Enhancing the Tolerance of a Green Foxtail Biotype to Mesotrione via a Cytochrome P450-Mediated Herbicide Metabolism

Abstract

Green foxtail is a troublesome weed in crop fields across China. A nova target HPPD inhibitor is widely used to control weeds in agricultural production. Mesotrione, an HPPD inhibitor, cannot control green foxtail effectively under the recommended field dose, indicating that green foxtail is tolerant to mesotrione. Interestingly, a green foxtail biotype that exhibits a greater tolerance to mesotrione (GR₅₀ value 463.2 g ai ha⁻¹) than that of the wild biotype (GR₅₀ value 271.9 g ai ha⁻¹) was found in Jilin Province, China. The HPPD genes isolated from the two biotypes genome were aligned, while no difference was found in the amino acid of the HPPD compared with that of the wild biotype. Through the qPCR experiment, the HPPD gene copy number variation and overexpression were also not found. Cytochrome P450 inhibitors (malathion and PBO), pretreatment, could effectively reverse the tolerance. Compared with the MT biotype, the in vivo activity of P450s was higher after the mesotrione treatment in the HT biotype. Therefore, P450s might be involved in the mechanism of tolerance.

1. Introduction

Crop rotation systems are a widely implemented agricultural practice around the world, designed to optimize farmland use while maintaining soil health and fertility. By alternating different crops in the same field over time, these systems help to balance nutrient demands, reduce soil depletion, prevent erosion, and improve overall field productivity and sustainability in the long term. Continuous cropping of single crops can increase weed density and reduce crop yield to a large extent because single crops allow weeds to compete effectively with crops or overcome this competition through various escape mechanisms [1]. In China, soybean and corn rotations are widely used. As a common weed, green foxtail (Setaria viridis (L) P. Beauv) control in soybean is influenced by the effectiveness of green foxtail control measures in the preceding corn crop. As a potential model for C4 photosynthetic plants with high competition, green foxtail is native to Eurasia, but it is an introduced species on most continents [2]. It is a hardy grass that grows in many types of urban, cultivated, and disturbed habitats, including vacant lots, sidewalks, railroads, lawns, and at the margins of fields. Green foxtail is the wild antecedent of the crop foxtail millet (Setaria italica (L.) P. Beauv.) [3]. As previously demonstrated, species that utilize this highly efficient form of photosynthesis, known as C4 photosynthesis, exhibit adaptive advantages when exposed to various abiotic stresses, including drought, heat, and cold. These adaptations allow them to maintain higher productivity and resilience under harsh environmental conditions, which can lead to enhanced growth, better survival, and increased competitiveness compared to C3 photosynthetic crops. As a result, C4 plants often have a distinct advantage in environments where C3 crops may struggle to thrive [4]. Therefore, finding a more effective method to control this hardy weed is important.

Further, 4-hydroxyphenylpyruvate dioxygenase (HPPD, EC 1.13.11.27, EC 1.14.2.2) is an enzyme found in practically all aerobic organisms. It plays a significant role in breaking down tyrosine and producing plastoquinone, tocopherols, and carotenoids. HPPD catalyzes the oxidative decarboxylation of 4-hydroxyphenylpyruvate to form homogentisate. The enzyme is widely distributed due to its significant role in metabolic processes. It is crucial for the catabolism of tyrosine and the anabolism of plastoquinone, tocopherols, and, eventually, carotenoid biosynthesis [5]. Plastoquinone is a crucial component in the following significant pathways: (i) it is a necessary element in photosynthetic electron transfer from photosystem II (PS II) to photosystem I (PS I), which produces ATP; and (ii) it plays a vital role as a cofactor for phytoene desaturase, a key enzyme in carotenoid biosynthesis. Therefore, plastoquinone is essential for ATP generation in photosynthesis and carotenoid production, which helps plants protect themselves from harmful photooxidation. Carotenoids are light-harvesting molecules that protect plants from photooxidation by quenching chlorophyll triplet states and preventing the formation of destructive singlet oxygen [6]. Therefore, HPPD and its targeted inhibitor screening have received considerable attention in herbicide discovery since the first commercialized HPPD inhibitor pyrazolate was invented by Daiichi Sankyo Co., Ltd. in 1980. After more than 40 years of development, over 10 excellent commercial HPPD inhibitors, including sulcotrione, mesotrione, benquitrione, isoxaflutole, tembotrione, pyrasulfotole, and topramezone, have been developed [7,8,9,10].

