Antimicrobial Potential of Probiotic Strains From Bulgarian Cheese and Shallot Yogurt Against Staphylococcus saprophyticus

Abstract

[...]it is imperative to explore alternate approaches for the prevention and treatment of uncomplicated UTIs caused by S. saprophyticus. Shallot yogurt exhibits commendable nutritional and sensory characteristics, including its notable levels of protein, calcium, phosphorus, vitamin C, and dietary fiber, as well as its minimal quantities of lactose and fat. The antibiotics that were utilized were listed as follows: cefoxitin (30 μg), erythromycin (15 μg), clindamycin (2 μg), gentamycin (120 μg), doxycycline (30 μg), nitrofurantoin (300 μg), linezolid (30 μg), cefoperazone (75 μg), rifampicin (5 μg), trimethoprim/sulfamethoxazole (1.25/23.75 μg), and tetracycline (30 μg). [...]the following antibiotics were used to test the susceptibility of probiotic isolates: nitrofurantoin (300 μg), erythromycin (15 μg), clindamycin (2 μg), gentamycin (120 μg), ciprofloxacin (5 μg), ampicillin (10 μg), linezolid (30 μg), penicillin (10 μg), rifampicin (5 μg), tetracycline (30 μg), trimethoprim/sulfamethoxazole (1.25/23.75 μg), and vancomycin (30 μg). Probiotic cultures were inoculated into the chilled BHI broth, and the mixture was incubated at the specified low temperature (4°C) for 24 h. This cold enrichment process allowed for the selective proliferation of probiotic bacteria while suppressing the growth of nonprobiotic or pathogenic microorganisms.

This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

1. Introduction

An uncomplicated urinary tract infection (UTI) refers to a bacterial infection that specifically affects the bladder and related anatomical tissues. This condition is observed in people who do not exhibit any structural abnormalities or concurrent medical conditions, such as diabetes, immunodeficiency, or pregnancy. Uncomplicated UTI is alternatively referred to as cystitis or lower UT [1]. Staphylococcus saprophyticus, a gram-positive, coagulase-negative coccus, is identified as a uniquely causative agent of uncomplicated UTIs. It is estimated to be responsible for approximately 10%–20% of UTIs acquired within the community, primarily affecting sexually active females in their younger age groups [2, 3]. S. saprophyticus can stick to uroepithelial cells and form biofilms, which play a significant role in its pathogenicity and antibiotic resistance [4]. The prevalence of uncomplicated UTIs caused by S. saprophyticus is impacted by various factors, including sexual activity, contraceptive usage, genetic predisposition, and anomalies in the urinary system [4, 5]. The adhesion and biofilm formation of S. saprophyticus is facilitated by a range of molecular processes and factors, including surface proteins, extracellular polysaccharides, quorum sensing, and environmental conditions [6, 7]. The current treatment approach for UTIs caused by S. saprophyticus encounters various problems and constraints, including rising rates of resistance, side effects, recurrence, and ecological consequences [8]. Hence, it is imperative to explore alternate approaches for the prevention and treatment of uncomplicated UTIs caused by S. saprophyticus.

One potential strategy is the utilization of probiotics, which are live bacteria that provide advantageous effects on the host’s health when provided in sufficient quantities [9]. Probiotics can demonstrate antimicrobial properties against a range of pathogens, such as S. saprophyticus, through the production of organic acids, hydrogen peroxide, bacteriocins, and other bioactive compounds [10, 11]. In addition to their known effects, probiotics can regulate the immune system of the host, improve the function of the intestinal barrier, and prevent the attachment and infiltration of harmful microorganisms [12].

Probiotics are present in a range of fermented dairy products, including yogurt and cheese, which have a long-standing cultural consumption history in numerous nations [13]. Bulgarian cheese and shallot yogurt are notable for their abundance of probiotic bacteria from the Lactobacillus and Bifidobacterium genera, which have demonstrated advantageous impacts on human well-being. The aforementioned effects encompass the enhancement of the gut microbiota, fortification of the immune system, prevention of infections, reduction of cholesterol and blood pressure levels, and regulation of inflammation [14, 15]. Bulgarian yogurt and cheese are produced by employing distinct starter cultures comprising strains of Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus, alongside other indigenous microorganisms, play a role in shaping the sensory and functional characteristics of these food items [16]. The starter cultures possess unique molecular and biochemical attributes, including proteolytic, lipolytic, and glycolytic activities, as well as the ability to produce organic acids, volatile compounds, and exopolysaccharides. Additionally, they exhibit interactions with other microorganisms [17].

Shallot yogurt is a traditional fermented dairy product that enjoys popularity in Bulgaria and other countries within the Balkan region. The production process involves the incorporation of finely diced shallots (Allium cepa var. aggregatum) into milk, which is subsequently fermented using yogurt starter culture. The unique taste and scent of shallot yogurt can be attributed to the sulfur compounds found in shallots, which are also known to possess antibacterial and antioxidant properties [18]. Shallot yogurt exhibits commendable nutritional and sensory characteristics, including its notable levels of protein, calcium, phosphorus, vitamin C, and dietary fiber, as well as its minimal quantities of lactose and fat. Additionally, it is distinguished by its appealing taste, texture, and color [18, 19].

The objective of this research is to assess the antibacterial efficacy of probiotic microorganisms derived from Bulgarian cheese and shallot yogurt against S. saprophyticus. It is postulated that these strains possess the capability to impede the proliferation and production of biofilms in S. saprophyticus by the synthesis of diverse antimicrobial agents and by vying for adhesion sites. Additionally, we explore the potential mechanisms of action associated with these probiotic strains, as well as their safety and compatibility with human cells.

