INTRODUCTION
Alzheimer's disease (AD) is the leading cause of dementia, affecting approximately one of every ten individuals older than 65 years of age. Pathologically, AD is characterized by the extracellular deposition of amyloid β (Aβ) peptides and the intracellular accumulation of hyperphosphorylated tau protein. These protein form senile plaques and neurofibrillary tangles, respectively, leading to widespread cortical atrophy.
Newborn neural stem cells (NSCs)/progenitor cells are consistently found in the subventricular zone (SVZ) and the subgranular zone (SGZ) of the dentate gyrus (DG) in the brains of adult mammals.1 These cells are capable of migrating to other brain regions to repair injured neurons and may also contribute to memory reconstruction. This process, known as adult neurogenesis, offers promising avenues for the treatment of Alzheimer's disease. Although some studies have challenged the occurrence of neurogenesis in adults, the majority of research has affirmed its presence across multiple species, utilizing methods such as sequencing and tissue staining.2–4 Environmental damage to NSCs can lead to compromised neurogenesis, potentially resulting in brain atrophy. Thus, understanding the microenvironment's influence on the fate of adult NSCs is essential.
Recent focus has been placed on oxidative stress in the pathogenesis of AD.5 Autophagy, a highly regulated process that responds adaptively to oxidative stress, degrades cytoplasmic macromolecules and damaged organelles within lysosomes, supporting cellular growth, development, and homeostasis. Autophagic can be induced by cellular stress from nutrient deprivation, energy deficits, hypoxia, toxins, radiation, DNA damage, and intracellular pathogens, making it a potential target for research aimed at halting the progression of neurodegenerative disorders like AD.
Curcumin, a principal component of turmeric, has garnered significant attention for its antioxidative, anticarcinogenic, antitumor, and anti-inflammatory properties.6,7 An expanding body of evidence suggests that curcumin may exert antioxidative and neuroprotective effects, potentially slowing the progression of neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease.8 As reviewed by Shameemah, 17 studies have highlighted the protective effect of curcumin on various cellular models of neurodegenerative disorders.9 Curcumin has been noted to enhance the proliferation of neural progenitor cells by reducing histone H3 and H4 acetylation,10 and to stimulate hippocampal neurogenesis through the activation of ERK and p38 kinase pathways.11 However, it remains unclear whether the impact of curcumin on NSCs is linked to oxidative stress. In this study, we examine the effect of curcumin on H2O2-induced oxidative stress in neural stem cells in vitro to assess its potential application in the treatment of AD.
MATERIALS AND METHODS
Experimental strains and reagents
C17.2 neural stem cells (NSCs) were preserved in the laboratory of the Sun Yat-sen Memorial Hospital, Sun Yat-sen University. Dulbecco's modified Eagle medium: Nutrient Mixture F-12 (DMEM/F-12) media, fetal bovine serum (FBS), and trypsin EDTA digestion solution, and PBS buffer were purchased from Gibco (New York, USA). The Penicillin–Streptomycin solution was provided by Hyclone (Utah, USA). RIPA lysis buffer, protease inhibitor cocktail, and phosphatase inhibitor cocktail were obtained from Cwbio (Jiangsu, China). The Cell Counting Kit-8 assay (CCK-8) for examining cytotoxicity of C17.2 NSCs after different intervention was purchased from APExBIO (Houston, USA). Hydrogen peroxide solution (H2O2) was obtained from Merck (New York, USA). The Oxidation-sensitive fluorescent probe-Dihydroethidium (DHE) was purchased from KeyGEN BioTECH (Nanjing, China). The mRFP-GFP-LC3 plasmid for detecting autophagic was obtained from Hanbio Biotechnology Co., Ltd. (Shanghai, China). Finally, the primary antibody for microtubule-associated protein light chain 3 (LC3) (CST3868), phospho-p44/42 MAPK (ERK1/2) (CST4370), p44/42 MAPK (ERK1/2) (CST4695), and the secondary antibodies HRP Goat anti-mouse IgG (CST7076) and the HRP Goat anti-rabbit IgG (CST7074) were provided by Cell Signaling Technology (Massachusetts, USA). Meanwhile, the antibodies GAPDH (ab181602) and Beclin-1 (ABclonalA7353) were purchased from Abcam (Cambridge, UK) and ABclonal Technology Co., Ltd. (Wuhan, China), respectively. SOD and MDA kits were obtained from Jiancheng Bioengineering Institute (Nanjing, China). Total RNA extraction reagents and primeScript™ Master Mix were both purchased from Takara (Tokyo, Japan). Both rapamycin and 3-methyladenine (3-MA) were purchased from Selleck (Huston, USA).