Currently, chemical control continues to be an effective and convenient approach for managing weeds in agricultural field systems. The application of herbicides, such as sterilants and selective herbicides, has proven to be particularly successful in controlling green foxtail. This method not only helps maintain crop yield but also reduces competition from unwanted vegetation in the fields. As one selective herbicide, HPPD inhibitors are broadly sprayed in different fields to control weeds. One critical result, rapid metabolism by ring hydroxylation mediated by cytochrome P450s, combined with reduced absorption of HPPD inhibitors, has been attributed to the selectivity of these herbicides [11]. Herbicide-susceptible plants display observable bleaching symptoms upon treatment, which is a consequence of their inability to synthesize carotenoids. This deficiency eventually causes plant cell membranes to undergo lipid peroxidation [12]. As a highly effective HPPD inhibitor herbicide, mesotrione is frequently utilized in corn crops to selectively manage numerous broad-leaved weeds and some types of grasses [11]. However, under the recommended field rate, mesotrione cannot efficiently control weed green foxtail [13]. However, interestingly, one biotype collected in Jilin Province expresses higher tolerance than that of ordinary green foxtail biotypes, its GR₅₀ value was significantly higher than that of the wild type, and the 95% confidence interval did not overlap.

According to the Weed Science Society of America (WSSA), herbicide tolerance is defined as the innate ability of a plant species to survive and reproduce after being exposed to herbicides. This characteristic is naturally present in the plant and has not resulted from genetic manipulation, breeding, or selection processes. The plant possesses this ability without the influence of human intervention, allowing it to thrive even when herbicides are applied. Rather, the plant naturally possesses that capacity. On the other hand, herbicide resistance is described as the inherited ability of a plant to withstand and proliferate after exposure to a dosage of herbicide that is typically lethal to the wild type. In plants, resistance may occur naturally or be artificially induced through methods such as genetic engineering or selecting variants produced via tissue culture or mutagenesis [14]. The purpose of this research was to preliminarily investigate the underlying mechanism that contributes to the high tolerance of green foxtail to the herbicide mesotrione. Moreover, this research offered a new perspective on the transition from tolerance to resistance. It opened up new avenues for understanding the underlying mechanisms and processes that drive this transformation, shedding light on the intricate interactions between plants and herbicides.

2. Materials and Methods

2.1. Plant Material and Growth Conditions

Seeds from all the green foxtail biotypes collected in Jilin Province were sown in small pots (6 cm × 6 cm × 6.5 cm) filled with a potting mixture and cultivated in a greenhouse under controlled conditions. The temperature was maintained at 30/25 °C with a 15/9 h light/dark photoperiod, supplemented by sodium vapor lamps providing 250 µmol m⁻² s⁻¹ illumination. The plants were regularly watered as needed to support healthy growth. At the 3–4-leaf stage, all the green foxtail biotypes were treated with mesotrione at doses of 1×, 2×, and 4× (the × indicates the rate, 135 g ai ha⁻¹, listed on the herbicide label). Survival estimates of green foxtail biotypes with herbicide were utilized 21 days after treatment (DAT). One biotype that survived at a dose of 4× was referred to as the higher tolerance (HT) biotype. By comparison, one ordinary foxtail biotype was referred to as the wild-type biotype with moderate tolerance (MT).

2.2. Whole-Plant Dose Response to Mesotrione

Based on the growth conditions, HT and MT green foxtail biotypes at the 3–4-leaf stage was sprayed with mesotrione at varying rates of 67.5, 135, 270, 540, 1080, and 2160 g ai ha⁻¹ using a spray chamber with a compressed air, moving nozzle cabinet sprayer, 3WPSH-500D (Nanjing, Jiangsu, China), equipped with one Teejet XR8003 flat fan nozzle (Glendale Heights, IL, USA) calibrated to deliver 450 L ha⁻¹ at 0.3 MPa. Each dose-response experiment was randomized with three replicates per herbicide dose to ensure accuracy. The plant-control rate was recorded by assessing the impact of mesotrione on the plants, and 21 days after treatment (DAT), the aboveground biomass was harvested and weighed to measure the herbicide’s effect on plant growth.

