HNF-1β alleviates podocyte injury in lupus nephritis by maintaining endoplasmic reticulum homeostasis

Abstract

Objective

The current study aims to elucidate the critical function of hepatocyte nuclear factor 1-beta (HNF1-β) in lupus nephritis (LN) by investigating its modulation of the Derlin-1/valosin-containing protein (VCP)/VCP-interacting membrane selenoprotein (VIMP) complex, endoplasmic reticulum (ER) stress and podocyte apoptosis.

Methods

In vitro and in vivo models of LN were established using glomerular podocytes treated with LN serum and MRL/lpr mice, respectively. The expression levels of HNF1-β were analysed in kidney tissues from patients with LN and MRL/lpr mice. To assess the effects of HNF1-β inhibition, an adeno-associated virus vector carrying HNF1-β short hairpin was administered to MRL/lpr mice. In vitro, glomerular podocytes were transfected with HNF1-β small interfering RNA (siRNA) or HNF1-β overexpression plasmids to explore their regulatory effects on the Derlin-1/VCP/VIMP complex and podocyte apoptosis. Dual-luciferase reporter assays and chromatin immunoprecipitation (ChIP) assays were performed to investigate the transcriptional activation of Derlin-1 and VCP promoters by HNF1-β.

Results

A significant decrease in HNF1-β levels was observed in kidney tissues from patients with LN while MRL/lpr mice exhibited an initial compensatory increase followed by a subsequent decrease in renal HNF1-β expression. Overexpression of HNF1-β transcriptionally upregulated Derlin-1 and VCP mitigating LN serum-induced ER stress and podocyte apoptosis. In contrast, HNF1-β inhibition exacerbated renal dysfunction and structural damage in MRL/lpr mice. Interestingly, HNF1-β inhibition transcriptionally repressed ERP44, leading to calcium ions (Ca²⁺) release-mediated disruption and inactivation of the Derlin-1/VCP/VIMP complex. This finding suggests that HNF1-β not only regulates the expression of key proteins in the Derlin-1/VCP/VIMP complex but also influences their assembly through Ca²⁺ release regulation.

Conclusion

This study provides novel insights into the regulatory mechanisms of HNF1-β in LN emphasising its impact on the Derlin-1/VCP/VIMP complex, ER stress and podocyte apoptosis. These findings have the potential to inform the development of new diagnostic tools and therapeutic strategies for LN.

Correspondence to Professor Fan Zhang; [email protected] ; Professor Bing Guo; [email protected] ; Dr Jun Liu; [email protected]

WHAT IS ALREADY KNOWN ON THIS TOPIC

• Podocyte injury represents a pivotal factor in the pathogenesis and progression of lupus nephritis (LN), yet the underlying mechanisms remain elusive. Substantial evidence underscores the pivotal role of apoptosis activation in podocyte injury which subsequently drives kidney damage in LN. Endoplasmic reticulum-associated degradation (ERAD) is a vital intracellular quality-control mechanism that facilitates the transfer of misfolded proteins from the endoplasmic reticulum (ER) to cytosolic proteasomes for degradation. The Derlin-1/valosin-containing protein (VCP)/VCP-interacting membrane selenoprotein (VIMP) complex, colloquially known as the Derlin-1 complex, is a key constituent of the ERAD system, instrumental in the retrograde translocation of misfolded proteins from the ER to the cytoplasm. A decline in the expression or functional imbalance of the Derlin-1 complex disrupts the degradation of misfolded proteins eliciting a robust ER stress response that disrupts ER homeostasis and triggers cellular damage and apoptosis. Notably, the Derlin-1 complex is also essential for maintaining normal podocyte function.

WHAT THIS STUDY ADDS

• Hepatocyte nuclear factor 1-beta (HNF1-β) exhibits a compensatory increase in the early stages of LN followed by depletion in the decompensated stage.

• HNF1-β transcriptionally upregulates Derlin-1 and VCP, thereby stabilising the Derlin-1 complex and preserving ER homeostasis.

• Inhibition of HNF1-β transcriptionally downregulates ERP44 expression leading to calcium ions (Ca²⁺) release-mediated dissociation of the Derlin-1 complex.

HOW THIS STUDY MIGHT AFFECT RESEARCH, PRACTICE OR POLICY

• These findings underscore the multifaceted role of HNF1-β on the expression of key proteins within the Derlin-1 complex but also its impact on the polymerisation of these proteins through the regulation of Ca²⁺ release. This study has the potential to introduce novel perspectives and avenues for clinical treatment and diagnosis of LN, facilitating the development of targeted therapies aimed at preserving podocyte function and mitigating kidney damage.

Introduction

Lupus nephritis (LN), a common complication of SLE, represents a significant cause of morbidity and mortality among patients with the disease.¹ Recent clinical reports and foundational research have highlighted the intimate association between podocyte injury and the progression of LN.^{2 3} Notably, podocyte damage is evident even in the early stages of the disease suggesting that it is not merely a manifestation of renal impairment in LN but a pivotal factor contributing to renal dysfunction. Furthermore, the presence of undifferentiated podocytes in the urine of patients with LN coupled with a positive correlation between urinary levels of podocyte-specific proteins and the severity of proteinuria and renal impairment underscores the critical role of podocyte injury in LN pathogenesis.⁴ Convincing evidence now indicates that endoplasmic reticulum (ER) stress-mediated apoptosis serves as the fundamental mechanism underlying podocyte damage, ultimately leading to renal injury in LN.