2. Materials and Methods

2.1. Isolation of Lactobacillus Strains

In total, six samples of fresh Bulgarian cheese and shallot yogurt were randomly collected from local markets in Isfahan, Iran, and designated as A1 to A6. All samples were collected and processed on the same day. Following collection, the samples were promptly transported to the laboratory under refrigeration conditions (4°C) to prevent spoilage. Subsequently, 2 g of each sample were aseptically dissolved in 18 mL of normal saline (at a 1:10 $w/v$ ratio) and agitated at 600 rpm for 10 min. Thereafter, 1 mL of each prepared sample was aseptically transferred to 10 mL of MRS broth media (Merck, Germany) within a microaerobic environment enriched with 5% CO₂. These sample dilutions (0.01 mL) were then plated onto MRS agar plates (Merck, Germany) and subsequently incubated for 48 h. Following incubation, colonies exhibiting growth on the agar plates were subcultured into a broth culture medium and further incubated at 37°C for 24 h. For subsequent analysis, the isolated bacterial strains were preserved by submerging them in a preservation medium consisting of 10% skim milk ($w/v$) and 30% glycerol ($w/v$) and maintained at −70°C [20].

2.2. Isolation and Identification of Clinical S. saprophyticus spp.

Urine samples were collected from subjects on clinical signs of UTI diagnosed by licensed health care professionals based on reported symptoms and clinical evaluation. Clean-catch midstream urine samples were collected in sterile containers using standard aseptic techniques. Patient confidentiality was maintained by using sample codes that deidentified the samples. Afterward, the samples were subjected to cultivation on blood agar and MacConkey agar media. The plates were subjected to incubation at a temperature of 37°C for a duration of 24 h, after which they were assessed for the presence of bacterial proliferation. The gram-positive cocci, which exhibited catalase-positive and coagulase-negative characteristics, were subsequently subjected to a novobiocin susceptibility test for further identification. A circular medium infused with 5 μg of novobiocin was positioned on a bacterial growth layer spread on Mueller–Hinton agar. The agar plate was then subjected to incubation at a temperature of 37°C for a duration of 18 h. The measurement and interpretation of the zone of inhibition surrounding the disc were conducted following the recommendations established by the Clinical and Laboratory Standards Institute (CLSI) [21]. Novobiocin-resistant isolates with a zone diameter of ≤ 16 mm were identified as S. saprophyticus.

2.3. Antibiotic Susceptibility Evaluation

The antibiotic resistance patterns of clinical isolates of S. saprophyticus were assessed by employing the disc diffusion technique following the recommendations set by the CLSI [21]. The antibiotics that were utilized were listed as follows: cefoxitin (30 μg), erythromycin (15 μg), clindamycin (2 μg), gentamycin (120 μg), doxycycline (30 μg), nitrofurantoin (300 μg), linezolid (30 μg), cefoperazone (75 μg), rifampicin (5 μg), trimethoprim/sulfamethoxazole (1.25/23.75 μg), and tetracycline (30 μg). Moreover, the following antibiotics were used to test the susceptibility of probiotic isolates: nitrofurantoin (300 μg), erythromycin (15 μg), clindamycin (2 μg), gentamycin (120 μg), ciprofloxacin (5 μg), ampicillin (10 μg), linezolid (30 μg), penicillin (10 μg), rifampicin (5 μg), tetracycline (30 μg), trimethoprim/sulfamethoxazole (1.25/23.75 μg), and vancomycin (30 μg).

2.4. Agar Well Diffusion Method

The Muller–Hinton agar plates were prepared and inoculated with 0.1 mL of a suspension of S. saprophyticus containing 10⁶ colony-forming units per milliliter. The suspension was evenly spread across the entire surface of the agar plates. Afterward, sterile cork borers were used to punch 6 mm-diameter holes into the agar. Next, 50 μL of Bulgarian cheese and shallot yogurt extracts were added to their corresponding wells using a micropipette. The plates were incubated at 37°C for 24 h to promote the diffusion of antimicrobial agents. After incubation, the diameter of the zones of inhibition surrounding each well was measured using a ruler, and the measurements were recorded. The assay was performed in triplicate to evaluate the antimicrobial efficacy of the extracts or supernatants against the growth of S. saprophyticus [22].

2.5. Time–Kill Test in Cocultures

This experiment is aimed at identifying the most effective probiotic strain within a specified timeframe. The time–kill assay involved combining S. saprophyticus cells with the cell-free supernatant of Lactobacillus spp. for coculture. A suspension with a turbidity equivalent to 0.5 McFarland was prepared using the S. saprophyticus strain. Next, the supernatant was added to the suspension. The sample was cultured on blood agar medium and incubated at 37°C for 24 h at various time points: 0, 1, 2, 4, 8, 12, 24, and 48 h [22].

2.6. Cold Enrichment of Probiotic Bacteria

BHI broth was prepared and cooled to a low temperature (4°C) to create a cold environment. Probiotic cultures were inoculated into the chilled BHI broth, and the mixture was incubated at the specified low temperature (4°C) for 24 h. This cold enrichment process allowed for the selective proliferation of probiotic bacteria while suppressing the growth of nonprobiotic or pathogenic microorganisms. Subsequently, bacterial growth in the medium was assessed by observing turbidity [22].

2.7. Broth Microdilution Method

The measurement of antibacterial activity, namely, the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC), was conducted on cell-free supernatants derived from probiotics that were cultivated in the presence of clinical isolates of S. saprophyticus. No further turbidity was observed thereafter to ascertain accuracy. The pathogenic strain was subsequently cultivated on a blood agar medium and subjected to an additional incubation period of 24 h at 37°C. This investigative process revealed the inhibitory effect of probiotics on the pathogenic strain, shedding light on their potential as agents against S. saprophyticus [22].

2.8. Antibiofilm Effect of Lactobacilli

A 24-well plate was utilized to assess the antibiofilm activity of various strains of lactobacilli isolates against the pathogenic bacterium S. saprophyticus. Lactobacilli supernatants were acquired after an overnight culture at 37°C in MRS broth. To isolate the bacterial cells from the supernatant, the cultures were centrifuged at $\mathrm{10,000}\times \text{g}$ for 15 min. Filtration was performed on the supernatants using a 0.22 μm filter in order to remove any remaining bacterial cells. Until further use, the sterile supernatants were stored at −80°C. The evaluation of S. saprophyticus biofilm formation was conducted utilizing 24-well tissue culture plates. After dilution of overnight cultures of S. saprophyticus to an optical density at 600 nm (OD600) of 0.1, each well received 1 mL of this bacterial suspension. For the formation of biofilm, plates were incubated at 37°C for a duration of 24 h. To evaluate the antibiofilm activity of supernatants derived from lactobacilli, different dilutions of the supernatants were introduced into S. saprophyticus biofilms. Plates were incubated for an additional 24 h. Without supernatant treatment, S. saprophyticus biofilms were present in the control wells. The biofilms were quantified using crystal violet staining, and the optical density was determined at 570 nm following incubation. Experiments were conducted in triplicate, and significant differences were determined through statistical analysis [23].