2.3. HPPD Gene Cloning and Sequencing

Leaf tissue from five individual plants of each biotype at the three-leaf stage was collected, and the total RNA was extracted using a TransZol Up Plus RNA Kit (TransGen Biotech., Beijing, China) following the manufacturer’s instructions. Reverse transcription (RT)-PCR was conducted with TransScript^® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech., Beijing, China). According to the reference sequence in NCBI (XM_034725699.1), the complete sequence of HPPD genes in green foxtail was amplified with the HPPD gene primers (F: 5′-ACGCCCCCACACCCTCC-3′; R: 5′-CACAAAGCACTACAACTGTTGCA-3′) by Ultra HiFidelity PCR polymerase II (Tiange Biotech, Beijing, China). PCR was conducted as follows: 30 s at 98 °C, 35 cycles of [10 s at 98 °C, 20 s at 60 °C, 90 s at 72 °C], and a final elongation for 5 min at 72 °C. The PCR products were ligated into a pEASY^®-blunt cloning vector (TransGen Biotech., Beijing, China). At least eight clones of each plant per biotype were bidirectionally sequenced.

2.4. HPPD Gene Determination of Relative Copy Number and Expression

Relative copy number and expression were conducted with genomic DNA (gDNA, ~10 ng) and complementary DNA (cDNA) as templates, while HPPD gene-specific primers (HPPD-GSP) and Actin [15] (Wang et al., 2020) were chosen as an internal standard (Table 1). One day after, the MT and HT green foxtails were treated with mesotrione (135 g ai ha⁻¹). The gDNA was extracted and purified using the EasyPure^® Plant Genomic DNA Kit (TransGen Biotech., Beijing, China). Total RNA was extracted and purified according to the manufacturer’s instructions, and 1 μg of total RNA was used for first-stand cDNA synthesis with TransScript^® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech., Beijing, China). Quantitative PCR (qPCR) was performed in 96-well plates on an Applied Biosystems 7500 system (Foster City, CA, USA) using SuperReal PreMix Plus (SYBR Green) (Tiangen Biotech, Beijing, China), with three replicates prepared for each sample. The relative copy number and expression of the HPPD gene in the HT and MT biotypes were calculated using the 2^−ΔΔCt method [16]. Experiments were conducted with eight biological replicates. Data were analyzed with a Student’s t-test (p < 0.05).

2.5. Effects of P450 Inhibitors on Mesotrione Sensitivity

Green foxtails at the 3–4-leaf stage were treated with the P450 inhibitor malathion or piperonyl butoxide (PBO). The herbicide spray was the same as described above. Mesotrione was applied to the MT and HT biotypes at doses of 67.5, 135, 270, 540, 1080, and 2160 g ai ha⁻¹. Malathion at 2000 g ai ha⁻¹ was sprayed 1 h prior to mesotrione application [17]. PBO was dissolved in dimethyl sulfoxide (DMSO) (the final concentration of 3% (v/v)) and Tween-80 (the final concentration of 5% (v/v)) and then diluted with water. PBO was also applied 1 h before the spray of mesotrione at 4100 g ai ha⁻¹ [18,19]. At 21 DAT, the fresh weight of aboveground plants was assessed. All the applications were sprayed by spray chamber with compressed air and a moving nozzle cabinet sprayer, 3WPSH-500D (Nanjing, Jiangsu, China), equipped with one Teejet XR8003 flat fan nozzle (Glendale Heights, IL, USA) calibrated to deliver 450 L ha⁻¹ at 0.3 MPa.

2.6. Determination of P450s Activity In Vivo

At the 3–4-leaf stage, MT and HT biotypes of green foxtail were treated with mesotrione at a rate of 135 g ai ha⁻¹. To assess the effect of the herbicide on cytochrome P450 enzyme activity, shoots from the treated weeds were collected at 0, 1, 2, 3, 4, and 5 days after treatment (DAT) for further analysis. The shoots were used for microsome isolation to facilitate the examination of cytochrome P450 content and activity. These parameters were measured using the cytochrome P450 reductase enzyme-linked immunosorbent assay (ELISA) method, following the instructions provided with the kit from Gene Lab (Beijing, China). The study was conducted twice to ensure consistency and reliability, with three replicates performed for each treatment group.

2.7. Statistical Analyses

To evaluate the herbicide’s effects on growth and determine dose-response relationships for the biotypes under study, a more accurate analysis of weed-tolerance levels was provided. The data from the whole-plant dose-response experiment, which assessed the impact of mesotrione and P450 inhibitors on weed growth, were analyzed as a percentage of the no-herbicide control treatment. After preliminary process, the data were pooled and fitted to a four-parameter nonlinear log-logistic regression model. This model fitting was performed using SigmaPlot version 14.0 (Systat Software, Chicago, IL, USA).

$\mathit{Y}=\mathrm{C}+{\displaystyle \frac{\mathrm{D}-\mathrm{C}}{1+{\left(\frac{x}{\mathrm{G}}\right)}^{\mathrm{b}}}}$

In the model, parameter C is the lower response limit, D is the upper response limit, b is the slope of the curve, G represents the GR₅₀, and variable x indicates the dose [20]. Relative tolerance indices were calculated by dividing the GR₅₀ of the tolerant biotype by that of the susceptible biotype. Additionally, significant differences in the copy number variation, and expression levels were also subjected to Student’s t-test analysis.