Within eukaryotic cells, the ER serves as a pivotal locale for protein synthesis and maturation processes.⁵ Abundant in the ER are diverse molecular chaperones and folding enzymes which collaborate to facilitate protein folding and post-translational modifications.⁶ Genetic mutations, transcriptional deficiencies and various other factors can lead to protein misfolding resulting in protein aggregation within the ER and subsequently triggering ER stress.⁷ This stress disrupts normal cellular functions, inducing apoptosis and potentially leading to the onset of severe disease. Endoplasmic reticulum-associated degradation (ERAD) is a critical quality-control mechanism in the cell that is responsible for transferring misfolded proteins from the ER for degradation by cytosolic proteasomes.⁸ Dysfunction of the ERAD system has been linked to numerous diseases.^9–11 The Derlin-1/valosin-containing protein (VCP)/VCP-interacting membrane selenoprotein (VIMP) complex, abbreviated as the Derlin-1 complex, is one of the key components of the ERAD system.¹² The complex plays a crucial role in facilitating the retrograde transport of misfolded proteins from the ER to the cytoplasm. This process leads to the subsequent degradation of misfolded proteins within cytoplasmic lysosomes¹³ (online supplemental figure S1). A reduction in the expression or function of the Derlin-1 complex attributed to various factors impairs the degradation of misfolded proteins. This impairment triggers a robust ER stress response, ultimately disrupting ER homeostasis.¹⁴ Sugiyama et al demonstrated that the absence of the Derlin-1 complex not only triggers neuronal cell apoptosis both in vitro and in vivo but also interferes with the synthesis of neurotransmitters within neuronal cells.¹⁵ Additionally, Zhang et al¹² revealed that extensive accumulation of misfolded proteins occurs within the ER during suppression of the Derlin-1 complex. Renal tubular epithelial cells experience severe ER stress as a result of this accumulation which ultimately contributes to the development and progression of renal interstitial fibrosis. In conclusion, the role of the Derlin-1 complex in various diseases in which ER stress induces cellular damage and apoptosis is increasingly gaining attention.

As a transcription factor, hepatocyte nuclear factor 1-beta (HNF-1β) is crucial for various biological processes.¹⁶ It is expressed in organs such as the liver, pancreas and kidneys and participates in the regulation of gene transcription, playing a critical role in the development, metabolism and maintenance of the functions of these organs.¹⁷ However, mutations in HNF-1β have been observed and demonstrated to play an important role in various acute and chronic kidney diseases (CKDs). In experimental models of acute kidney injury, the upregulation of HNF-1β plays a vital role in promoting renal tubule regeneration.¹⁸ Conversely, when HNF-1β is absent in renal epithelial cells, it leads to abnormal TGF-β signalling and epithelial-mesenchymal transition, ultimately contributing to renal fibrosis via a non-cell autonomous mechanism.¹⁹ These previous findings underscore the crucial role of HNF1-β in maintaining normal kidney development and substantial cell function. Nonetheless, its specific involvement in the podocyte injury process within the LN remains uncertain.

The present investigation revealed age-related fluctuations in HNF1-β expression within renal tissues from lupus-prone mice. Early in the progression of the disease, there was an increase in HNF1-β expression which was followed by a reduction of HNF1-β expression in the subsequent phases. In MRL/lpr mice, inhibition of HNF1-β aggravated renal impairment and increased structural damage. Conversely, overexpressing HNF1-β significantly delayed podocyte apoptosis induced by LN serum. Mechanistically, HNF1-β transcriptionally facilitates Derlin-1 and VCP expression ensuring the stability of the Derlin-1 complex and the ER. Derlin-1 and VCP inhibition abrogated the protective effect of HNF1-β on podocytes. Interestingly, aberrant calcium ions (Ca²⁺) release leads to the Derlin-1 complex, causing it to dissociate. Inhibiting HNF1-β transcriptionally decreased endoplasmic reticulum protein 44 (ERP44) expression, triggering Ca²⁺ release-mediated Derlin-1 complex dissociation. These findings not only emphasise the regulatory involvement of HNF1-β in the expression of essential proteins within the Derlin-1 complex but also its effect on the polymerisation of these key proteins via Ca²⁺ release regulation. These findings reveal the particular regulatory role of HNF1-β in the initiation of podocyte apoptosis in LN-induced renal disease.

Materials and methods

Human tissue specimens

From May 2021 to July 2021, at the Department of Rheumatology, Affiliated Hospital of Guizhou Medical University, eight patients who underwent renal biopsy were diagnosed with LN and satisfied the 2019 European League Against Rheumatism/American College of Rheumatology Classification Criteria for SLE. Ultrasound-guided percutaneous renal biopsies were obtained from all patients and kidney tissues were extracted for subsequent preparation and sectioning via pathology. Table 1 shows the histological classification details of the eight biopsied patients with LN. Concurrently, normal kidney tissues were procured from eight individuals who underwent nephrectomy due to renal trauma at the Department of Urinary Surgery, Affiliated Hospital of Guizhou Medical University, during the same period as the patients with LN. All specimens were subjected to conventional staining and thorough pathological examination by pathologists. Human serum (LN serum) samples were collected from the same individuals who underwent biopsy during flare-up and were used for cell stimulation. Normal serum samples were sourced from healthy female volunteers who did not have any known health conditions and matched the age profile of the patients with LN. The specific pathogenic antibodies found in the serum samples of patients with LN are showcased in table 2 and online supplemental figure S8. All patients who were registered at the Affiliated Hospital of Guizhou Medical University (Guiyang, China) signed a written informed consent form.

Table 1

Histological classification of the eight biopsied patients with LN

All cases	Gender	Age (year)	C1q	C3	IgA	IgG	IgM	Classification
Case 1	Female	16	+++	+++	+++	+	+++	III
Case 2	Female	17	+++	+++	++ ++++	±	+	IV V
Case 3	Female	34	++	+++		+	++
Case 4	Female	37	+	++	+++	++	++	V
Case 5	Female	41	+	+++	++ +	–	+	V IV
Case 6	Female	24	++	++		±	++
Case 7	Female	32	+++	+++	+++ +++	+	++	V IV
Case 8	Female	22	+++	+++		++	++++

Ig, immunoglobulin; LN, lupus nephritis.

Table 2

The antibodies in the serum of eight patients with LN

All cases	Gender	Age	ANA1	Anti-dsDNA	Anti-Sm
Case 1	Female	16	+(1:1000)	–	+
Case 2	Female	17	+(1:3200)	+ +	+
Case 3	Female	34	+(1:1000)		–
Case 4	Female	37	+(1:1000)	++	++
Case 5	Female	41	+(1:3200)	++ +	–
Case 6	Female	24	+(1:1000)		+
Case 7	Female	32	+(1:3200)	+ ++	++
Case 8	Female	22	+(1:1000)		+

ANA1, antinuclear antibody 1; Anti-dsDNA, anti-double-stranded DNA antibody; Anti-Sm, anti-Smith antibody; LN, lupus nephritis.