Cell culture
The C17.2 neural stem cells were cultured in DMEM/F12 media supplemented with 10% FBS and 1% penicillin–Streptomycin solution at 37°C in a humidified atmosphere containing 5% CO2, as previously reported.12 The cells were passaged when they reached an 80% confluency.
Cell viability assay
Cell viability was assessed using the CCK-8 assay. Briefly, cells were seeded in 96-well plates with 104 cells per well and incubated for 24 h. They were than treated with various concentrations of curcumin (5, 10, 15, 20 μM) and H2O2 (400, 600, 800, 1000 μM), followed by incubation at predetermined time points (6, 12, 24, 48 h). The medium was then replaced with 10 μL of CCK-8 reagent and 100 μL of DMEM, followed by a further incubation for 2 h at 37°C and 5% CO2 in the dark. The absorbance of each sample was measured using a multifunctional microplate reader (SpectraMax M5, Sunnyvale, CA, USA) at 450 nm. The cell viability was calculated using the formula Cell viability (%).
Determination of
The levels of superoxide dismutase (SOD) and malondialdehyde (MDA) were measured using a commercial ELISA kit. Cells were seeded in a 6-well plate and were pretreated with curcumin for 24 h upon reaching 70% confluence, followed by H2O2 incubation for 6, 12, 24, 48 h. The cell culture supernatant was collected, and the content of SOD and MDA was detected according to the manufacturer's instructions.
Intracellular
Intracellular ROS levels were measured by DHE. Briefly, C17.2 cells were pretreated with curcumin for 24 h and then exposed to 600 μM H2O2 for 6 h. Afterwards, the supernatant was discarded, the cells were washed twice with PBS, and incubated with 3 μM DHE for 20 min at 37°C in the dark. The cells were collected for flow cytometry experiment (FACSCalibur, BD, USA). Both the geometric mean fluorescence intensity of positive cells and the percentage of positive C17.2 cells were analyzed. Additionally, the DHE fluorescence intensity was observed under a fluorescence microscopy (BX63, Olympus, Japan).
RNA was extracted from C17.2 cells using Trizol reagent and then converted to cDNA with primeScript™ Master Mix. Quantitative RT-PCR was conducted on a Roche LightCycler®96 PCR instrument (Roche, Basel, Switzerland), following the PCR protocols. The total volume of the reaction system was 10 μL, comprising 1 μL cDNA, 3 μL diethyl pyrocarbonate-treated water, and 1 μL primer. The specific primer sequences are listed as follows: SOD1 (F: AACCAGTTGTGTTGTCAGGAC; R: CCACCATGTTTCTTAGAGTGAGG); SOD2 (F: CAGACCTGCCTTACGACTATGG; R: CTCGGTGGCGTTGAGATTGTT); GAPDH (F: TGGATTTGGACGCATTGGTC; R: TTTGCACTGGTACGTGTTGAT). The relative mRNA expression of SOD1 and SOD2 was calculated by 2−△△Ct.
C17.2 cells were transfected with mRFP-GFP-LC3 plasmid according to the manufacturer's protocol. Briefly, after 6 h of transfection, the medium was refreshed. After 24 h transfer, the plasmid contained within the cells was relatively stable. Cells treated with H2O2 or in combination with curcumin were then fixed for 15 min with 4% paraformaldehyde, washed three times with PBS, and counterstained with DAPI for 5 min to locate the nuclei. The cells were then covered with cover slips. Images of the cells were obtained using a 40× oil immersion objective mounted on confocal microscopy (Lsm710, Zeiss, German).
Transmission electron microscopy (
C17.2 cells were fixed for 1 h with Karnovsky- fixative, followed by fixation with a 1% OsO4 solution. The monolayer of cells was rinsed in an ascending series of acetone concentrations (50%, 70%, 90%, 100%) for dehydration. After selected the ultrathin sections, they were counterstained with 2% uranyl acetate/lead citrate. The TEM images were obtained through a transmission electron microscope (Tecnai G2 SpiritTwin + GATAN 832.10 W, FEI, USA).