3. Results

3.1. Result of Whole-Plant Dose Response to Mesotrione

In the study of HPPD inhibitor tolerance, it was crucial to understand how different biotypes of a species respond to various doses of a particular herbicide. The HT (high tolerance) and MT (moderate tolerance) biotypes showed different dose responses to mesotrione in whole-plant dose-response tests. As shown in Figure 1, compared with the MT biotype, the HT biotype was highly tolerant to mesotrione. The HT biotype displayed significantly higher GR₅₀ values (463.2 g ai ha⁻¹) than that of the wild biotype (271.9 g ai ha⁻¹) with a non-overlapping 95% confidence interval. The GR₅₀ values of the HT biotype were approximately 1.7-fold higher than those of the MT biotype.

3.2. HPPD Gene Cloning and Aligment

The mRNA sequence analysis of the HPPD gene involved testing Target Site Resistance (TSR) through the complete amplification of the HPPD gene using specific primer pairs. The analysis yielded HPPD gene sequences of 1326 base pairs (bp) from both the HT and MT biotypes, as shown in Figure 2. While there were single-nucleotide polymorphisms (SNPs) observed between the reference sequence and the sequences of the two biotypes, a comparison of the HT and MT biotypes with the NCBI reference HPPD amino acid sequence from S. viridis revealed that no amino acid mutations occurred in the HPPD amino acid sequence of either biotype.

3.3. The HPPD Gene Determination of Relative Copy Number and Expression

According to the data presented in Figure 3A, qPCR analysis of gDNA indicated that there was no significant difference in the relative copy number of the HPPD gene between the MT and HT biotypes. This finding suggests that gene amplification is unlikely to be responsible for the higher tolerance to mesotrione observed in the HT biotype. Furthermore, it appears that there may be no copy number variation in the MT biotype concerning the HPPD gene. As illustrated in Figure 3B, no significant difference in HPPD gene expression was detected between the treated and untreated plants within each biotype. Specifically, the expression levels of the HPPD gene in the HT biotype were found to be comparable to those in the MT biotype. These results collectively indicate that overexpression of the HPPD gene does not play a role in conferring greater tolerance to mesotrione in the HT biotype. Instead, it is plausible that the high tolerance exhibited by the HT biotype may be associated with the activity of metabolic enzymes that can detoxify or degrade mesotrione, thereby mitigating its harmful effects on the plant. Further research into these metabolic pathways may provide valuable insights into the mechanisms underlying herbicide tolerance.

3.4. Result of P450 Inhibitors on Mesotrione Sensitivity

Figure 4 and Figure 5 showed the significant changes in the GR₅₀ values of the HT and MT biotypes when mesotrione was applied in conjunction with malathion or PBO (piperonyl butoxide), compared to the treatment with mesotrione alone. Specifically, after pretreatment with malathion, the GR50 values for the HT and MT biotypes were observed to be 32.1 g ai ha⁻¹ and 22.3 g ai ha⁻¹, respectively. In contrast, following pretreatment with PBO, the GR50 values for the HT and MT biotypes significantly decreased to 3.0 g ai ha⁻¹ and 2.7 g ai ha⁻¹, respectively. These findings suggest that P450 enzymes may play a critical role in the enhanced mesotrione tolerance observed in green foxtail. The marked reduction in GR₅₀ values with PBO pretreatment implies that the activity of these enzymes, which are known to metabolize various herbicides, may contribute to the detoxification of mesotrione, thereby allowing the plants to withstand higher concentrations of the herbicide without detrimental effects. Further investigation into the specific P450 pathways involved could provide deeper insights into the mechanisms of herbicide tolerance.

3.5. Activity of the P450s

On day 0, there was no significant difference in enzyme activity between the MT and HT biotypes in the absence of mesotrione, as illustrated in Figure 6. However, following treatment with mesotrione, the activity of cytochrome P450 reductase exhibited distinct responses in the MT and HT biotypes. Specifically, on day 2, the enzyme activity in the HT biotype increased by 1.3 times compared to that in the MT biotype. This elevation in enzyme activity indicates a heightened metabolic response in the HT biotype to the presence of mesotrione. Subsequently, the enzyme activity in the HT biotype gradually decreased over the course of days 3, 4, and 5 (Figure 6). Despite this decline, the enzyme activity remained significantly higher in the HT biotype compared to the MT biotype even after 2 DAT. These findings suggest that the HT biotype not only responds more effectively to mesotrione but also retains a greater level of cytochrome P450 reductase activity, which may play a crucial role in its enhanced tolerance to this herbicide. Further studies are warranted to explore the implications of these enzymatic changes in herbicide-resistance mechanisms.