Animal model

The MRL/lpr strain is a recognised lupus model that shows spontaneous SLE-like symptoms akin to human pathology and is crucial for studying SLE mechanisms and treatments.²⁰ Female MRL/lpr mice obtained from the SLAC Laboratory Animal Research Centre (Shanghai, China) were used as LN mice while sex-matched C57BL/6 mice served as NCs and were housed in controlled environments. For the quantitative analysis of HNF1-β in the kidney, 16 mice at 16 weeks, 16 at 28 weeks of age from the MRL/lpr strain and 16 from the C57BL/6 mouse population were sacrificed after the intraperitoneal injection of 0.6% pentobarbital sodium. Additionally, 12 6-week-old MRL/lpr mice were divided into two groups (MRL/lpr+adeno-associated virus (AAV) shNC and MRL/lpr+AAV-shHNF1-β; n=6 each) to examine the effects of HNF1-β on kidney injury progression. AAV9 RNAi viruses (4.5×10¹¹ vg/mL) were injected into the kidneys via ultrasound guidance. Six untreated C57BL/6 mice were used as controls. At 16 weeks, the mice were euthanised for histopathological and biochemical analyses and urinary protein levels were assessed using Coomassie Brilliant Blue G-250 and serum creatinine (CRE) levels were measured via a Hitachi 7080 automatic analyser. The Institutional Animal Ethics Committee of Guizhou Medical University approved the study. All possible measures were taken to lessen the animals’ suffering. The approval number for the protocol was 2200051 (online supplemental file 2).

Histological and immunohistochemistry analysis

The kidney tissue was fixed using 10% paraformaldehyde, dehydrated and embedded in liquid paraffin to create 4 µm thick sections. After baking for 2 hours at 60°C, the slides were dewaxed in xylene followed by rinses with ethanol and distilled water. H&E, Picrosirius Red or periodic acid-Schiff (PAS) staining was used to assess kidney injury levels. The slides were cleansed with hydrogen peroxide (H₂O₂) for 10 min to remove catalase and subjected to antigen retrieval in boiling sodium citrate buffer for 5 min. Tissue sections were immunostained using diluted primary antibodies after blocking with 5% goat serum at 4°C overnight in a humidified box. Subsequently, the sections were incubated with secondary antibodies for 1 hour at room temperature. Diaminobenzidine staining (ZSGB-BIO, China) was used to visualise the positive signal which was visualised using a Leica microscope imaging system. ImageJ software was used for quantitative analysis (Rawak Software, Germany).

Cell culture and treatment

The immortalised human podocyte cell line (HPC) provided by Professor Fanfan Hou from Southern Medical University (Guangzhou, China) was stored in liquid nitrogen. The cells were cultured in McCoy’s 5A medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, USA) at 37°C with 5% carbon dioxide (CO₂). HNF1-β siRNAs (GeneChem, China) or negative controls (NCs) were transfected into cells using Lipofectamine 3000 reagent (Invitrogen, USA) following the manufacturer’s instructions. After transfection, the cells were cultured for 12 hours under standard conditions, washed with phosphate-buffered saline (PBS) and then exposed to experimental media supplemented with 2% FBS and 8% human serum sourced from either patients with LN (LN serum) or healthy individuals (normal control serum) for 48 hours. Subsequently, all the cells were harvested for further analysis. The specific siRNA sequences used are detailed in table 3.

Table 3

siRNA sequences

Gene	Sense 5’–3’	Antisense 5’–3’
si-HNF1-β	CGUCCCAGCAAAUCUUGUATT	UACAAGAUUUGCUGGGACGTT
si-VCP	GGGCACAUGUGAUUGUUAUTT	AUAACAAUCACAUGUGCCCTT
si-Derlin1	GACUUGGGAGGAAGAAAUTT	AUUUCUUCCUCCCAAGUCCTT
si-Negative control	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT

HNF1-β, hepatocyte nuclear factor 1-beta; siRNA, small interfering RNA; VCP, valosin-containing protein.

Quantitative real-time PCR analysis

Total RNA was extracted from tissues and cells using a TRIzol kit (Invitrogen, USA). After extraction, the RNA was assessed for purity and concentration. The RNA was denatured in a PCR amplification apparatus at 65°C for 5 min followed by reverse transcription into complementary DNA using a reverse transcription kit (Takara, Japan) per the manufacturer’s guidelines. The relative expression levels of the target genes were determined using TB Green Fast quantitative PCR (qPCR) Mix (Takara, Japan) on an ABI Prism 7500 Sequence Detection System (Applied Biosystems, USA). Details of all primers used are provided in table 4.

Table 4

The primers used in the current study

Gene	Species	Forward primer sequence (5'−3')	Reverse primer sequence (5'−3')
HNF1-β	human	AGCCCGTCCAGTTCTCC	GTTCCTGCTTGTGTGCGT
	mouse	ACACTCCTCCCATCCTCAAA	AGAGAGGTGGGATTGGTTCA
Derlin1	human	GGTTGCCCATAAAATTGCT	TCCAAAAGCTGAGAAAACG
	mouse	CATCACGAGCTACTAGTTTG	GATAGAGGAAGGCTTCGGGC
VCP	human	TCGGGAAACTGTGGTAGAG	GCCTTTGGAGGGAGTCACG
	mouse	GAGAACGAGAGAGGCAGACAAA	GGGCGAACATTTCATACTTCCG
VIMP	human	CGCTCTGGAGAATGGCT	ACCCTTGTTTCCACTGACC
	mouse	TGGCTGCTGGCTAGTTG	CCTCACTGGTGGGTTCAC
GAPDH	human	GGGGCTCTCCAGAACATC	TGACACGTTGGCAGTGG
	mouse	GGTTGTCTCCTGCGACTTCA	TGGTCCAGGGTTTCTTACTCC

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HNF1-β, hepatocyte nuclear factor 1-beta; VCP, valosin-containing protein; VIMP, VCP-interacting membrane selenoprotein.