2.9. High-Performance Liquid Chromatography (HPLC) of Lactobacilli Supernatants

Lactobacillus isolates were grown in MRS broth for 72 h. The cultures were then centrifuged at 10,000 g for 10 min. The supernatant was carefully collected and filtered through a 0.22 μm syringe to ensure sterility. To ensure lactobacilli-free growth, the filtrate was recultivated in MRS broth medium for 72 h. The HPLC apparatus received 20 μL of the sterile filtrate after sterility verification. The separation of chemicals was done using reversed-phase HPLC columns C18 (25 cm, 4.6 mm). An aqueous solution of phosphate buffer and acetonitrile (CH₃CN) at 10 mM and pH 3.6 was used as the mobile phase. To identify and quantify the chemical, UV absorbance at 282 nm was measured at room temperature, 25°C, after the separation at 1 mL/min. A thorough HPLC methodology was used to analyze lactobacilli supernatants, ensuring reliable and reproducible results [22].

2.10. Acid and Bile Salt Tolerance Assay

The acid and bile salt tolerance of lactobacilli isolates were assessed using the methodology described by Duc et al. [24], with minor modifications. In this study, an MRS broth with a pH of 2.5 was created and subsequently infected with a bacterial cell suspension including all of the isolates. Samples of 0.5 mL were examined at 0, 1, 2, and 3 h to determine the total number of live cells. The plate counts on MRS agar were subjected to incubation at a temperature of 37°C for a duration of 24 h under a pH condition of 2.5. To assess bile salt tolerance, an MRS broth supplemented with oxgall (0.3%) was prepared and afterwards inoculated with 1 mL of a 48-h-old culture. Samples were collected at 0- and 3-h intervals. The dilutions that were deemed suitable were directly plated onto nutrient agar plates. The plates were subjected to incubation at a temperature of 37°C for a duration of 24 h to ascertain the number of colony forming units (CFU). After experimenting three times, the mean values of each bacterial isolate were considered [20].

2.11. Cytotoxicity Assay

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was employed to evaluate the cytotoxicity of lactobacilli supernatants on L929 fibroblast cells. The assay employs MTT as a measure of cell viability. The L929 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin. The cells were maintained at a temperature of 37°C with 5% CO₂ until they reached 80% confluence. Different dilutions of lactobacilli supernatants were introduced to L929 cells, which were subsequently incubated for 24 h. The control wells consisted of cells that were cultured in a medium without any treatment of the supernatant. Following the incubation period, the addition of MTT solution was carried out for each well, and subsequent solubilization of formazan crystals was achieved using dimethyl sulfoxide (DMSO). Cell viability as a percentage of the control was determined by measuring the absorbance at 570 nm using a microplate reader (BioTek Instruments Inc., Vermont, United States). The cytotoxicity assessment was conducted in triplicate to ensure experimental reliability [9].

2.12. Identification of Lactobacilli Isolates

A multistep procedure was required to identify potent Lactobacillus isolates that exhibited inhibitory and antibiofilm properties against pathogenic strains. In accordance with established protocols [20], isolates were initially chosen based on their classical characteristics, which included morphology, cultural traits, and biochemical attributes. The strains that were initially identified using conventional methods were subsequently verified through 16S ribosomal DNA (rDNA) PCR using universal primers: Universal 2 (1492r): TACGGYTACCTTGTTACGACTT and Universal 1 (27f): AGAGTTTGATCCTGGCTCAG (Cinnagen Company, Iran), respectively. To amplify the 16S rDNA gene, the amplification protocol consisted of the subsequent steps: an initial denaturation cycle at 94°C for a duration of 5 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 54°C for 30 s, and extension at 72°C for 5 min; and a final extension cycle at 72°C for 5 min. Following this, the positive PCR products underwent nucleotide sequencing at the facility of Macrogen Inc. (Seoul, Korea). Following this, the acquired sequences underwent BLAST searches in the database of the National Center for Biotechnology Information (NCBI) to ensure their accuracy and registration.

2.13. Statistical Analysis

Each experiment was performed three times, and the mean and standard error values were calculated using SPSS software (SPSS Inc. No. 22).

3. Results

3.1. S. saprophyticus Isolation and Antibiotic Sensitivity Pattern

The isolation and identification of 100 S. saprophyticus strains from clinical samples were performed by morphological and biochemical tests. The most common source of S. saprophyticus was the cervix (45%), followed by urine (35%), urethra (15%), and other sites (5%), respectively. The antibiotic susceptibility pattern of clinical S. saprophyticus isolates revealed that all strains (100%) were resistant to tetracycline and doxycycline, which are commonly used antibiotics for UTIs. However, all strains (100%) were susceptible to the other antibiotics tested, such as clindamycin, gentamycin, nitrofurantoin, and linezolid (Table 1).

Table 1

The antibiotic resistance patterns of S. saprophyticus isolates.

	FOX	E	CC	GM	D	FM	LZ	CP	RA	SXT	TE
Resistant (%)	—	—	—	—	100	—	—	—	—	—	100
Sensitive (%)	100	100	100	100	—	100	100	100	100	100	—

3.2. Isolation, Screening, and Identification of Lactobacilli

Based on gram staining, catalase test, and cell morphology, 33 out of 67 isolates from Bulgarian cheese and shallot yogurt were classified as lactic acid bacteria (LAB). All isolates were gram-positive, catalase-negative, and γ-hemolytic. The isolates exhibited different morphologies, such as cocci in pairs or chains and rods in pairs or chains. Two isolates, named M and B, showed the highest antibacterial activity against clinical S. saprophyticus isolates, which were isolated from shallot yogurt and Bulgarian cheese, respectively. Further identification by 16S rRNA gene sequencing revealed that they belonged to the genus Lactobacillus rhamnosus M and B with the assigned accession numbers PQ083436 and PQ083437, respectively. Moreover, they demonstrated resistance to bile and acid stress, as well as the ability to grow at low temperature (4°C) for 24 h. Finally, the genome sequences of the two Lactobacillus strains, M and B, were deposited in the NCBI database and assigned the accession numbers ON837155.