Western blot analysis
C17.2 cells were cultured in a 6-well plate, pretreated with curcumin for 24 h, and then treated with H2O2 for 6 h. Subsequently, cells were lysed in radioimmunoprecipitation assay buffer mixed with protease inhibitor on ice for 30 min; afterwards, the solution was centrifuged at 12,000 rpm and 4°C for 10 min. The protein concentration was measured through bicinchoninic acid (BCA) protein assay kit. Equal amounts of protein were subjected to SDS–PAGE gels and transferred to polyvinylidene fluoride (PVDF) membranes. After blocking with 5% bovine serum albumin (BSA) for 1 h, the membranes were incubated with primary antibodies LC3, Beclin-1 and GAPDH overnight at 4°C. The membrane was washed with TBST, followed by incubation with a secondary antibody for 1 h. The imprint of the membranes was detected with the aid of ECL chemiluminescence by a Digital Imaging System (Gel Logic 2200pro, Kodak, USA).
Statistical analysis
All quantitative data are presented as mean ± SD. One-way ANOVA statistical analysis with Bonferroni test was used for multiple group comparisons, whereas unpaired Student's t test was used for two-groups comparisons, using SPSS 13.0 software (SPSS Inc. USA). The column charts were constructed using Graphpad Prism 6.0 (Graphpad Prism 6.0 Software Inc., USA). All results were considered statistically significant at p < 0.05. All experiments were performed three times.
RESULTS
Viability of
The viability of C17.2 cells treated with varying concentrations of curcumin and H2O2 for specific time periods was assessed using CCK-8 kits. As depicted in Figure 1, curcumin exhibited no significant cytotoxic effect at the concentration up to 20 μM after a 24-h incubation period. In comparison to the cells treated with 10 μM curcumin, it demonstrated a neuroprotective effect after 6 h of incubation. These findings suggest that pre-treating cells with 10 μM curcumin for 24 h is sufficient to protect against H2O2-induced cell injury.
[IMAGE OMITTED. SEE PDF]
Curcumin suppresses
SOD serves as an endogenous antioxidant, whereas MDA is a byproduct of ROS. We assessed the levels of SOD and MDA using ELISA kits to gauge the oxidative balance within cells (Figure 2a,b). The SOD levels in the H2O2-treated group were significantly lower than those in the control group, whereas pre-treatment with curcumin elevated the SOD levels. Additionally, the expression of MDA was markedly increased in cells treated with H2O2 but decreased following curcumin administration. Furthermore, we investigated the gene expression levels of SOD1 and SOD2. In alignment with the ELISA outcomes, the expressions of SOD1 and SOD2 were significantly reduced post-H2O2 treatment compared to the control group, whereas curcumin pre-treatment restored their expressions over various time periods (Figure 2c,d).
[IMAGE OMITTED. SEE PDF]
Curcumin alleviates autophagy enhanced by
Autophagy typically serves as an adaptive response to cellular malfunction and cell death, regulated by multiple mechanisms. Both excessive and insufficient activation of autophagy can lead to cell death. The assessment of autophagy was conducted by measuring the levels of LC3, a protein present in all autophagic membranes.13 The relative expression of LC3-II and Beclin-1 is indicative of the degree of autophagy activation.14 As demonstrated in Figure 3a–c, cells treated with H2O2 showed a marked increase in the relative expression of LC3-II and Beclin-1 compared to the control group, whereas pre-treatment with curcumin significantly reduced the expression of these proteins. Furthermore, we utilized a tandem fluorescent mRFP-GFP-LC315 assay to assess autophagic. Specifically, LC3 puncta labeled with both GFP and mRFP denote autophagosomes, whereas those labeled only with mRFP indicate autolysosomes.16 In comparison to the control group (Figure 3d), autophagosome and autolysosome formation was diminished following H2O2 intervention. Consistent with the western blot results, curcumin pre-treatment suppressed autophagosome formation and mitigated dysregulated autophagic flux. Additionally, transmission electron microscopy (TEM) results (Figure 3e) confirmed that autophagosome formation increased after H2O2 treatment but decreased with curcumin administration. These findings suggest that curcumin modulates aberrant autophagic activity.