Western blot analysis

Total protein was extracted from tissues and cells using a Total Protein Extraction Kit (KeyGen Biotech, China) and the protein concentration was determined using the bicinchoninic acid (BCA) method. Protein samples were separated via 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Roche, USA) at a constant flow. After blocking with 5% bovine serum albumin (BSA) at 37°C for 2 hours, the membrane was incubated overnight at 4°C with primary antibodies. Subsequently, after the unbound antibodies were washed off with Tris-Buffered Saline with Tween 20 (TBST), the membrane was exposed to goat anti-rabbit immunoglobulin G (IgG) or mouse IgG conjugated with horseradish peroxidase (HRP) at 37 ℃ for 1 hour. Finally, HRP chemiluminescence solution (Millipore, USA) was used to visualise the membranes. Specific details regarding the antibodies used are provided in table 5.

Table 5

The antibodies and their reaction conditions used in the current study

Target	kDa	Raised in	Source	Catalogue. no.
Anti- HNF1-β	58	Mouse	Abcam, UK	ab236759
Anti-Synaptopodin	99	Rabbit	Abcam, UK	ab224491
Anti-Desmin	53	Rabbit	Abcam, UK	ab32362
Anti-WT1	55	Rabbit	Abcam, UK	ab89901
Anti-C1q	26	Mouse	Santa Cruz, USA	sc-365301
Anti-Derlin 1	21	Mouse	Santa Cruz, USA	sc-293385
Anti-IP3R	314	Mouse	Santa Cruz, USA	sc-271197
Anti-Phospho-IP3R	314	Rabbit	CST, USA	#8548
Anti-ERP44	44	Mouse	Santa Cruz, USA	sc-515435
Anti-VCP	90	Rabbit	Proteintech, USA	10 736–1-AP
Anti- VIMP	21	Rabbit	Proteintech, USA	15 591–1-AP
Anti- GRP78	78	Rabbit	Proteintech, USA	11 587–1-AP
Anti- CHOP	30	Rabbit	Proteintech, USA	15 204–1-AP
Anti- Bax	21	Rabbit	Proteintech, USA	50 599–2-AP
Anti- Bcl2	26	Mouse	Proteintech, USA	26 593–1-AP
Anti- Caspase 3	32	Rabbit	Proteintech, USA	19 677–1-AP
Anti- PARP	113	Rabbit	Proteintech, USA	13 371–1-AP
Anti-GAPDH	36	Mouse	Proteintech, USA	60 004–1-Ig

ERP44, endoplasmic reticulum protein 44; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HNF1-β, hepatocyte nuclear factor 1-beta; IP3R, inositol trisphosphate receptors; VCP, valosin-containing protein; VIMP, VCP-interacting membrane selenoprotein; WT1, Wilms’ tumour-1.

Flow cytometric analysis of apoptosis

Annexin V (AV) and propidium iodide (PI) serve as vital fluorescent markers for discerning various stages of cell death.²¹ AV targets phosphatidylserine, allowing for the identification of early apoptotic cells by binding to externalised phosphatidylserine while PI labels late apoptotic and necrotic cells by penetrating compromised membranes. The combined use of these methods in flow cytometry enables the precise differentiation of cell death types. This dual-staining approach offers intricate insights into cellular dynamics contributing to a comprehensive understanding of the cell cycle, pathological mechanisms and nuances in cellular demise. The cells were treated with 10% FBS and lupus serum for 6 hours. Subsequently, the cells were centrifuged at 800×g and 4°C for 5 min followed by two washes with PBS. The supernatant was discarded and according to the manufacturer’s instructions, 5 µl of AV and 2 µl of PI were added to the cells. Within 30 min of staining, a flow cytometer (Beckman Coulter, USA) was used to analyse cell apoptosis based on the number of early apoptotic cells.

Immunofluorescence analysis

The cells were spread evenly onto a confocal dish and cultured in McCoy’s 5A medium supplemented with 10% serum. The cells were incubated at 37°C for 48 hours after which the adherent cells were fixed with 4% paraformaldehyde. Triton X-100 was used for cell permeabilisation. Subsequently, the cells were blocked with 1% BSA at room temperature for 30 min and incubated overnight at 4°C with the primary antibody. On the following day, the fluorescent secondary antibody was added and the samples were incubated at room temperature for 2 hours. Nuclear staining was performed using 4',6-DiAmidino-2-PhenylIndole (DAPI). After the cells were washed with PBS, they were promptly observed under a laser confocal microscope.

Visualising ER in podocytes using ER Tracker Red

To visualise the ER in podocytes, we conducted staining with ER Tracker Red dye (Beyotime, China) which is widely recognised for its specificity and sensitivity in labelling ER structures. Prior to staining, podocytes were gently rinsed with PBS to eliminate any trace of culture medium. Subsequently, the cells were exposed to ER Tracker Red dye diluted to a concentration of 1 µM in a complete growth medium. This concentration is commonly employed in similar staining protocols due to its balance between staining intensity and cell viability. The podocytes were then incubated with the dye for 30 min at 37°C in a humidified atmosphere containing 5% CO2, allowing the dye to permeate the cells and bind specifically to ER structures. After the incubation period, the cells were meticulously washed two times with PBS to remove any unbound dye, ensuring clean and accurate visualisation. Staining procedures were conducted under low-light conditions to prevent dye photobleaching and to maintain the integrity of the fluorescent signal. For visualisation, the stained podocytes were examined using a high-resolution fluorescence microscope configured with appropriate filters to detect the red fluorescence emitted by the ER Tracker Red dye.

Observation of podocyte ER using transmission electron microscopy

Podocytes were fixed with a buffered solution of 2.5% glutaraldehyde in 0.1 M sodium cacodylate, pH 7.4, for 2 hours at room temperature. This fixative was chosen for its ability to preserve cellular ultrastructure while minimising artefact formation. Postfixation, cells were rinsed again with cacodylate buffer and treated with 1% osmium tetroxide in the same buffer for 1 hour to enhance membrane contrast. Cells were then dehydrated through a graded series of ethanol concentrations and infiltrated with propylene oxide before embedding in Epon 812 resin. Blocks containing the embedded podocytes were sectioned at a thickness of 70 nm using an ultramicrotome. Sections were mounted on copper grids, stained with uranyl acetate and lead citrate to enhance electron density and membrane contrast, respectively. Finally, the stained sections were examined under a transmission electron microscope.

