqrep.2019.100264]
61. Xu, L.; Spinas, G.A.; Niessen, M. ER stress in adipocytes inhibits insulin signaling, represses lipolysis, and alters the secretion of adipokines without inhibiting glucose transport. Horm. Metab. Res.; 2010; 42, pp. 643-651. [DOI: https://dx.doi.org/10.1055/s-0030-1255034] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20560104]
62. Zou, W.; Liu, W.; Yang, B.; Wu, L.; Yang, J.; Zou, T.; Zhang, D. Quercetin protects against perfluorooctanoic acid-induced liver injury by attenuating oxidative stress and inflammatory response in mice. Int. Immunopharmacol.; 2015; 28, pp. 129-135. [DOI: https://dx.doi.org/10.1016/j.intimp.2015.05.043] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26054880]
63. Amara, I.E.; Elshenawy, O.H.; Abdelrady, M.; El-Kadi, A.O. Acute mercury toxicity modulates cytochrome P450, soluble epoxide hydrolase and their associated arachidonic acid metabolites in C57Bl/6 mouse heart. Toxicol. Lett.; 2014; 226, pp. 53-62. [DOI: https://dx.doi.org/10.1016/j.toxlet.2014.01.025] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24472606]
64. Chang, C.C.; Yeh, M.S.; Cheng, W. Cold shock-induced norepinephrine triggers apoptosis of haemocytes via caspase-3 in the white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol.; 2009; 27, pp. 695-700. [DOI: https://dx.doi.org/10.1016/j.fsi.2009.08.010]
65. Liang, Z.; Liu, R.; Zhao, D.; Wang, L.; Sun, M.; Wang, M.; Song, L. Ammonia exposure induces oxidative stress, endoplasmic reticulum stress and apoptosis in hepatopancreas of pacific white shrimp (Litopenaeus vannamei). Fish Shellfish Immunol.; 2016; 54, pp. 523-528. [DOI: https://dx.doi.org/10.1016/j.fsi.2016.05.009] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27164997]
66. Duan, Y.; Zhang, Y.; Dong, H.; Zhang, J. Effect of desiccation on oxidative stress and antioxidant response of the black tiger shrimp Penaeus monodon. Fish Shellfish Immunol.; 2016; 58, pp. 10-17. [DOI: https://dx.doi.org/10.1016/j.fsi.2016.09.004]
67. Jaffer, Y.D.; Saraswathy, R.; Ishfaq, M.; Antony, J.; Bundela, D.S.; Sharma, P.C. Effect of low salinity on the growth and survival of juvenile pacific white shrimp, Penaeus vannamei: A revival. Aquaculture; 2020; 515, 734561. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2019.734561]
68. Andreyeva, A.Y.; Kladchenko, E.S.; Kukhareva, T.A.; Rychkova, V.N.; Tkachuk, A.A.; Lavrichenko, D.S. Effects of salinity on hemocyte functionality in mediterranean mussels (Mytilus galloprovincialis). J. Shellfish Res.; 2023; 42, pp. 215-221. [DOI: https://dx.doi.org/10.2983/035.042.0203]
69. Huang, Y.; Hong, Y.; Huang, Z.; Zhang, J.; Huang, Q. Avermectin induces the oxidative stress, genotoxicity, and immunological responses in the Chinese Mitten Crab, Eriocheir sinensis. PLoS ONE; 2019; 14, e0225171. [DOI: https://dx.doi.org/10.1371/journal.pone.0225171]
70. Tatusov, R.L.; Koonin, E.V.; Lipman, D.J. A genomic perspective on protein families. Science; 1997; 278, pp. 631-637. [DOI: https://dx.doi.org/10.1126/science.278.5338.631]
71. Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Mesirov, J.P. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA; 2005; 102, pp. 15545-15550. [DOI: https://dx.doi.org/10.1073/pnas.0506580102] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16199517]
72. Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Res.; 1999; 27, pp. 1767-1780. [DOI: https://dx.doi.org/10.1093/nar/27.8.1767]
73. Koo, M.J.; Rooney, K.T.; Choi, M.E.; Ryter, S.W.; Choi, A.M.; Moon, J.S. Impaired oxidative phosphorylation regulates necroptosis in human lung epithelial cells. Biochem. Biophys. Res. Commun.; 2015; 464, pp. 875-880. [DOI: https://dx.doi.org/10.1016/j.bbrc.2015.07.054] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26187663]
74. Mitchell, P. Chemiosmotic coupling in oxidative and photosynthetic phosphorylation. BBA-Bioenergetics; 2011; 1807, pp. 1507-1538. [DOI: https://dx.doi.org/10.1016/j.bbabio.2011.09.018]
75. Oliveira, D.C.S.G.; Raychoudhury, R.; Lavrov, D.V.; Werren, J.H. Rapidly evolving mitochondrial genome and directional selection in mitochondrial genes in the parasitic wasp Nasonia (Hymenoptera: Pteromalidae). Mol. Biol. Evol.; 2008; 25, pp. 2167-2180. [DOI: https://dx.doi.org/10.1093/molbev/msn159]
76. Kulkarni, A.; Krishnan, S.; Anand, D.; Uthaman, S.K.; Otta, S.K.; Karunasagar, I.; Valappil, R.K. Immune responses and immunoprotection in crustaceans with special reference to shrimp. Rev. Aquacult.; 2021; 13, pp. 431-459. [DOI: https://dx.doi.org/10.1111/raq.12482]
77. Lambeth, J.D.; Neish, A.S. Nox enzymes and new thinking on reactive oxygen: A double-edged sword revisited. Annu. Rev. Pathol. Mech. Dis.; 2014; 9, pp. 119-145. [DOI: https://dx.doi.org/10.1146/annurev-pathol-012513-104651] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24050626]
78. Schieber, M.; Chandel, N.S. ROS function in redox signaling and oxidative stress. Curr. Biol.; 2014; 24, pp. R453-R462. [DOI: https://dx.doi.org/10.1016/j.cub.2014.03.034]
79. Shadel, G.S.; Horvath, T.L. Mitochondrial ROS signaling in organismal homeostasis. Cell; 2015; 163, pp. 560-569. [DOI: https://dx.doi.org/10.1016/j.cell.2015.10.001]
80. Weinberg, S.E.; Sena, L.A.; Chandel, N.S. Mitochondria in the regulation of innate and adaptive immunity. Immunity; 2015; 42, pp. 406-417. [DOI: https://dx.doi.org/10.1016/j.immuni.2015.02.002]
81. West, A.P.; Brodsky, I.E.; Rahner, C.; Woo, D.K.; Erdjument-Bromage, H.; Tempst, P. TLR signalling augments macrophage bactericidal activity through mitochondrial ROS. Nature; 2011; 472, pp. 476-480. [DOI: https://dx.doi.org/10.1038/nature09973] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21525932]
82. Huber, L.A.; Teis, D. Lysosomal signaling in control of degradation pathways. Curr. Opin. Cell Biol.; 2016; 39, pp. 8-14. [DOI: https://dx.doi.org/10.1016/j.ceb.2016.01.006] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26827287]
83. Gorelick, F.S.; Shugrue, C.A.; Kolodecik, T.R.; Thrower, E.C. Vacuolar adenosine triphosphatase and pancreatic acinar cell function. J. Gastroenterol. Hepatol.; 2006; 21, pp. S18-S21. [DOI: https://dx.doi.org/10.1111/j.1440-1746.2006.04576.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16958663]
84. Triepels, R.H.; Van den Heuvel, L.P.; Trijbels, J.M.; Smeitink, J.A. Respiratory chain complex I deficiency. Am. J. Med. Genet.; 2001; 106, pp. 37-45. [DOI: https://dx.doi.org/10.1002/ajmg.1397]
85. Mimaki, M.; Wang, X.; McKenzie, M.; Thorburn, D.R.; Ryan, M.T. Understanding mitochondrial complex I assembly in health and disease. BBA-Bioenergetics; 2012; 1817, pp. 851-862. [DOI: https://dx.doi.org/10.1016/j.bbabio.2011.08.010]