3.3. Antimicrobial Assessment of Lactobacilli Isolates Against S. saprophyticus

The inhibitory impact of the supernatants from probiotic bacteria M and B on S. saprophyticus was established by the utilization of the 24-well microtiter plate assay. No significant alteration in optical density was detected in any of the wells when the supernatants were cocultivated with S. saprophyticus. Following a 24-h incubation period, it was observed that the wells containing 1 and 1/2 dilutions of the supernatants did not exhibit any bacterial growth. This observation suggests that these particular concentrations demonstrated bactericidal properties against S. saprophyticus. Nevertheless, it was observed that bacterial colonies were present in the wells containing supernatant dilutions of 1/4, 1/8, and 1/16. This observation suggests that these concentrations were inadequate in inhibiting the growth of S. saprophyticus. Therefore, the MIC of the probiotic supernatants against S. saprophyticus was determined as 1/2 dilution, based on the absence of turbidity in the 24-well microtiter plate assay.

To determine the MBC, 50 μL of the supernatants from the wells with no turbidity (1 and 1/2 dilution) were transferred to blood agar plates using sterile swabs and incubated at 37°C for 24 h. No bacterial growth was observed on the plate with 1/2 dilution of the supernatants, indicating that this concentration was bactericidal for S. saprophyticus. Therefore, the probiotic supernatants had the same concentration for both MBC and MIC against S. saprophyticus.

The antibiofilm activity of the probiotic supernatants was also evaluated by measuring the optical density of the biofilms formed by S. saprophyticus in the presence of different concentrations of the supernatants. The results showed that the probiotic supernatants inhibited biofilm formation by S. saprophyticus at 1, 1/2, and 1/4 dilutions, but not at 1/8 and 1/16 dilutions, suggesting that these concentrations were subinhibitory for S. saprophyticus.

3.4. Pattern of Antibiotic Susceptibility and Virulence Factor of Probiotics

The antibiotic susceptibility patterns of the probiotic strains M and B were determined by the disc diffusion method. Both strains were sensitive to most of the tested antibiotics, such as erythromycin, clindamycin, gentamycin, ciprofloxacin, ampicillin, linezolid, penicillin, rifampicin, and tetracycline. However, both strains were resistant to trimethoprim/sulfamethoxazole and vancomycin. Moreover, strain M was susceptible to nitrofurantoin, whereas strain B was resistant to it.

The virulence factors of the probiotic strains M and B were assessed by testing their ability to produce DNase, β-hemolysin, catalase, CAMP factor, and gelatinase enzymes. Both strains were negative for all these tests, indicating that they lacked these virulence factors.

3.5. Cytotoxicity Assay

The cytotoxicity of the probiotic strains M and B was evaluated by measuring their effect on the viability of the L929 fibroblast cell line using the MTT assay. The results showed that the cytotoxicity of strain M was 7.1% and that of strain B was 6.3, which was not significantly different from the cytotoxicity of the control sample of 6.5% ($p>0.05$). This indicated that both probiotic strains had a low level of cytotoxicity and did not adversely affect the viability of the L929 fibroblast cell line.

3.6. HPLC Analyzing

The inhibitory effect of the organic acids produced by the probiotic strains M and B on S. saprophyticus was investigated by neutralizing the acidic pH of the culture supernatants. The results showed that all S. saprophyticus strains were able to grow in the neutralized supernatants, indicating that the organic acids were responsible for the antibacterial activity of the probiotics.

The type and concentration of the organic acids were determined by HPLC analysis. The results revealed that the probiotic strains M and B produced three organic acids: formic acid, lactic acid, and acetic acid. The concentration of each organic acid varied between the two strains. Strain M produced more acetic acid (535.2 mg/L) than formic acid (280.8 mg/L) and lactic acid (254.3 mg/L). Strain B produced more formic acid (338.4 mg/L) and acetic acid (301.4 mg/L) than lactic acid (174.7 mg/L) (Figure 1).

[figure(s) omitted; refer to PDF]

4. Discussion

UTIs, particularly those caused by S. saprophyticus, a gram-positive coccus found in the normal flora of the female genital tract and perineum, present significant challenges due to their prevalence and the emergence of antibiotic resistance [1, 2, 25]. The bacterium’s ability to adhere to uroepithelial cells and persistently grow in the urinary tract makes it a common cause of community-acquired UTIs [2, 26]. This study is aimed at exploring the potential of probiotic strains, such as L. rhamnosus, derived from Bulgarian cheese and shallot yogurt as alternatives for combating S. saprophyticus infections. L. rhamnosus, originally considered a subspecies of L. casei but later identified as a separate species through genetic research, is a gut-friendly bacterium used as a probiotic, particularly useful in treating infections of the female urogenital tract [27, 28]. It can help relieve diarrhea, IBS symptoms, and cavities, and aid gut health, teeth, and oral health. Lactobacillus rhamnosus, adept at thriving within the gastrointestinal tract, presents promising long-term advantages [29]. It is commonly employed as a probiotic supplement and frequently incorporated into various dairy products such as yogurts, cheeses, and milk to augment their probiotic constituents [30]. The findings provide insights into the antimicrobial efficacy, safety, and mechanisms of action of these probiotic strains, offering a better understanding of both L. rhamnosus and S. saprophyticus, the latter being part of the normal flora in humans that colonizes areas like the perineum, rectum, urethra, cervix, and gastrointestinal tract, despite being a common cause of UTIs [2]. This understanding can help in developing effective strategies for the prevention and treatment of UTIs.