Chromatin immunoprecipitation assay

The cells were fixed with paraformaldehyde. HNF1-bound DNA was collected using antibodies according to the chromatin immunoprecipitation (ChIP) kit instructions (Millipore, USA). PCR was used to confirm the target gene promoter and ChIP‒qPCR was used for quantitative analysis. The input percentage technique was used to calculate the efficiency of immunoprecipitation (IP).

Luciferase reporter assay

The transfected cells were subjected to cleavage in a petri dish using a cleavage buffer. Luciferase assay reagent II, 1×Passive Lysis buffer and Stop & Glo reagent lysis solution were prepared at room temperature following the guidelines provided by Promega, USA. After the cells were washed with precooled PBS, 100 µl of 1×Passive Lysis buffer was added to the cells and the cells were left at room temperature to divide. To measure the fluorescence intensity of the fireflies, 20 μl of cell lysate was mixed well with 100 µl of Luciferase Assay Reagent II and evaluated via a chemiluminescence detector (GloMax 20/20, Promega, USA). Subsequently, 100 µl of Stop & Glo reagent was added to the mixture and a chemiluminescence detector was used to record the fluorescein concentration. Ultimately, the ratio of firefly to fluorescein fluorescence intensity was used for statistical analysis.

Coimmunoprecipitation analysis

The cells were placed in a 10 cm cell culture dish with precooled radio immunoprecipitation assay (RIPA) solution for cell lysis. The supernatant was separated into three groups and maintained as input, IP and IgG samples. The IP sample was incubated with the Derlin-1 antibody whereas the IgG sample was incubated with the IgG antibody. The collected specimens were kept at 4°C overnight. The IP and IgG samples were incubated overnight in a vertical mixer at 4°C with 40 µl of Protein A agarose on the second day. On the third day, after centrifugation, the supernatant was removed and the IP lysate and loading buffer were added to the mixture which was subsequently incubated for 10 min. Western blot (WB) was conducted as previously described.

Measurement of [Ca²⁺]i

The [Ca²⁺]i was measured by a Shimadzu RF5301 fluorescence spectrophotometer (Japan). HPC cells were cultivated in McCoy’s 5A medium for 45 min at 37°C with 2 M fura-2/AM (Sigma-Aldrich, USA). The fura-2/AM was cleaned with Hank’s balanced salt solution (HBSS) buffer after incubation and the cells in suspension were measured in a cuvette with a spectrophotometer at 37°C. The intracellular Ca²⁺ concentration was measured using an RF-5301 fluorescence spectrophotometer with excitation wavelengths of 340 nm and 380 nm and an emission wavelength of 500 nm. In the effective dose range, none of the experimental reagents produced fluorescence interference. The computer automatically recorded and calculated the results.

Statistical analysis

A two-tailed Student’s t-test or one-way analysis of variance was used to compare quantitative data between groups. If p<0.05, the difference was considered significant: *. The mean±SD of at least three independent experiments was used to determine the data. SPSS 22.0 statistical software (IBM, USA) was used for all the statistical analyses.

Results

HNF1-β expression was involved in the development of LN

Dysregulated expression of HNF1-β is a major cause of many disorders and contributes significantly to both the development and progression of these disorders.²² To examine the involvement of the HNF1-β protein in the progression of LN-induced kidney damage, renal biopsy specimens were collected from eight patients with LN for pathological quantification of HNF1-β. Normal kidney tissues were obtained from eight patients who underwent nephrectomy following renal trauma and served as controls. HE staining revealed significant glomerular lesions in renal biopsy tissues from patients with LN. Immunohistochemical analysis indicated a marked reduction in HNF1-β protein expression within the glomeruli of patients with LN compared with that in normal kidney tissues (figure 1A). Additionally, we evaluated the expression levels of HNF1-β in the renal tissues of two groups of MRL/lpr mice at different ages with C57BL/6 mice used as the normal control. Histological examinations including HE, Picrosirius Red and PAS staining revealed significant pathological damage in the glomeruli of MRL/lpr mice compared with C57BL/6 mice and the extent of damage worsened with increasing age in MRL/lpr mice. Immunohistochemistry (IHC) analysis revealed significantly higher HNF1-β protein levels in the kidneys of 16-week-old MRL/lpr mice compared with those of C57BL/6 mice. However, a notable decrease in its expression was observed in the kidneys of 28-week-old MRL/lpr mice with their expression being significantly lower than the HNF1-β expression in the kidneys of C57BL/6 mice (figure 1D–G). Quantitative real-time PCR (RT-qPCR) and WB analyses further validated the expression levels of HNF1-β in the three groups of mouse kidneys and the trends were consistent with the results obtained from the IHC analysis. The messenger RNA (mRNA) and protein levels of HNF1-β in the kidney tissue of 16-week-old MRL/lpr mice were both significantly higher than those of C57BL/6 mice while the mRNA and protein levels of HNF1-β in 28-week-old MRL/lpr mice were both significantly lower than those of C57BL/6 mice. (Figure 1B–C). Elevated serum CRE levels and increased urinary protein are indicative of renal function loss in patients with LN. Similarly, in mice with LN, the serum CRE and urinary protein levels increased markedly as nephritis progressed. Our study demonstrated significantly greater levels of serum CRE and urinary protein in MRL/lpr mice than in C57BL/6 mice with these two indicators further increasing with age (figure 1H–I). These findings suggest that the expression of HNF1-β in LN kidneys differs from that in normal renal tissue. Specifically, its expression shows a compensatory increase in the early stage of LN progression whereas it decreases in the later stage. The disparity observed between human and animal models in the context of LN can be attributed to the inherent difficulty in capturing a comprehensive, early-stage picture of the kidneys in patients with LN. Frequently, by the time patients with LN undergo kidney biopsy, their renal condition has already progressed to a more advanced stage hampering our ability to observe the compensatory upregulation of HNF1-β that is evident in the kidneys of MRL/lpr mice during the earlier phases of the disease. As a result, direct comparisons between the two models may be hindered by this temporal disparity in disease progression.