4. Discussion

Previous research has shown that mesotrione failed to control green foxtail at the recommended field dose [21], indicating that green foxtail exhibits tolerance to the herbicide mesotrione. These findings further confirm that the HT biotype is significantly more tolerant to mesotrione compared to the wild biotype. However, when analyzing the HPPD gene through complete amplification, no mutations were detected between the HT and MT biotypes. This suggests that the higher mesotrione tolerance in the HT biotype is not linked to mutations in the HPPD gene. According to previous research, target gene overexpression results in weed resistance in Lolium. rigidum [22], Conyza canadensis, and Conyza bonariensis [23], which are resistant to glyphosate, and in Hordeum leporinum [24] and Bromus sterilis [25], which are resistant to acetolactate synthase (ALS) inhibitors. However, further experiments revealed that neither copy number variation nor overexpression of the HPPD gene was detected in the HT biotype, ruling out these factors as contributors to its higher tolerance to mesotrione. This suggests that other mechanisms, possibly involving metabolic processes or enzymes such as cytochrome P450s, may play a more significant role in conferring the enhanced tolerance to mesotrione observed in the HT biotype of green foxtail.

Previous research has shown that green foxtail can rapidly metabolize mesotrione, with levels below 0.05 µg per gram of fresh weight 7 days after application [11]. The GR₅₀ values and relative tolerance index values with and without P450 inhibitors (malathion and PBO) indicate that cytochrome P450 reductases may be involved in the metabolism of herbicides [18]. Resistance to HPPD inhibitors has been reported in Amaranthus palmeri [26] and, recently, in Raphanus raphanistrum [27]. The resistant biotypes metabolized HPPD inhibitors at a faster rate than the susceptible populations through hydroxylation reactions, indicating that P450s play a role in the resistance mechanism [26,27]. Interestingly, the GR₅₀ values between the MT and HT biotypes were different under malathion pretreatment, and the GR₅₀ values of the two biotypes were also different under PBO pretreatment. Although green foxtails have a tolerance to mesotrione, it can be seen from the activity of cytochrome P450 reductase results that the activity of the MT biotype increased slowly at 2 DAT, the activity of cytochrome P450 reductase in the HT biotype was higher than the MT biotype. This result indicates that P450s may be involved in mesotrione metabolism.

Although green foxtail has a certain tolerance to mesotrione, another type of HPPD inhibitor, topramezone [28], can effectively control this weed in corn fields [29]. But maximizing the weed control spectrum of one herbicide can reduce agricultural production costs. PBO is commonly used as an insecticide synergist because it significantly reduces the levels of cytochrome P450 enzymes in treated organisms. By inhibiting P450s, PBO enhances the effectiveness of insecticides, preventing the breakdown of toxic compounds and increasing their potency against target pests [30]. Research has been performed on the safety of ALS inhibitors on corn with malathion pretreatment [31]. In subsequent experiments, various experimental methods and technical approaches were employed to further investigate which specific cytochrome P450 enzymes, or groups of P450s, contribute to the high tolerance of the HT biotype to mesotrione. These detailed analyses aim to identify the particular P450 enzymes involved in the detoxification process, providing deeper insights into the mechanisms underlying herbicide tolerance and potentially aiding in the development of improved weed-management strategies.

5. Conclusions

High tolerance to mesotrione was remarkably observed even in the MT biotype. This biotype demonstrated a GR₅₀ value that far exceeded the recommended field dose. In the context of this study, the HT biotype exhibited an even greater degree of tolerance. This suggests that it may have been continuously subjected to intense selection pressure from HPPD inhibitor herbicides. As a consequence, there is a strong possibility that the HT biotype could be in the process of transitioning from mere herbicide tolerance to full-blown resistance. This significant shift is likely to be facilitated by enhanced mechanisms, particularly those mediated by the metabolic enzyme cytochrome P450s. The increased activity of these crucial enzymes could play a major role in contributing to the plant’s remarkable ability to detoxify the herbicide. This, in turn, further promotes the evolution of resistance in the HT biotype, potentially leading to more challenges in weed management and agricultural practices.