[IMAGE OMITTED. SEE PDF]
Curcumin inhibits
To determine whether curcumin inhibits ROS through autophagy in C17.2 cells, we utilized the autophagy inhibitor 3-MA and the autophagy enhancer rapamycin in our study. As illustrated in Figure 4a–h, both the proportion of DHE positive cells and the median intensity of DHE fluorescence were significantly elevated following H2O2 treatment (Figure 4b, 4k), whereas pre-treatment with curcumin ameliorated these effects to a certain degree (Figure 4c, 4i). Additionally, pre-treatment with 10 μM rapamycin 2 h prior to H2O2 exposure further augmented the ROS levels (Figure 4d, 4m). Conversely, the addition of 10 nM 3-MA 2 h before the combined treatment with curcumin and H2O2 enhanced the protective effects of curcumin (Figure 4f, 4o). Furthermore, the substantial ROS levels induced by H2O2 and rapamycin were partially mitigated following curcumin treatment. The fluorescence microscopy observations of DHE in C17.2 cells agreed with the findings from flow cytometry (Figure 4j–o).
[IMAGE OMITTED. SEE PDF]
Inactivation of
The mitogen-activated protein kinase (MAPK)/ERK1/2 pathway is known to be crucial in regulating cell fate.17 Within this pathway, extracellular signal-regulated kinase (ERK) is responsive to ROS. However, the precise relationship between ROS and ERK activation is not fully understood.18 To investigate whether curcumin can modulate the expression of ERK1/2, we analyzed cells treated with curcumin, both with and without the addition of U0126—a specific inhibitor of MEK1/2—for 30 or 60 min. As depicted in Figure 5a,b, the relative expression of phosphorylated ERK (p-ERK) declined following curcumin treatment and decreased further when combined with U0126. The disparity in p-ERK expression between cells treated solely with curcumin and those treated with the combination of curcumin and U0126 was statistically significant.
[IMAGE OMITTED. SEE PDF]
To ascertain whether curcumin's protective effect against ROS in C17.2 stem cells is linked to the activation of ERK1/2, cells were incubated with 10 μM U0126, curcumin, H2O2, or pre-incubated with curcumin for 24 h followed by stimulation with H2O2, with or without U0126, for the indicated durations. As shown in Figure 5c,d, in contrast to the control group, curcumin reduced the phosphorylation of ERK1/2, and the application of U0126 significantly suppressed ERK phosphorylation (p < 0.001). Meanwhile, stimulation with H2O2 markedly increased ERK phosphorylation (p < 0.001). Pre-treatment with curcumin, both with and without U0126, decreased the phosphorylation of ERK (p < 0.001) compared to the group treated only with H2O2.
Curcumin decrease autophagy via
The observed results prompted us to investigate whether curcumin could protect cells from ROS and if this protection was associated with the interplay between autophagy and the phosphorylation of ERK. We pre-treated C17.2 stem cells with curcumin, both alone and in combination with U0126, prior to H2O2 exposure. The subsequent reduction in the relative expression of LC3-II and Beclin-1 (p < 0.001) indicated that the harmful pathway activated by H2O2 could be modulated by curcumin. This modulation appears to occur through a decrease in autophagy, facilitated by the inactivation of the ERK1/2 signaling pathway (Figure 6a–c).
[IMAGE OMITTED. SEE PDF]
DISCUSSION
Curcumin plays a multifaceted role in NSCs, encompassing the suppression of inflammation, enhancement of proliferation and neurogenesis, and preventing apoptosis. Distinct from traditional neuroprotective agents, curcumin demonstrates poten anti-inflammatory and antioxidant activities, crucial for attenuating the pathophysiological processes inherent in neurodegenerative disorders.19 Its therapeutic efficacy is ascribed to its capacity to modulate a spectrum of molecular targets, notably reducing oxidative stress, inhibition pro-inflammatory cytokines, and chelating metal ions.20 Nonetheless, the correlation between curcumin's protective in NSCs and oxidative stress remains to be elucidated. The present study indicated that curcumin treatment may alleviate oxidative stress in NSCs through modulation of the ERK1/2 Signaling Pathways.
The established safety profile of curcumin is reinforced by the findings of the current study.21 Utilizing the CCK-8 assay, this research analyzed curcumin's impact on NSCs survival in vitro. The results showed that curcumin, at concentrations as high as 20 μM, did not exert any significant cytotoxic effects following a 24 h incubation period. Notably, a 24 h pretreatment of cells with 10 μM curcumin period is effective in safeguarding against H2O2-induced cellular damage (Figure 1). These observations suggest that curcumin, when administered at appropriate concentrations, does not compromise cell viability and may possess neuroprotective properties.