Figure 1. The expression of HNF1-[beta] was assessed in renal tissues obtained from patients and mice with LN. (A) Renal tissue sections from patients with LN and from kidneys of healthy patients (n=8) were stained with Picrosirius Red and subjected to IHC for HNF1-[beta] (% control represents the relative positive area). (B) Quantification of HNF1-[beta] mRNA levels in mouse kidney tissues using RT-qPCR. (C) WB analysis of HNF1-[beta] protein expression in mouse kidneys. (D-G) Histological staining with HE, PAS and Picrosirius Red and IHC for HNF1-[beta] (% control signifies the relative positive area) in renal tissue sections from MRL/lpr and C57BL/6 mice. (H-I) Renal function was analysed by measuring the levels of urinary protein and serum CRE in mice. p<0.05 was considered to indicate statistical significance (*). The data are presented as the mean+-SD from a minimum of three independent experiments. CRE, creatinine; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HNF1-[beta], hepatocyte nuclear factor 1-beta; IHC, immunohistochemistry; LN, lupus nephritis; mRNA, messenger RNA; PAS, periodic acid-Schiff; RT-qPCR, quantitative real-time-PCR; WB, Western blot.

Overexpression of HNF1-β attenuates LN serum-induced podocyte apoptosis

Sustained stimulation by LN serum is a significant factor contributing to LN podocyte injury and involves the activation of various apoptotic and pyroptotic signalling pathways.²³ This form of stimulus-induced podocyte damage is a crucial contributor to LN pathogenesis. Initially, we observed that LN serum stimulation significantly activated BAX/Caspase-3 signalling and induced podocyte damage (figure 2D). On stimulation with serum from patients with lupus, we witnessed intricate temporal fluctuations in the expression of HNF1-β within podocytes. Our results clearly indicate that the initial exposure to LN serum elicits a robust elevation in HNF1-β expression in podocytes with levels peaking at 6 hours—significantly surpassing those in the 0 hour stimulation control. However, as the duration of exposure lengthens, the expression of HNF1-β within podocytes begins to decline gradually culminating in a trough at 15 hours. At this point, the expression levels are not only markedly lower than those observed at 6 hours but also significantly decreased compared with the baseline levels at 0 hours. This temporal pattern of HNF1-β expression mirrors the compensatory response observed in vivo where HNF1-β levels in the kidney tissue of 16-week-old mice initially rise in response to LN but subsequently decrease as the disease progresses. Our in vitro experiments have successfully replicated this phenomenon, thereby reinforcing the potential role of HNF1-β in podocyte apoptosis induced by LN serum (figure 2A–B). To gain a deeper insight into the role of HNF1-β during the compensatory phase of podocyte apoptosis induced by LN serum, we used siRNA plasmids to downregulate its expression specifically during the spontaneous upregulation of HNF1-β which occurs after 6 hours of LN serum stimulation. This allowed us to observe the effects of reduced HNF1-β on podocyte behaviour. In contrast, to explore the function of HNF1-β in the decompensatory phase, we transfected overexpression plasmids into podocytes at the point where HNF1-β expression declines, typically post-15 hours of LN serum stimulation. This strategy aimed to elevate HNF1-β levels and assess its potential to counter the detrimental effects associated with its exhaustion. By adopting these targeted approaches, we aimed to uncover the temporal and functional importance of HNF1-β in modulating podocyte apoptosis in the context of LN serum exposure (figure 2C). WB analyses were performed to quantify HNF1-β levels, apoptosis-related proteins and podocyte markers. PI staining was used to identify apoptosis-mediated changes in membrane permeability during the apoptosis assay. The percentage of apoptotic cells was precisely determined through dual staining with active AV and PI. Gain-of-function and loss-of-function experiments unveiled that ectopic HNF1-β expression partially mitigated the LN serum-induced activation of the BAX/Caspase-3 apoptotic signalling pathway in podocytes. In contrast, silencing HNF1-β augmented this apoptotic response triggered by LN serum (figure 2E and online supplemental figure S5). Flow cytometry data revealed a notably lower percentage of double-stained podocytes in the HNF1-β overexpression model compared with the control whereas HNF1-β silencing heightened podocyte apoptosis (figure 2F). Immunofluorescence (IF) techniques assessed synaptopodin (functional marker) and Desmin (injury marker) expression in podocytes confirming that ectopic HNF1-β expression delayed LN serum-induced podocyte injury while HNF1-β silencing intensified its detrimental effects (figure 2G and H).

Figure 2. Influence of HNF1-[beta] modulation on the apoptotic progression of podocytes. (A) Assessment of relative HNF1-[beta] mRNA expression in HPC cells via RT‒qPCR after treatment with LN serum overtime. (B) Evaluation of HNF1-[beta] protein levels in HPC cells using WB following a temporal gradient in LN serum treatment. (C) Quantification of HNF1-[beta] mRNA expression in HPC cells via RT-qPCR after transfection with HNF1-[beta] siRNA or p-CAG-HNF1-[beta] followed by LN serum treatment. (D-E) The WB analysis of HNF1-[beta], the Derlin-1 complex and ER stress markers was performed in podocytes across different treatment groups. Similarly, the activation of BAX/Caspase-3 signalling in podocytes was also verified. (F) Determination of the apoptotic cell death rate through flow cytometry (n=3). (G-H) Immunofluorescence analysis showing the expression levels of synaptopodin and desmin in podocytes. (I) Electron micrograph depicting the endoplasmic reticulum (ER) within podocytes. p<0.05 indicated statistical significance (*). The data are presented as the mean+-SD from a minimum of three independent experiments. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HNF1-[beta], hepatocyte nuclear factor 1-beta; HPC, human podocyte cell line; LN, lupus nephritis; mRNA, messenger RNA; NC, negative control; RT-qPCR, quantitative real-time-PCR; siRNA, small interfering RNA; VCP, valosin-containing protein; VIMP, VCP-interacting membrane selenoprotein; WB, Western blot.

Under various stimuli, the sustained and excessive induction of ER stress serves as a crucial factor in mediating podocyte apoptosis in LN. Prior research has indicated that the HNF family contributes to maintaining ER homeostasis by regulating the expression of genes involved in ER function. It influences the transcription of ER chaperones, folding enzymes and components of the ERAD pathway and is crucial for proper protein folding and degradation within the ER. Disruptions or deficiencies in HNF1-β function may impact these regulatory pathways, potentially leading to impaired protein folding, accumulation of misfolded proteins and ER stress. Hence, we examined the expression of ER stress markers and the Derlin-1 complex. The results revealed that overexpression of HNF1-β can elevate the expression of the Derlin-1 complex and mitigate LN serum-induced ER stress. Conversely, HNF1-β-siRNA suppressed the expression of the Derlin-1 complex further exacerbating podocyte ER stress (figure 2E and online supplemental material figure S5).