Antibiotic susceptibility of S. saprophyticus plays a critical role in managing UTIs, particularly in young, sexually active women [2, 31]. The effectiveness of treatment regimens directly depends on the bacterium’s resistance or sensitivity to antibiotics. In UTIs, antibiotic-resistant S. saprophyticus strains can lead to treatment failure, prolonged infection, and increased complications [32]. For instance, resistance to tetracycline and doxycycline is common, necessitating the use of alternative antibiotics such as clindamycin, gentamycin, nitrofurantoin, and linezolid [33]. Our study’s findings align with a broader understanding, showing complete resistance to tetracycline and doxycycline but susceptibility to other tested antibiotics [33, 34]. Despite specific resistance mechanisms, S. saprophyticus remains susceptible to various antimicrobial agents, emphasizing the importance of appropriate antibiotic selection based on susceptibility patterns. Moreover, recent research elucidates S. saprophyticus’s antibiotic resistance further. Studies reveal multidrug resistance and genetic markers like the mecA gene associated with resistance to cefoxitin and oxacillin [35, 36]. Biofilm formation also contributes to resistance against several antibiotics [37, 38]. However, our study did not find resistance to erythromycin and clindamycin, contrasting previous findings, possibly due to variations in bacterial strains or experimental conditions.

The antimicrobial assessment of lactobacilli isolates against S. saprophyticus in UTIs is a critical area of research, especially in the context of increasing antibiotic resistance. Lactobacilli, a genus of gram-positive bacteria commonly found in the human microbiota, have been studied for their potential to inhibit the growth of uropathogens, including S. saprophyticus, which is responsible for a significant proportion of UTIs [5, 11]. Our findings contribute to this body of research by demonstrating that specific lactobacilli isolates from Bulgarian cheese and shallot yogurt exhibit antibacterial activity against S. saprophyticus. This activity is particularly notable in the inhibition of biofilm formation, a key factor in the persistence and recurrence of UTIs [5]. Biofilms are complex structures that bacteria like S. saprophyticus form on surfaces, such as the epithelial lining of the urinary tract, which protect them from antibiotics and the host immune response [5]. The lactobacilli isolates’ ability to produce organic acids, such as lactic acid, acetic acid, and formic acid, is believed to be one of the mechanisms behind their antimicrobial properties. These acids can lower the pH of the environment, making it inhospitable for the growth of pathogenic bacteria. Additionally, lactobacilli can compete with pathogens for adhesion sites on the host epithelium, further preventing infection [12]. In this regard, our study aligns with recent research that emphasizes the need for novel treatments against UTIs due to the rising rates of antibiotic resistance [39, 40]. The specificity of the probiotic strains’ activity against S. saprophyticus presents a compelling case for their use as an alternative to traditional antibiotics, which are becoming increasingly ineffective [11, 41]. The antimicrobial assessment in our study showed that the supernatants from lactobacilli strains M and B were effective in inhibiting the growth of S. saprophyticus, with the MIC determined to be at a 1/2 dilution. This suggests that substances secreted by these probiotic strains have the potential to be used as novel agents in the treatment of UTIs caused by S. saprophyticus [42].

Biofilms play a significant role in UTIs by providing a protective environment for bacteria, which can lead to persistent infections and complicate treatment. Biofilms are complex communities of bacteria that adhere to surfaces and are encased in a self-produced matrix of carbohydrates, proteins, fats, and DNA [43]. This matrix shields the bacteria from the immune system and antibiotics, making infections difficult to eradicate and often leading to recurrent UTIs [43]. In the context of our study, the L. rhamnosus strains M and B demonstrated the ability to inhibit the growth and biofilm production of S. saprophyticus. This is particularly relevant because biofilms contribute to the pathogenicity of UTIs and are associated with antibiotic resistance. By preventing biofilm formation, these probiotic strains could potentially reduce the incidence of recurrent UTIs and offer an alternative to traditional antibiotic treatments, which are less effective against biofilm-embedded bacteria [44]. Furthermore, probiotics themselves can form biofilms on host mucosal surfaces, which may competitively exclude pathogenic bacteria, preventing their colonization and subsequent infection [45]. This suggests that the introduction of beneficial probiotic bacteria could help in establishing a protective biofilm that outcompetes harmful pathogens, thereby reducing the risk of UTIs.

The pattern of antibiotic susceptibility and the presence of virulence factors in probiotics are critical considerations when evaluating their potential use in treating UTIs [46]. In our study, the probiotic strains M and B showed a broad spectrum of antibiotic susceptibility, being sensitive to most of the tested antibiotics, which is a desirable trait for probiotics used in a clinical setting [47]. This suggests that these strains can be safely administered alongside conventional antibiotics without the risk of contributing to antibiotic resistance [48]. Moreover, the absence of virulence factors in the probiotic strains M and B, as indicated by negative results for cell cytotoxicity, DNase, β-hemolysin, catalase, CAMP factor, and gelatinase, is significant. Probiotics intended for therapeutic use should not possess virulence factors that could potentially harm the host [49]. The lack of these factors in strains M and B supports their safety profile and suitability for use in managing UTIs [48]. The relationship between antibiotic susceptibility, virulence factors, and UTI treatment outcomes is complex. Uropathogens with multiple virulence factors are often more challenging to treat and may exhibit higher levels of antibiotic resistance [50]. Conversely, probiotics that are susceptible to antibiotics and lack virulence factors can be advantageous in UTI treatment. They can provide a competitive edge against uropathogens by occupying niches in the urinary tract, thereby preventing infection, and can be used in conjunction with antibiotics to enhance treatment efficacy [51, 52].

In conclusion, this study explored the potential of lactobacilli strains, particularly L. rhamnosus from Bulgarian cheese and shallot yogurt, as an alternative approach for the treatment of UTIs caused by S. saprophyticus. The findings demonstrate that these probiotic strains exhibit antibacterial activity against S. saprophyticus, including inhibiting biofilm formation, a crucial factor in UTI persistence and recurrence. Moreover, exploring the synergistic effects of combining these probiotics with antibiotics could open new therapeutic modalities. The development of functional foods or supplements containing these strains could also provide a practical means of preventing UTIs, contributing to the overall well-being of individuals at risk. The proposed mechanism involves organic acid production by lactobacilli, creating an inhospitable environment for S. saprophyticus. Furthermore, these probiotic strains displayed a broad spectrum of antibiotic susceptibility and lacked virulence factors, highlighting their safety for potential clinical applications. Future research should focus on clinical trials to validate the efficacy and safety of these probiotic strains in human subjects. Overall, this study provides valuable insights into the use of lactobacilli strains as a promising strategy for UTI prevention and treatment, particularly in the face of increasing antibiotic resistance in S. saprophyticus.