Author Contributions

Conceptualization, Y.L.; Methodology, Y.C.; Software, Y.S.; Formal Analysis, Y.L.; Investigation, Y.C.; Data Curation, R.W.; Writing—Original Draft Preparation, Y.L.; Writing—Review and Editing, Z.H.; Project Administration, Z.H. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Figures and Table

Figure 1. The dose-response curves depicted plant growth of MT and HT biotypes under mesotrione treatment. Vertical bars represent standard errors (SEs), while the colored ribbons indicate the 95% confidence intervals (both R2 [greater than] 0.99).

Figure 2. Sequence alignment of coding sequences of HPPD genes in MT biotype and HT biotype. The orange arrows in the figure indicated SNPs in the sequence. The Setaria_viridis means the reference HPPD gene sequence of S. viridis in NCBI.

Figure 3. Target gene copy number and expression analysis. (A) Relative HPPD gene copy number. (B) Relative HPPD gene expression level (the T means treated with mesotrione, the CK means only treated with water, ns means not significant).

Figure 4. (A) Whole-plant dose response of the tolerance to mesotrione with the malathion pretreatment in the MT and HT green foxtail biotypes at 21 DAT. (B) Whole-plant dose response of the tolerance to mesotrione with the PBO pretreatment in the MT and HT green foxtail biotypes at 21 DAT. (C) Only the malathion or PBO treatment to the MT and HT green foxtail biotypes at 21 DAT (the CK means only treated with water).

Figure 5. Dose-response curves of the plant growth of the green foxtail biotypes under the mesotrione treatment with the P450 inhibitors pretreatment. (A) means both biotypes under the mesotrione treatment with the malathion pretreatment; (B) means both biotypes under the mesotrione treatment with the PBO pretreatment. Vertical bars indicate the SEs (all R2 [greater than] 0.99).

Figure 6. Comparison of the activities of cytochrome P450 reductase between MT and HT biotypes at 0, 1, 2, 3, 4, and 5 days after mesotrione treatment.

Table 1

Primers used in HPPD gene relative copy number and expression studies.

Primer Name	Primer Sequence (5′-3′)
Actin	F: GCACCACCTGAGAGGAAATATAGR: CTCATCGTACTCCGCCTTTG
HPPD-GSP	F: GGGCAGGAATACCAGAAGGGR: CGCAGCAGCTTGCTTTGATT

References

1. Blackshaw, R.E.; Harker, K.N.; O’Donovan, J.T.; Beckie, H.J.; Smith, E.G. Ongoing Development of Integrated Weed Management Systems on the Canadian Prairies. Weed Sci.; 2008; 56, pp. 146-150. [DOI: https://dx.doi.org/10.1614/WS-07-038.1]

2. Li, P.; Brutnell, T.P. Setaria Viridis and Setaria Italica, Model Genetic Systems for the Panicoid Grasses. J. Exp. Bot.; 2011; 62, pp. 3031-3037. [DOI: https://dx.doi.org/10.1093/jxb/err096]

3. Doust, A.; Diao, X. Genetics and Genomics of Setaria. Plant Genetics and Genomics: Crops and Models; Springer: Cham, Switzerland, 2017; Volume 19, ISBN 978-3-319-45103-9

4. Shanker, A.; Venkateswarlu, B. Abiotic Stress in Plants—Mechanisms and Adaptations; InTech: Rijeka, Croatia, 2011; ISBN 978-953-307-394-1

5. Beaudegnies, R.; Edmunds, A.J.F.; Fraser, T.E.M.; Hall, R.G.; Hawkes, T.R.; Mitchell, G.; Schaetzer, J.; Wendeborn, S.; Wibley, J. Herbicidal 4-Hydroxyphenylpyruvate Dioxygenase Inhibitors—A Review of the Triketone Chemistry Story from a Syngenta Perspective. Bioorg. Med. Chem.; 2009; 17, pp. 4134-4152. [DOI: https://dx.doi.org/10.1016/j.bmc.2009.03.015]

6. Siefermann-Harms, D. The Light-Harvesting and Protective Functions of Carotenoids in Photosynthetic Membranes. Physiol. Plant.; 1987; 69, pp. 561-568. [DOI: https://dx.doi.org/10.1111/j.1399-3054.1987.tb09240.x]

7. Chen, M.-X.; Mei, L.-C.; Wang, F.; Boyagane Dewayalage, I.K.W.; Yang, J.-F.; Dai, L.; Yang, G.-F.; Gao, B.; Cheng, C.-L.; Liu, Y.-G. et al. PlantSPEAD: A Web Resource towards Comparatively Analysing Stress-Responsive Expression of Splicing-Related Proteins in Plant. Plant Biotechnol. J.; 2021; 19, pp. 227-229. [DOI: https://dx.doi.org/10.1111/pbi.13486]