The electron microscopy results revealed that knocking down HNF1-β significantly exacerbated ER swelling and dilation as well as increased vesicular formation after 6 hours of stimulation with patient with LN serum. These morphological alterations were characterised by the enlargement of ER tubules and the formation of numerous small vesicles surrounding the dilated ER structures. These findings suggest that the depletion of HNF1-β enhances the susceptibility of ER to stress induction leading to more pronounced ultrastructural changes. Conversely, when HNF1-β was overexpressed for 15 hours in the presence of patient with LN serum, we observed a marked attenuation of ER swelling and dilation along with a significant reduction in vesicular formation. The ER maintained a relatively normal, well-organised network with fewer vesicular structures compared with the control group (figure 2I). These discoveries imply that HNF1-β could play a safeguarding role in podocytes exposed to LN serum, potentially by modulating the expression of the Derlin-1 complex, thereby preserving ER homeostasis.

HNF1-β transcriptionally enhances Derlin-1 and VCP expression to maintain ER homeostasis and prevent LN serum-induced podocyte apoptosis

Derlin-1, VIMP and VCP are pivotal components of the Derlin-1 complex and play crucial roles in preserving ERAD signalling and cellular ER homeostasis.²⁴ To gain a deeper understanding of the specific roles Derlin-1 and VCP play in HNF1-β-mediated regulation of podocyte apoptosis induced by LN serum, we first exogenously overexpressed HNF1-β in podocytes exposed to LN serum for 15 hours. Following this, we silenced the expression of Derlin-1 and VCP, either individually or concurrently, in these pretreated podocytes. This approach enabled us to investigate the specific contributions of these proteins to the apoptotic process and to determine how HNF1-β modulates their involvement in this context. Through WB analysis, we found that upregulating HNF1-β expression in human podocytes notably augmented the levels of Derlin-1 and VCP, thereby alleviating ER stress and inhibiting the BAX/Caspase-3-mediated apoptotic cascade. However, individual silencing of Derlin-1 or VCP partially restored the expression of apoptosis-related proteins. Remarkably, concurrent suppression of both Derlin-1 and VCP virtually abolished the protective effects of HNF1-β on podocytes (figure 3A–D and online supplemental figure S6). Flow cytometry-based quantification of apoptotic cells concurred with these observations (figure 3E and G). Additionally, WB and cellular IF staining for synaptopodin exhibited a consistent correlation between the severity of podocyte injury and the expression levels of apoptosis-related proteins across the six experimental groups (figure 3F and H). The utilisation of ER Tracker Red for visualising the ER revealed intriguing findings concerning the modulation of ER stress in podocytes. Specifically, overexpression of HNF1-β was found to effectively attenuate the lupus serum-induced increase in ER staining intensity along with the expansion or hypertrophy of the ER in podocytes. This protective effect of HNF1-β was evidenced by a reduction in ER staining intensity and normalisation of ER morphology. However, when either VCP or Derlin-1 was knocked down individually, the alleviating effect of HNF1-β on ER stress was partially reversed. Notably, the concurrent knockdown of both VCP and Derlin-1 essentially abolished the protective role of HNF1-β on ER stress in podocytes. Under these conditions, the ER staining intensity and morphological abnormalities were comparable to those observed in podocytes treated with lupus serum without HNF1-β overexpression (figure 3I). These findings underscore the paramount importance of the Derlin-1 complex in maintaining ER homeostasis and safeguarding podocyte integrity under the influence of HNF1-β.

Figure 3. The role of HNF1-[beta] in maintaining endoplasmic reticulum homeostasis in podocytes through the regulation of Derlin-1 and VCP. (A) Following transfection and stimulation, the protein expression of relevant markers in podocytes was assessed via WB. (B-D) RT-qPCR analysis was conducted to measure the mRNA levels of HNF1-[beta], Derlin-1 and VCP in the six specified experimental groups. (E and G) Quantification of the apoptotic cell death rate using flow cytometry. (F and H) Immunofluorescence analysis showing the synaptopodin levels in the designated experimental groups. (I) Visualisation of the endoplasmic reticulum (ER) using ER Tracker Red. p<0.05 indicated statistical significance (*). The data are presented as the means+-SDs from a minimum of three independent experiments. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HNF1-[beta], hepatocyte nuclear factor 1-beta; mRNA, messenger RNA; NC, negative control; PI, propidium iodide; RT-qPCR, quantitative real-time-PCR; siRNA, small interfering RNA; VCP, valosin-containing protein; VIMP, VCP-interacting membrane selenoprotein; WB, Western blot.

As a transcription factor, HNF1-β exerts its regulatory influence primarily through transcriptional modulation of downstream genes. In this section, we designed dual-luciferase reporter assays and ChIP experiments to validate whether HNF1-β directly transcriptionally activates the expression of Derlin-1 and VCP. Analysis of the JASPAR database revealed the presence of four potential HNF1-β binding sites within the Derlin-1 promoter and three within the VCP promoter. To validate the binding of HNF1-β to these promoters, we designed specific primers and luciferase reporter vectors. Our results revealed that augmenting HNF1-β expression in HEK293 cells led to an increase in Derlin-1 and VCP mRNA levels whereas silencing HNF1-β in HPCs resulted in a reduction of these mRNA levels (figure 4A and B). Furthermore, the dual-luciferase reporter assays demonstrated that HNF1-β transactivates both the Derlin-1 and VCP promoter activities (figure 4D and G). Notably, serial deletion and site-directed mutagenesis experiments pinpointed sites 1, 3 and 4 as indispensable for HNF1-β-induced Derlin-1 transactivation (figure 4E) while sites 1 and 3 played pivotal roles in HNF1-β-mediated VCP transactivation (figure 4H). Additionally, a ChIP experiment conducted in HPCs provided further validation of the direct binding of HNF1-β to the Derlin-1 and VCP promoters (figure 4C and F). Collectively, these findings strongly suggest that HNF1-β transcriptionally amplifies the expression of Derlin-1 and VCP, thereby contributing to the maintenance of podocyte ER homeostasis. This regulatory mechanism underscores the significance of HNF1-β in the context of cellular processes and disease states such as LN.