Funding

This research was supported by the Shahid Ashrafi Esfahani University.

Acknowledgments

This study was financially supported by a grant from the Shahid Ashrafi Esfahani University, Isfahan, Iran.

References

[1] G. Mancuso, A. Midiri, E. Gerace, M. Marra, S. Zummo, C. Biondo, "Urinary tract infections: the current scenario and future prospects," Pathogens., vol. 12 no. 4,DOI: 10.3390/pathogens12040623, 2023.

[2] B. Djawadi, N. Heidari, M. Mohseni, "UTI caused by Staphylococcus saprophyticus," Urinary Tract Infections-New Insights, 2023.

[3] M. Hasannejad-Bibalan, A. Mojtahedi, H. Biglari, M. Halaji, H. Sedigh Ebrahim-Saraie, "Antibacterial activity of tedizolid, a novel oxazolidinone against methicillin-resistant Staphylococcus aureus: a systematic review and meta-analysis," Microbial Drug Resistance, vol. 25 no. 9, pp. 1330-1337, DOI: 10.1089/mdr.2018.0457, 2019.

[4] M. Hashemzadeh, A. Dezfuli, R. Nashibi, F. Jahangirimehr, Z. Akbarian, "Study of biofilm formation, structure and antibiotic resistance in Staphylococcus saprophyticus strains causing urinary tract infection in women in Ahvaz, Iran," New Microbes and New Infections, vol. 39, article 100831,DOI: 10.1016/j.nmni.2020.100831, 2021.

[5] O. U. Lawal, M. J. Fraqueza, O. Bouchami, P. Worning, M. D. Bartels, M. L. Gonçalves, P. Paixão, E. Gonçalves, C. Toscano, J. Empel, M. Urbaś, M. A. Domínguez, H. Westh, H. de Lencastre, M. Miragaia, "Foodborne origin and local and global spread of Staphylococcus saprophyticus causing human urinary tract infections," Emerging Infectious Diseases, vol. 27 no. 3, pp. 880-893, DOI: 10.3201/eid2703.200852, 2021.

[6] W. Yang, Z. Wang, Q. Li, Y. Jia, S. Song, Z. Ma, J. Liu, J. Wang, "Photodynamic inactivation using natural bioactive compound prevents and disrupts the biofilm produced by Staphylococcus saprophyticus," Molecules, vol. 26 no. 16,DOI: 10.3390/molecules26164713, 2021.

[7] K. C. S. Silva, L. O. H. S. Silva, G. A. A. Silva, C. L. Borges, E. Novaes, J. D. Paccez, W. Fontes, M. Giambiagi-deMarval, C. M. A. Soares, J. A. Parente-Rocha, "Staphylococcus saprophyticus proteomic analyses elucidate differences in the protein repertories among clinical strains related to virulence and persistence," Pathogens, vol. 9 no. 1,DOI: 10.3390/pathogens9010069, 2020.

[8] C. Kelmis, K. Stephan, A. Varadhan, J. B. Brown, C. Preuss, "Recent developments in the treatment of bacterial urinary tract infections," Infectious diseases drug delivery systems, pp. 383-406, 2023.

[9] M. Mohkam, N. Nezafat, A. Berenjian, M. Zamani, F. Dabbagh, R. Bigharaz, Y. Ghasemi, A. Berenjian, "Multifaceted toxin profile of Bacillus probiotic in newly isolated Bacillus spp. from soil rhizosphere," Biologia, vol. 75 no. 2, pp. 309-315, DOI: 10.2478/s11756-019-00357-1, 2020.

[10] C.-C. Tsai, T.-M. Lai, P.-P. Lin, Y.-M. Hsieh, "Evaluation of lactic acid bacteria isolated from fermented plant products for antagonistic activity against urinary tract pathogen Staphylococcus saprophyticus," Probiotics and Antimicrobial Proteins, vol. 10 no. 2, pp. 210-217, DOI: 10.1007/s12602-017-9302-x, 2018.

[11] T. A. Bamidele, F. O. Alao, V. C. Ekeh, M. A. Fowora, B. A. Adeniyi, "Inhibitory Activities of Lactic Acid Bacteria against Multi-Drug Resistant Uropathogenic Staphylococcus saprophyticus Isolated from Symptomatic Women in Lagos, Nigeria," Advances in Microbiology, vol. 10 no. 8, pp. 375-382, DOI: 10.4236/aim.2020.108027, 2020.

[12] J. Plaza-Diaz, F. J. Ruiz-Ojeda, M. Gil-Campos, A. Gil, "Mechanisms of action of probiotics," Advances in Nutrition, vol. 10, pp. S49-S66, DOI: 10.1093/advances/nmy063, 2019.

[13] M. García-Burgos, J. Moreno-Fernández, M. J. Alférez, J. Díaz-Castro, I. López-Aliaga, "New perspectives in fermented dairy products and their health relevance," Journal of Functional Foods, vol. 72, article 104059,DOI: 10.1016/j.jff.2020.104059, 2020.

[14] B. Covaci, M. Covaci, "Mountain food as a natural probiotic: evidence from central and eastern European nutrition and behaviour," International Food Research Journal, vol. 30 no. 1, pp. 263-280, DOI: 10.47836/ifrj.30.1.22, 2023.

[15] N. Hasaniani, M. Ghasemi-Kasman, M. Halaji, S. Rostami-Mansoor, "Bifidobacterium breve probiotic compared to Lactobacillus casei causes a better reduction in demyelination and oxidative stress in cuprizone-induced demyelination model of rat," Molecular Neurobiology, vol. 61 no. 1, pp. 498-509, DOI: 10.1007/s12035-023-03593-4, 2024.