8. Hao, G.-F.; Jiang, W.; Ye, Y.-N.; Wu, F.-X.; Zhu, X.-L.; Guo, F.-B.; Yang, G.-F. ACFIS: A Web Server for Fragment-Based Drug Discovery. Nucleic Acids Res.; 2016; 44, pp. W550-W556. [DOI: https://dx.doi.org/10.1093/nar/gkw393]

9. Fu, Y.-X.; Zhang, Z.-Y.; Guo, W.-Y.; Dai, Y.-J.; Wang, Z.-Y.; Yang, W.-C.; Yang, G.-F. In Vivo Fluorescent Screening for HPPD-Targeted Herbicide Discovery. Pest Manag. Sci.; 2022; 78, pp. 4947-4955. [DOI: https://dx.doi.org/10.1002/ps.7117]

10. Ndikuryayo, F.; Moosavi, B.; Yang, W.-C.; Yang, G.-F. 4-Hydroxyphenylpyruvate Dioxygenase Inhibitors: From Chemical Biology to Agrochemicals. J. Agric. Food Chem.; 2017; 65, pp. 8523-8537. [DOI: https://dx.doi.org/10.1021/acs.jafc.7b03851]

11. Mitchell, G.; Bartlett, D.W.; Fraser, T.E.M.; Hawkes, T.R.; Holt, D.C.; Townson, J.K.; Wichert, R.A. Mesotrione: A New Selective Herbicide for Use in Maize. Pest Manag. Sci.; 2001; 57, pp. 120-128. [DOI: https://dx.doi.org/10.1002/1526-4998(200102)57:2<120::AID-PS254>3.0.CO;2-E]

12. Nakka, S.; Godar, A.S.; Wani, P.S.; Thompson, C.R.; Peterson, D.E.; Roelofs, J.; Jugulam, M. Physiological and Molecular Characterization of Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor Resistance in Palmer Amaranth (Amaranthus palmeri S. Wats.). Front. Plant Sci.; 2017; 8, 555. [DOI: https://dx.doi.org/10.3389/fpls.2017.00555]

13. Creech, J.E.; Monaco, T.A.; Evans, J.O. Photosynthetic and Growth Responses of Zea Mays L and Four Weed Species Following Post-Emergence Treatments with Mesotrione and Atrazine. Pest Manag. Sci.; 2004; 60, pp. 1079-1084. [DOI: https://dx.doi.org/10.1002/ps.924]

14. WSSA “Herbicide Resistance” and “Herbicide Tolerance” Defined. Weed Technol.; 1998; 12, 789. [DOI: https://dx.doi.org/10.1017/S0890037X00044766]

15. Wang, T.; Song, H.; Wei, Y.; Li, P.; Hu, N.; Liu, J.; Zhang, B.; Peng, R. High Throughput Deep Sequencing Elucidates the Important Role of lncRNAs in Foxtail Millet Response to Herbicides. Genomics; 2020; 112, pp. 4463-4473. [DOI: https://dx.doi.org/10.1016/j.ygeno.2020.07.045]

16. Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc.; 2008; 3, pp. 1101-1108. [DOI: https://dx.doi.org/10.1038/nprot.2008.73]

17. Huang, Z.; Lu, Z.; Huang, H.; Li, W.; Cao, Y.; Wei, S. Target Site Mutations and Cytochrome P450s-Involved Metabolism Confer Resistance to Nicosulfuron in Green Foxtail (Setaria viridis). Pestic. Biochem. Physiol.; 2021; 179, 104956. [DOI: https://dx.doi.org/10.1016/j.pestbp.2021.104956]

18. Wang, H.; Li, J.; Lv, B.; Lou, Y.; Dong, L. The Role of Cytochrome P450 Monooxygenase in the Different Responses to Fenoxaprop-P-Ethyl in Annual Bluegrass (Poa annua L.) and Short Awned Foxtail (Alopecurus aequalis Sobol.). Pestic. Biochem. Physiol.; 2013; 107, pp. 334-342. [DOI: https://dx.doi.org/10.1016/j.pestbp.2013.10.001]

19. Liu, Y.; Wang, H.; Fang, J.; Gao, H.; Chen, J.; Peng, Z.; Dong, L. Target-Site and Metabolic Mechanisms of Tolerance to Penoxsulam in Pond Lovegrass (Eragrostis japonica). Weed Sci.; 2023; 71, pp. 29-38. [DOI: https://dx.doi.org/10.1017/wsc.2022.63]