Oxidative stress, induced by ROS, is implicated in the etiology of aging, cancer, and a spectrum of neurodegenerative disorders. The expression levels of MDA and SOD serve as quantifiable indicators of oxidative damage. Our study revealed that curcumin could mitigate H2O2-induced oxidative stress, as evidenced by a reduction in MDA levels. Additionally, curcumin treatment led to a significant restoration of the endogenous antioxidant enzyme SOD (Figures 2 and 4). These results are in line with those of prior research,22 which corroborates the cytoprotective role of curcumin through the attenuation of oxidative damage. It is noteworthy, however, that curcumin's protective efficacy is not uniform across various cell types; this is exemplified by its diminished effectiveness in oligodendrocytes and macrophages subjected to H2O2 stimulation.23
The research delineated by Ren et al. elucidates that curcumin impedes the inflammatory signaling-mediated elevation of Keap1, thereby initiating the Nrf2 pathway, which in turn activates antioxidative enzymes, contributing to its antioxidant effects.24 Another study using model PC12 cells showed that the mitogen-activated protein kinases (MAPK) and serine/threonine protein kinase (Akt) pathways may be important in curcumin's antioxidant effect.25 The involvement of these mechanisms in neural stem cells (NSCs), however, remains speculative. Our hypothesis posits that the protective effects of curcumin against ROS in NSCs are associated with the deactivation of ERK1/2. Exposure to H2O2 markedly augmented the expression of p-ERK, indicating that H2O2 induces oxidative stress via the upregulation of p-ERK. Contrastingly, pre-treatment with curcumin substantially inhibited the phosphorylation of ERK. To emulate the inactivation of the ERK1/2 signaling pathways, U0126 was utilized, which selectively inhibits MEK1/2, thus impeding the phosphorylation and activation of ERK1/2. In the current study, curcumin attenuated the expression of p-ERK, with the reduction being pronounced when used in conjunction with U0126.
Emerging studies have posited that modulating selective autophagy may offer a novel therapeutic approach for neurodegenerative diseases.26 Conversely, evidence suggests that autophagy could induce cell death through the inhibition of the TOR signaling pathway.27 These results underscore autophagy's dualistic nature in cellular fate. Our study demonstrated that curcumin decreased the expression of autophagy markers produced by rapamycin or H2O2. These findings intimate that the inhibition of autophagy may underlie the neuroprotective mechanism afforded by curcumin in NSCs.
Prior research indicates that lactate can activate the ERK1/2/mTOR/p70S6K signaling pathway, thereby promoting autophagy in skeletal muscle.28 Curcumin has been documented to inhibit both autophagy29 and the ERK1/2 signaling pathway.30 Therefore, we hypothesized that the inhibition of autophagy after curcumin treatment is related to the inactivation of the ERK1/2 signaling pathways. The current study demonstrates that curcumin pretreatment, either alone or in combination with U0126, reduces the expression levels of LC3-II and beclin-1. These findings suggest a pivotal role for the ERK1/2 signaling pathways in the activation of autophagy induced by oxidative stress, positing that the inactivation of these pathways may suppress autophagy.
Autophagy serves as a mechanism of cytoprotection, facilitating the phagocytosis and degradation of oxidizing agents to preserve cellular homeostasis.31 Prior research has demonstrated that caffeine mitigates oxidative stress by activating A2AR/SIRT3/AMPK-mediated autophagy.32 Conversely, according to another study, melatonin has been shown to protect mouse granulosa cells from oxidative damage by inhibiting FOXO1-mediated autophagy.33 This suggests that the regulatory mechanisms of autophagy in response to different therapeutic agents may vary, depending on the specific mediators involved in drug-induced autophagy. In line with our hypothesis regarding curcumin's antioxidant role being linked to autophagy inhibition, our study observed that the autophagy enhancer rapamycin exacerbated oxidative stress induced by H2O2. Furthermore, the autophagy inhibitor 3-MA appeared to augment curcumin's antioxidant effect. Therefore, we assumed that curcumin confers protection to NSCs by diminishing oxidative stress through the suppression of autophagy.
The accumulation of data has substantiated the efficacy of curcumin in ameliorating neurodegenerative diseases. For instance, curcumin has been identified as potentially therapeutic for Alzheimer's disease, attributed to its capacity to reduce amyloid-β protein levels.34 Moreover, oxidative stress, which induces DNA and RNA damage, is implicated in the pathogenesis of neurodegenerative diseases.35 Despite these advances, the precise molecular mechanisms underlying curcumin's effects on NSCs associated with oxidative stress remains largely undetermined.