[16] P. Petrova, I. Ivanov, L. Tsigoriyna, N. Valcheva, E. Vasileva, T. Parvanova-Mancheva, A. Arsov, K. Petrov, "Traditional Bulgarian dairy products: ethnic foods with health benefits," Microorganisms, vol. 9 no. 3,DOI: 10.3390/microorganisms9030480, 2021.

[17] R. D. Ayivi, S. A. Ibrahim, "Lactic acid bacteria: an essential probiotic and starter culture for the production of yoghurt," International Journal of Food Science & Technology, vol. 57 no. 11, pp. 7008-7025, DOI: 10.1111/ijfs.16076, 2022.

[18] F. Vahdat, T. Mehdizadeh, H. Kazemeini, A. Reale, A. Kaboudari, "Physicochemical, microbial, and sensory characteristics of yogurt with Persian shallot ( Allium hirtifolium Boiss) and probiotic bacteria," Food Science & Nutrition, vol. 12 no. 5, pp. 3653-3662, DOI: 10.1002/fsn3.4036, 2024.

[19] M. Farahbakhsh, L. Roufegarinejad, "A survey on physicochemical and antioxidative properties of shallot probiotic yoghurt containing inulin," Journal of Food Research, vol. 31 no. 1, pp. 129-141, 2021.

[20] M. Mohkam, S. Rasoul-Amini, D. Shokri, A. Berenjian, F. Rahimi, M. Sadraeian, B. Khalvati, A. Gholami, Y. Ghasemi, "Characterization and in vitro probiotic assessment of potential indigenous Bacillus strains isolated from soil rhizosphere," Minerva Biotecnologica, vol. 28 no. 1, pp. 19-28, 2016.

[21] M. P. Weinstein, J. S. Lewis, "The Clinical and Laboratory Standards Institute subcommittee on antimicrobial susceptibility testing: background, organization, functions, and processes," Journal of Clinical Microbiology, vol. 58 no. 3,DOI: 10.1128/JCM.01864-19, 2020.

[22] A. Ghiaei, S. M. Ghasemi, D. Shokri, "Investigating the antagonistic effect of indigenous probiotics on carbapenem-resistant Pseudomonas aeruginosa strains," BioMed Research International, vol. 2023 no. 1,DOI: 10.1155/2023/6645657, 2023.

[23] S. Jafari, M. A. Mobasher, S. Najafipour, Y. Ghasemi, M. Mohkam, M. A. Ebrahimi, N. Mobasher, "Antibacterial potential of Chlorella vulgaris and Dunaliella salina extracts against Streptococcus mutans," Jundishapur Journal of Natural Pharmaceutical Products, vol. 13 no. 2, article e13226,DOI: 10.5812/jjnpp.13226, 2018.

[24] L. H. Duc, H. A. Hong, T. M. Barbosa, A. O. Henriques, S. M. Cutting, "Characterization of Bacillus probiotics available for human use," Applied and Environmental Microbiology, vol. 70 no. 4, pp. 2161-2171, DOI: 10.1128/AEM.70.4.2161-2171.2004, 2004.

[25] B. S. Fazly Bazzaz, S. Darvishi Fork, R. Ahmadi, B. Khameneh, "Deep insights into urinary tract infections and effective natural remedies," African Journal of Urology, vol. 27 no. 1,DOI: 10.1186/s12301-020-00111-z, 2021.

[26] S. Nasrollahian, J. P. Graham, M. Halaji, "A review of the mechanisms that confer antibiotic resistance in pathotypes of E. coli," Frontiers in Cellular and Infection Microbiology, vol. 14,DOI: 10.3389/fcimb.2024.1387497, 2024.

[27] S. Yang, G. Reid, J. R. Challis, G. B. Gloor, E. Asztalos, D. Money, S. Seney, A. D. Bocking, "Effect of oral probiotic Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri RC-14 on the vaginal microbiota, cytokines and chemokines in pregnant women," Nutrients, vol. 12 no. 2,DOI: 10.3390/nu12020368, 2020.

[28] M. I. Petrova, G. Reid, J. A. Ter Haar, "Lacticaseibacillus rhamnosus GR-1, a.k.a. Lactobacillus rhamnosus GR-1: past and future perspectives," Trends in Microbiology, vol. 29 no. 8, pp. 747-761, DOI: 10.1016/j.tim.2021.03.010, 2021.

[29] N. Recine, E. Palma, L. Domenici, M. Giorgini, L. Imperiale, C. Sassu, A. Musella, C. Marchetti, L. Muzii, P. Benedetti Panici, "Restoring vaginal microbiota: biological control of bacterial vaginosis. A prospective case–control study using Lactobacillus rhamnosus BMX 54 as adjuvant treatment against bacterial vaginosis," Archives of Gynecology and Obstetrics, vol. 293 no. 1, pp. 101-107, DOI: 10.1007/s00404-015-3810-2, 2016.

[30] D. Hill, I. Sugrue, C. Tobin, C. Hill, C. Stanton, R. P. Ross, "The Lactobacillus casei group: history and health related applications," Frontiers in Microbiology, vol. 9,DOI: 10.3389/fmicb.2018.02107, 2018.

[31] M. S. Shams-Abadi, M. Halaji, S. Hoseini-Alfatemi, A. Gholipour, A. Mojtahedi, H. S. Ebrahim-Saraie, "Epidemiology of toxic shock syndrome toxin-1 harboring Staphylococcus aureus obtained from clinical samples in Iran: a systematic review and meta-analysis," Annali di Igiene, vol. 30, pp. 391-400, 2018.

[32] J. Hur, A. Lee, J. Hong, W. Y. Jo, O. H. Cho, S. Kim, I. G. Bae, "Staphylococcus saprophyticus bacteremia originating from urinary tract infections: a case report and literature review," Infection & Chemotherapy, vol. 48 no. 2, pp. 136-139, DOI: 10.3947/ic.2016.48.2.136, 2016.

[33] L. Chen, J.-X. Hu, C. Liu, J. Liu, Z. B. Ma, Z. Y. Tang, Y. F. Li, Z. L. Zeng, "Identification of the multiresistance gene poxtA in oxazolidinone-susceptible Staphylococcus haemolyticus and Staphylococcus saprophyticus of pig and feed origins," Pathogens, vol. 10 no. 5,DOI: 10.3390/pathogens10050601, 2021.