20. Lan, Y.; Zhou, X.; Lin, S.; Cao, Y.; Wei, S.; Huang, H.; Li, W.; Huang, Z. Pro-197-Ser Mutation and Cytochrome P450-Mediated Metabolism Conferring Resistance to Flucarbazone-Sodium in Bromus japonicus. Plants; 2022; 11, 1641. [DOI: https://dx.doi.org/10.3390/plants11131641]

21. Boydston, R.A.; Collins, H.P.; Fransen, S.C. Response of Three Switchgrass (Panicum virgatum) Cultivars to Mesotrione, Quinclorac, and Pendimethalin. Weed Technol.; 2010; 24, pp. 336-341. [DOI: https://dx.doi.org/10.1614/WT-D-09-00053.1]

22. Baerson, S.R.; Rodriguez, D.J.; Biest, N.A.; Tran, M.; You, J.; Kreuger, R.W.; Dill, G.M.; Pratley, J.E.; Gruys, K.J. Investigating the Mechanism of Glyphosate Resistance in Rigid Ryegrass (Lolium ridigum). Weed Sci.; 2002; 50, pp. 721-730. [DOI: https://dx.doi.org/10.1614/0043-1745(2002)050[0721:ITMOGR]2.0.CO;2]

23. Gaines, T.A.; Duke, S.O.; Morran, S.; Rigon, C.A.G.; Tranel, P.J.; Küpper, A.; Dayan, F.E. Mechanisms of Evolved Herbicide Resistance. J. Biol. Chem.; 2020; 295, pp. 10307-10330. [DOI: https://dx.doi.org/10.1074/jbc.REV120.013572]

24. Yu, Q.; Nelson, J.K.; Zheng, M.Q.; Jackson, M.; Powles, S.B. Molecular Characterisation of Resistance to ALS-Inhibiting Herbicides in Hordeum leporinum Biotypes. Pest Manag. Sci.; 2007; 63, pp. 918-927. [DOI: https://dx.doi.org/10.1002/ps.1429]

25. Sen, M.K.; Hamouzová, K.; Mikulka, J.; Bharati, R.; Košnarová, P.; Hamouz, P.; Roy, A.; Soukup, J. Enhanced Metabolism and Target Gene Overexpression Confer Resistance against Acetolactate Synthase-Inhibiting Herbicides in Bromus sterilis. Pest Manag. Sci.; 2021; 77, pp. 2122-2128. [DOI: https://dx.doi.org/10.1002/ps.6241]

26. Küpper, A.; Peter, F.; Zöllner, P.; Lorentz, L.; Tranel, P.J.; Beffa, R.; Gaines, T.A. Tembotrione Detoxification in 4-Hydroxyphenylpyruvate Dioxygenase (HPPD) Inhibitor-Resistant Palmer Amaranth (Amaranthus palmeri S. Wats.). Pest Manag. Sci.; 2018; 74, pp. 2325-2334. [DOI: https://dx.doi.org/10.1002/ps.4786]

27. Lu, H.; Yu, Q.; Han, H.; Owen, M.J.; Powles, S.B. Evolution of Resistance to HPPD-Inhibiting Herbicides in a Wild Radish Population via Enhanced Herbicide Metabolism. Pest Manag. Sci.; 2020; 76, pp. 1929-1937. [DOI: https://dx.doi.org/10.1002/ps.5725]

28. Grossmann, K.; Ehrhardt, T. On the Mechanism of Action and Selectivity of the Corn Herbicide Topramezone: A New Inhibitor of 4-Hydroxyphenylpyruvate Dioxygenase. Pest Manag. Sci.; 2007; 63, pp. 429-439. [DOI: https://dx.doi.org/10.1002/ps.1341]

29. Soltani, N.; Kaastra, A.C.; Swanton, C.J.; Sikkema, P.H. Efficacy of Topramezone and Mesotrione for the Control of Annual Grasses. Int. Res. J. Agric. Sci. Soil Sci.; 2012; 2, pp. 46-50.

30. Hodgson, E.; Levi, P.E. Interactions of Piperonyl Butoxide with Cytochrome P450. Piperonyl Butoxide; Jones, D.G. Academic Press: London, UK, 1999; pp. 41-II. ISBN 978-0-12-286975-4

31. Paporisch, A.; Rubin, B. Isoxadifen Safening Mechanism in Sweet Corn Genotypes with Differential Response to P450-Metabolized Herbicides. Pestic. Biochem. Physiol.; 2017; 138, pp. 22-28. [DOI: https://dx.doi.org/10.1016/j.pestbp.2017.02.002]