In this study, we explored the antioxidative mechanism of curcumin on NSCs, revealing that curcumin can mitigate oxidative stress by regulating autophagy and impeding the phosphorylation of the ERK pathway, thereby highlighting a prospective therapeutic avenue for Alzheimer's disease management. Nonetheless, the clinical application of curcumin is encumbered by its low bioavailability, necessitating innovative strategies to enhance its systemic absorption and therapeutic index.36 Advances in nanotechnology have led to the development of curcumin nano-formulations that improve its solubility and stability, thereby increasing its bioavailability. Additionally, the co-administration of adjuvants such as piperine has been shown to augment curcumin's plasma concentrations significantly.37 Synthesis of curcumin derivatives with improved pharmacokinetic profiles also presents a promising approach.38 These strategies collectively aim to surmount the pharmacological barriers and harness the full therapeutic potential of curcumin, thereby facilitating its transition from bench to bedside as a viable treatment modality for AD.
In summary, this research has, for the first time, elucidated that curcumin mitigates oxidative stress by inactivating the ERK1/2 signaling pathways that facilitate autophagy in NSCs. The study unveils a novel therapeutic mechanism of curcumin at the cellular and molecular levels, underscoring its clinical potential in the management of neurodegenerative diseases and paving the way for the exploration of new curcumin applications.
CONCLUSIONS
This study delineates the protective effects of curcumin on NSCs against oxidative stress. It demonstrates that curcumin administration mitigates oxidative stress by attenuating autophagy, an effect mediated by a reduction in ERK expression within NSCs. Our findings underscore curcumin's potential as a promising therapeutic agent for the treatment of neurodegenerative diseases and elucidate the molecular mechanisms underlying its antioxidant properties. However, further research is necessary to explore the mechanisms and therapeutic efficacy of nano-formulated curcumin in individuals with neurodegenerative conditions.
AUTHOR CONTRIBUTIONS
J.L. and W.L. conceived and designed the experiments. Y.R., H.L., J.T. completed most of the experimental components and co-authored this manuscript. The corresponding author had full access to all the data and had final responsibility for the decision to submit for publication.
ACKNOWLEDGEMENTS
We would like to thank the corresponding authors, Wang Liao and Jun Liu, for their guidance, the National Natural Science Foundation of China, the Natural Science Foundation of Guangdong Province and the Natural Science Foundation of Guangzhou Municipality for their financial support of this project, and the members of the group for their technical help.
FUNDING INFORMATION
This study was supported by the grant from the National Natural Science Foundation of China (Nos. 82171178, 82101271, 82371186) and the Natural Science Foundation of Guangdong Province (No. 2022A1515110288). Natural Science Foundation of Guangzhou (No. SL2022A04J00442), Scientific Research Project of Guangdong Bureau of Traditional Chinese Medicine (No. 20232093), Plan on enhancing scientific research in GMU.
CONFLICT OF INTEREST STATEMENT
The authors declare that there is no conflict of interest regarding the publication of this paper.
DATA AVAILABILITY STATEMENT
The data used to support the findings of this study are available from the corresponding author upon request.
Zhao C, Deng W, Gage FH. Mechanisms and functional implications of adult neurogenesis. Cell. 2008;132(4):645‐660. doi:
Lee H, Thuret S. Adult human hippocampal neurogenesis: controversy and evidence. Trends Mol Med. 2018;24(6):521‐522. doi:
Tobin MK, Musaraca K, Disouky A, et al. Human hippocampal neurogenesis persists in aged adults and Alzheimer's disease patients. Cell Stem Cell. 2019;24(6):974‐982.e3. doi:
Yao J, Dai S, Zhu R, et al. Deciphering molecular heterogeneity and dynamics of human hippocampal neural stem cells at different ages and injury states. elife. 2024;12: [eLocator: RP89507]. doi:
Tripathi GM, Kalita J, Misra UK. A study of oxidative stress in migraine with special reference to prophylactic therapy. Int J Neurosci. 2018;128(4):318‐324. doi:
Méndez‐García LA, Martínez‐Castillo M, Villegas‐Sepúlveda N, Orozco L, Córdova EJ. Curcumin induces p53‐independent inactivation of Nrf2 during oxidative stress‐induced apoptosis. Hum Exp Toxicol. 2019;38(8):951‐961. doi:
Salehi B, Lopez‐Jornet P, Pons‐Fuster López E, et al. Plant‐derived bioactives in oral mucosal lesions: a key emphasis to curcumin, lycopene, chamomile, aloe vera, green tea and coffee properties. Biomol Ther. 2019;9(3): [eLocator: 106]. doi:
Tang M, Taghibiglou C. The mechanisms of action of curcumin in Alzheimer's disease. J Alzheimers Dis. 2017;58(4):1003‐1016. doi:
Abrahams S, Haylett WL, Johnson G, Carr JA, Bardien S. Antioxidant effects of curcumin in models of neurodegeneration, aging, oxidative and nitrosative stress: a review. Neuroscience. 2019;406:1‐21. doi:
Kang SK, Cha SH, Jeon HG. Curcumin‐induced histone hypoacetylation enhances caspase‐3‐dependent glioma cell death and neurogenesis of neural progenitor cells. Stem Cells Dev. 2006;15(2): [eLocator: 165]. doi:
Kim SJ, Son TG, Park HR, et al. Curcumin stimulates proliferation of embryonic neural progenitor cells and neurogenesis in the adult hippocampus. J Biol Chem. 2008;283(21):14497‐14505. doi:
Luan P, Zhou HH, Zhang B, et al. Basic fibroblast growth factor protects C17.2 cells from radiation‐induced injury through ERK1/2. CNS Neurosci Ther. 2012;18(9):767‐772. doi:
Kabeya Y, Mizushima N, Ueno T, et al. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J. 2000;19(21):5720‐5728. doi:
He C, Klionsky DJ. Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet. 2009;43:67‐93. doi:
Kimura S, Noda T, Yoshimori T. Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent‐tagged LC3. Autophagy. 2007;3(5):452‐460. doi:
Chen C, Wang S, Yu L, et al. H2O2‐mediated autophagy during ethanol metabolism. Redox Biol. 2021;46: [eLocator: 102081]. doi:
Liao W, Zheng Y, Fang W, et al. Dual specificity phosphatase 6 protects neural stem cells from β‐amyloid‐induced cytotoxicity through ERK1/2 inactivation. Biomol Ther. 2018;8(4): [eLocator: 181]. doi:
Nishida M, Maruyama Y, Tanaka R, Kontani K, Nagao T, Kurose H. G alpha(i) and G alpha(o) are target proteins of reactive oxygen species. Nature. 2000;408(6811):492‐495. doi:
Saffarionpour S, Diosady LL. Curcumin, a potent therapeutic nutraceutical and its enhanced delivery and bioaccessibility by pickering emulsions. Drug Deliv Transl Res. 2022;12(1):124‐157. doi:
Nebrisi EE. Neuroprotective activities of curcumin in Parkinson's disease: a review of the literature. Int J Mol Sci. 2021;22(20): [eLocator: 11248]. doi:
Shi LY, Zhang L, Li H, et al. Protective effects of curcumin on acrolein‐induced neurotoxicity in HT22 mouse hippocampal cells. Pharmacol Rep. 2018;70(5):1040‐1046. doi:
Samarghandian S, Azimi‐Nezhad M, Farkhondeh T, Samini F. Anti‐oxidative effects of curcumin on immobilization‐induced oxidative stress in rat brain, liver and kidney. Biomed Pharmacother. 2017;87:223‐229. doi:
van Meeteren ME, Hendriks JJ, Dijkstra CD, van Tol EA. Dietary compounds prevent oxidative damage and nitric oxide production by cells involved in demyelinating disease. Biochem Pharmacol. 2004;67(5):967‐975. doi:
Ren L, Zhan P, Wang Q, et al. Curcumin upregulates the Nrf2 system by repressing inflammatory signaling‐mediated Keap1 expression in insulin‐resistant conditions. Biochem Biophys Res Commun. 2019;514(3):691‐698. doi:
Fu XY, Yang MF, Cao MZ, et al. Strategy to suppress oxidative damage‐induced neurotoxicity in PC12 cells by curcumin: the role of ROS‐mediated DNA damage and the MAPK and AKT pathways. Mol Neurobiol. 2016;53(1):369‐378. doi:
Scrivo A, Bourdenx M, Pampliega O, Cuervo AM. Selective autophagy as a potential therapeutic target for neurodegenerative disorders. Lancet Neurol. 2018;17(9):802‐815. doi:
Scott RC, Juhász G, Neufeld TP. Direct induction of autophagy by Atg1 inhibits cell growth and induces apoptotic cell death. Curr Biol. 2007;17(1):1‐11. doi:
Nikooie R, Moflehi D, Zand S. Lactate regulates autophagy through ROS‐mediated activation of ERK1/2/m‐TOR/p‐70S6K pathway in skeletal muscle. J Cell Commun Signal. 2021;15(1):107‐123. doi:
Liu R, Zhang HB, Yang J, Wang JR, Liu JX, Li CL. Curcumin alleviates isoproterenol‐induced cardiac hypertrophy and fibrosis through inhibition of autophagy and activation of mTOR. Eur Rev Med Pharmacol Sci. 2018;22(21):7500‐7508. doi:
Shi X, Zheng Z, Li J, et al. Curcumin inhibits Aβ‐induced microglial inflammatory responses in vitro: involvement of ERK1/2 and p38 signaling pathways. Neurosci Lett. 2015;594:105‐110. doi:
Mizushima N, Levine B, Cuervo AM, Klionsky DJ. Autophagy fights disease through cellular self‐digestion. Nature. 2008;451(7182):1069‐1075. doi:
Li YF, Ouyang SH, Tu LF, et al. Caffeine protects skin from oxidative stress‐induced senescence through the activation of autophagy. Theranostics. 2018;8(20):5713‐5730. doi:
Shen M, Cao Y, Jiang Y, Wei Y, Liu H. Melatonin protects mouse granulosa cells against oxidative damage by inhibiting FOXO1‐mediated autophagy: implication of an antioxidation‐independent mechanism. Redox Biol. 2018;18:138‐157. doi:
Wan Y, Liang Y, Liang F, et al. A curcumin analog reduces levels of the Alzheimer's disease‐associated amyloid‐β protein by modulating AβPP processing and autophagy. J Alzheimer Dis. 2019;72(3):761‐771. doi:
Cioffi F, Adam RHI, Broersen K. Molecular mechanisms and genetics of oxidative stress in Alzheimer's disease. J Alzheimer Dis. 2019;72(4):981‐1017. doi:
Wen C, Cao L, Yu Z, Liu G, Zhang J, Xu X. Advances in lipo‐solubility delivery vehicles for curcumin: bioavailability, precise targeting, possibilities and challenges. Crit Rev Food Sci Nutr. 2023;1:20. doi:
Patel SS, Acharya A, Ray RS, Agrawal R, Raghuwanshi R, Jain P. Cellular and molecular mechanisms of curcumin in prevention and treatment of disease. Crit Rev Food Sci Nutr. 2020;60(6):887‐939. doi:
Mahran RI, Hagras MM, Sun D, Brenner DE. Bringing curcumin to the clinic in cancer prevention: a review of strategies to enhance bioavailability and efficacy. AAPS J. 2017;19(1):54‐81. doi:
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2024. This work is published under http://creativecommons.org/licenses/by-nc-nd/4.0/ (the "License"). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Objectives
This study investigates curcumin's neuroprotective role and its potential in promoting neurogenesis in progenitor cells within the brain. Notably, curcumin's antioxidant properties have been implicated in Alzheimer's disease treatment. However, the association between curcumin's antioxidative effects and its impact on neural stem cells (NSCs) remains to be elucidated.
Methods
C17.2 neural stem cells were utilized as a model to simulate oxidative stress, induced by hydrogen peroxide (H2O2). We quantified the levels of superoxide dismutase (SOD), malondialdehyde (MDA), and intracellular reactive oxygen species (ROS), alongside the gene expression of SOD1 and SOD2, to assess intracellular oxidative stress. Additionally, Western blot analysis was conducted to measure the expressions of LC3‐II, Beclin‐1, and phosphorylated ERK (p‐ERK), thereby evaluating autophagy and ERK signaling pathway activation.
Results
Treatment with curcumin resulted in a reduction of MDA and ROS levels, suggesting a protective effect on NSCs against oxidative damage induced by H2O2. Furthermore, a decrease in the relative expressions of LC3‐II, Beclin‐1, and p‐ERK was observed post‐curcumin treatment.
Conclusions
The findings suggest that curcumin may confer protection against oxidative stress by attenuating autophagy and deactivating the ERK1/2 signaling pathways, which could contribute to therapeutic strategies for Alzheimer's disease.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
; Liao, Wang 2
1 Department of Rehabilitation, The Second Affiliated Hospital, Guangzhou Medical University, Guangzhou, Guangdong, China
2 Department of Neurology, The Second Affiliated Hospital, Guangzhou Medical University, Guangzhou, Guangdong, China
3 Department of Neurology, Sun Yat‐sen Memorial Hospital of Sun Yat‐sen University, Guangdong, China
4 Department of Neurology, The First Affiliated Hospital of Guangdong Pharmaceutical University, Guangzhou, China