86. Quintens, R.; Singh, S.; Lemaire, K.; De Bock, K.; Granvik, M.; Schraenen, A.; Vroegrijk, I.O.C.M.; Costa, V.; Van Noten, P.; Lambrechts, D. et al. Mice deficient in the respiratory chain gene Cox6a2 are protected against high-fat diet-induced obesity and insulin resistance. PLoS ONE; 2013; 8, e56719. [DOI: https://dx.doi.org/10.1371/journal.pone.0056719]
87. Elmore, S.E.; La Merrill, M.A. Oxidative phosphorylation impairment by DDT and DDE. Front. Endocrinol.; 2019; 10, 429001. [DOI: https://dx.doi.org/10.3389/fendo.2019.00122]
88. Chen, X.; Zheng, J.; Teng, M.; Zhang, J.; Qian, L.; Duan, M.; Wang, Z.; Wang, C. Environmentally relevant concentrations of tralopyril affect carbohydrate metabolism and lipid metabolism of zebrafish (Danio rerio) by disrupting mitochondrial function. Ecotoxicol. Environ. Saf.; 2021; 223, 112615. [DOI: https://dx.doi.org/10.1016/j.ecoenv.2021.112615]
89. Xu, Z.; Zhang, Y.; Xu, Z.; Zhong, Y.; Wang, L.; Liu, C.; Chen, A.; Jiang, S.; Sun, W.; Yu, G. et al. Dysregulation of gut health in zebrafish by differentially charged nanoplastic exposure: An integrated analysis of histopathology, immunology, and microbial informatics. Environ. Sci.-Nano; 2023; 10, pp. 933-947. [DOI: https://dx.doi.org/10.1039/D2EN00542E]
90. Usenko, C.Y.; Abel, E.L.; Kudela, M.; Janise, A.; Bruce, E.D. Comparison of pbde congeners as inducers of oxidative stress in zebrafish. Environ. Toxicol. Chem.; 2015; 34, pp. 1154-1160. [DOI: https://dx.doi.org/10.1002/etc.2922]
91. Hu, Y.C.; Kang, C.K.; Tang, C.H.; Lee, T.H. Transcriptomic analysis of metabolic pathways in milkfish that respond to salinity and temperature changes. PLoS ONE; 2015; 10, e0134959. [DOI: https://dx.doi.org/10.1371/journal.pone.0134959] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26263550]
92. Tine, M.; McKenzie, D.J.; Bonhomme, F.; Durand, J.D. Salinity-related variation in gene expression in wild populations of the black-chinned tilapia from various West African coastal marine, estuarine and freshwater habitats. Estuar. Coast. Shelf Sci.; 2011; 91, pp. 102-109. [DOI: https://dx.doi.org/10.1016/j.ecss.2010.10.015]
93. Shi, X.Z.; Li, X.C.; Wang, S.; Zhao, X.F.; Wang, J.X. Transcriptome analysis of hemocytes and hepatopancreas in red swamp crayfish, Procambarus clarkii, challenged with white spot syndrome virus. ISJ-Invert. Surviv. J.; 2010; 7, pp. 119-131.
94. Li, X.; Zhang, Y.; Shen, P.; Xu, Y.; Gao, Q.; Cheng, H.; Wang, W.; Gu, Z.; Chen, X. Baicalin protects giant freshwater prawn, Macrobrachium rosenbergii against Vibrio parahaemolyticus via modulation of the Toll signaling pathway. J. World Aquacult. Soc.; 2021; 52, pp. 987-1000. [DOI: https://dx.doi.org/10.1111/jwas.12806]
95. Wang, C.; Pan, J.; Wang, X.; Cai, X.; Lin, Z.; Shi, Q.; Li, E.; Qin, J.G.; Chen, L. N-acetylcysteine provides protection against the toxicity of dietary T-2 toxin in juvenile Chinese mitten crab (Eriocheir sinensis). Aquaculture; 2021; 538, 736531. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2021.736531]
96. Stephens, A.; Rojo, L.; Araujo-Bernal, S.; Garcia-Carreno, F.; Muhlia-Almazan, A. Cathepsin B from the white shrimp Litopenaeus vannamei: cDNA sequence analysis, tissues-specific expression and biological activity. Comp. Biochem. Physiol. B Biochem. Mol. Biol.; 2012; 161, pp. 32-40. [DOI: https://dx.doi.org/10.1016/j.cbpb.2011.09.004]
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.