[34] K. Zhang, R. F. Potter, J. Marino, C. E. Muenks, M. G. Lammers, J. Dien Bard, T. C. Dingle, R. Humphries, L. F. Westblade, C. A. D. Burnham, G. Dantas, "Comparative genomics reveals the correlations of stress response genes and bacteriophages in developing antibiotic resistance of Staphylococcus saprophyticus," Msystems, vol. 8 no. 6, article e00697,DOI: 10.1128/msystems.00697-23, 2023.

[35] N. Pedretti, R. Iseppi, C. Condò, S. Ghazanfar, P. Messi, A. di Cerbo, C. Sabia, "Characterization of virulence factors and antimicrobial resistance in Staphylococcus spp. isolated from clinical samples," Folia Microbiologica, vol. 69 no. 5, pp. 1043-1052, DOI: 10.1007/s12223-024-01148-1, 2024.

[36] M. A. Abdelwahab, W. H. Amer, D. Elsharawy, R. M. Elkolaly, R. A. E. F. Helal, D. A. el Malla, Y. G. Elfeky, H. A. Bedair, R. S. Amer, M. E. Abd-Elmonsef, M. S. Taha, "Phenotypic and genotypic characterization of methicillin resistance in Staphylococci isolated from an Egyptian University Hospital," Pathogens, vol. 12 no. 4,DOI: 10.3390/pathogens12040556, 2023.

[37] M. Rafiee, E. A. Ghaemi, "Detection of virulence genes among Staphylococcus saprophyticus isolated from women with urinary tract infections: first report from Iran," BMC Research Notes, vol. 16 no. 1,DOI: 10.1186/s13104-023-06481-1, 2023.

[38] S. Moshtagheian, M. Halaji, H. Sedaghat, M. Shahin, S. Havaei, S. Havaei, "Molecular characteristics of methicillin-resistant Staphylococcus aureus nasal carriage from hospitalized patients and medical staff in Isfahan, Iran," Ann Ig, vol. 30 no. 3, pp. 237-244, DOI: 10.7416/ai.2018.2215, 2018.

[39] E. M. Kurniawati, G. Hardianto, T. H. Hadi, H. Paraton, A. Widyasari, N. A. Rahmawati, "The role of probiotics in urinary tract infections in women," Indonesian Journal of Obstetrics and Gynecology, vol. 18, pp. 189-197, DOI: 10.32771/inajog.v11i3.1881, 2023.

[40] P. Malfa, L. Brambilla, S. Giardina, M. Masciarelli, D. F. Squarzanti, F. Carlomagno, M. Meloni, "Evaluation of antimicrobial, antiadhesive and co-aggregation activity of a multi-strain probiotic composition against different urogenital pathogens," International Journal of Molecular Sciences, vol. 24 no. 2,DOI: 10.3390/ijms24021323, 2023.

[41] V. A. Abdullatif, R. L. Sur, E. Eshaghian, K. A. Gaura, B. Goldman, P. K. Panchatsharam, N. J. Williams, J. E. Abbott, "Efficacy of probiotics as prophylaxis for urinary tract infections in premenopausal women: a systematic review and meta-analysis," Cureus, vol. 13,DOI: 10.7759/cureus.18843, 2021.

[42] W. F. B. Pessoa, A. C. C. Melgaço, M. E. Almeida, T. F. Santos, C. C. Romano, "Probiotics for urinary tract disease prevention and treatment," Probiotics for human nutrition in health and disease, pp. 513-536, 2022.

[43] J. Agarwal, S. Radera, "Biofilm-mediated urinary tract infections," Biofilms in human diseases: Treatment and control, .

[44] N. Allam, "Correlation between biofilm production and bacterial urinary tract infections: new therapeutic approach," Egyptian Journal of Microbiology, vol. 52 no. 1, pp. 39-48, DOI: 10.21608/ejm.2017.1014.1021, 2017.

[45] C. Chapman, G. Gibson, I. Rowland, "Effects of single-and multi-strain probiotics on biofilm formation and in vitro adhesion to bladder cells by urinary tract pathogens," Anaerobe, vol. 27, pp. 71-76, DOI: 10.1016/j.anaerobe.2014.02.001, 2014.

[46] T. Li, D. Teng, R. Mao, Y. Hao, X. Wang, J. Wang, "A critical review of antibiotic resistance in probiotic bacteria," Food Research International, vol. 136, article 109571,DOI: 10.1016/j.foodres.2020.109571, 2020.

[47] A. Wong, D. Y. S. Ngu, L. A. Dan, A. Ooi, R. L. H. Lim, "Detection of antibiotic resistance in probiotics of dietary supplements," Nutrition Journal, vol. 14 no. 1,DOI: 10.1186/s12937-015-0084-2, 2015.

[48] E. Anisimova, I. Gorokhova, G. Karimullina, D. Yarullina, "Alarming antibiotic resistance of lactobacilli isolated from probiotic preparations and dietary supplements," Antibiotics, vol. 11 no. 11,DOI: 10.3390/antibiotics11111557, 2022.

[49] M. S. El Far, A. S. Zakaria, M. A. Kassem, A. Wedn, M. Guimei, E. A. Edward, "Promising biotherapeutic prospects of different probiotics and their derived postbiotic metabolites: in-vitro and histopathological investigation," BMC Microbiology, vol. 23 no. 1,DOI: 10.1186/s12866-023-02866-1, 2023.

[50] K. O’Rourke, P. A. Cadieux, "Pathogenic mechanisms of uropathogens," The role of Bacteria in Urology, pp. 23-39, 2019.

[51] I. C. Imperial, J. A. Ibana, "Addressing the antibiotic resistance problem with probiotics: reducing the risk of its double-edged sword effect," Frontiers in Microbiology, vol. 7, article 232849,DOI: 10.3389/fmicb.2016.01983, 2016.

[52] A. C. Ouwehand, S. Forssten, A. A. Hibberd, A. Lyra, B. Stahl, "Probiotic approach to prevent antibiotic resistance," Annals of Medicine, vol. 48 no. 4, pp. 246-255, DOI: 10.3109/07853890.2016.1161232, 2016.