Figure 4. Influence of HNF1-[beta] on Derlin-1 and VCP expression in LN pathogenesis. (A) Assessment of Derlin-1 and VCP expression levels in HPCs after transfection with HNF1-[beta]-siRNA or a negative control. (B) Evaluation of Derlin-1 and VCP expression levels in HEK293 cells after transfection with p-CAG-vector or p-CAG-HNF1-[beta]. (C and F) ChIP assay revealing direct binding of HNF1-[beta] to the Derlin-1 (or VCP) promoter in HPCs. A significant difference was observed compared with that in the distant region group (*). (D and G) HNF1-[beta] was found to transactivate the Derlin-1 and VCP promoters. Relative luciferase activity was measured in HPCs and HEK293 cells. (E) Identification of three HNF1-[beta]-responsive regions in the Derlin-1 promoter through deletion and selective mutation studies. Assessment of relative luciferase activity following cotransfection of HNF1-[beta] with serially truncated and mutant Derlin-1 promoter constructs. Statistical significance was noted compared with the full-length promoter group (*). (H) Identification of two HNF1-[beta]-sensitive regions in the VCP promoter through deletion and selective mutation studies. The relative luciferase activity of the serially truncated and altered VCP promoter constructs was measured after cotransfection with HNF1-[beta]. A significant difference was observed compared with that of the full-length promoter group (*). p<0.05 was considered to indicate statistical significance (*). The data are presented as the mean+-SD from a minimum of three independent experiments. ChIP, chromatin immunoprecipitation; HNF1-[beta], hepatocyte nuclear factor 1-beta; HPC, human podocyte cell line; IgG, immunoglobulin G; LN, lupus nephritis; mRNA, messenger RNA; NC, negative control; siRNA, small interfering RNA; VCP, valosin-containing protein.

HNF1-β suppresses ER Ca²⁺ release by transcriptionally enhancing ERP44 expression

Ca²⁺ serves as a critical second messenger regulating the aggregation and dissociation of numerous proteins within cells.²⁵ To investigate the impact of Ca²⁺ mobilisation on the stability and functionality of the Derlin-1 complex, a reciprocal coimmunoprecipitation (Co-IP) assay was conducted to validate the interaction between Derlin-1 and VCP. Derlin-1 is reciprocally associated with VCP in the mock group but artificially induced ER Ca²⁺ release via Adenophostin A hexasodium Salt (AAHS, an IP3R agonist) significantly impeded the polymerisation of Derlin-1 and VCP (figure 5A). This induction also triggered the activation of the BAX/Caspase-3 signalling pathway (figure 5B). Conversely, incubation with 1,2-Bis-(2-Aminophenoxy) Ethane-N,N,N,-Tetra Acetic Acid (BAPTA, a Ca²⁺ chelator) notably augmented the interaction between Derlin-1 and VCP (figure 5A). Taken together, these findings suggest that dysregulated Ca²⁺ signalling may disrupt the aggregation of the Derlin-1 complex.

Figure 5. HNF1-[beta] upregulates ERP44 expression and suppresses Ca 2+ -mediated podocyte apoptosis. (A) WB analysis of Derlin-1 and VCP following coimmunoprecipitation (co-IP) of Derlin-1 or an isotype-matched control IgG from identical sample lysates in the control, BAPTA and AAHS groups. IgG was used as the loading control. (B) Following the application of AAHS treatment to HPCs, WB analysis was conducted to detect the expression of relevant proteins. (C) Increased intracellular Ca 2+ induced by angiotensin II was significantly exacerbated by transfection with HNF1-[beta]-siRNA compared with that in the controls. (D) Compared with that in the control group, the phosphorylation of IP3R in the LN serum was notably inhibited by HNF1-[beta]-siRNA transfection. (E) Detection of relevant proteins by WB after cotransfection of p-CAG-HNF1-[beta] and si-ERP44 into HPCs. (F) Determination of the apoptotic cell death rate through flow cytometry (n=3). (G) Immunofluorescence analysis showing the expression levels of synaptopodin and desmin in podocytes. p<0.05 indicated statistical significance (*). The data are presented as the means+-SDs from a minimum of three independent experiments. AAHS, Adenophostin A hexasodium Salt; BAPTA, 1,2-Bis-(2-Aminophenoxy) Ethane-N,N,N,-Tetra Acetic Acid; Ca 2+ , calcium ions; ERP44, endoplasmic reticulum protein 44; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HNF1-[beta], hepatocyte nuclear factor 1-beta; HPC, human podocyte cell line; IgG, immunoglobulin G; IP3R, inositol trisphosphate receptors; LN, lupus nephritis; NC, negative control; PI, propidium iodide; siRNA, small interfering RNA; VCP, valosin-containing protein; WB, Western blot.

Angiotensin II triggers an increase in cytosolic Ca²⁺ through the activation of inositol trisphosphate receptors (IP3Rs) leading to the release of Ca²⁺ from the ER.²⁶ Intriguingly, we observed that suppressing HNF1-β effectively enhanced angiotensin II-induced Ca²⁺ release in podocytes (figure 5C). This finding suggested that HNF1-β may influence the aggregation of the Derlin-1 complex by modulating Ca²⁺ release. Furthermore, our observations indicate that compared with normal serum stimulation, N serum stimulation markedly increases the phosphorylation of IP3R in podocytes. Moreover, overexpression of HNF1-β partially reverses LN serum-induced IP3R phosphorylation while suppression of HNF1-β further enhances the effect of LN serum on podocytes (figure 5D and online supplemental figure S7). These findings suggest that HNF1-β may regulate ER Ca²⁺ release by modulating IP3R phosphorylation, thereby influencing the effect of LN serum on podocyte ER homeostasis and apoptotic processes.

ERP44 is an ER-resident protein crucial for protein folding and ER homeostasis.²⁷ By acting as a chaperone, ERP44 facilitates proper protein folding by managing disulfide bond formation within the ER. Its role in quality control ensures the correct assembly of proteins before they are trafficked to various cellular destinations.²⁸ Notably, the inhibition of IP3R by ERP44 crucially modulates intracellular Ca²⁺ release impacting cellular Ca²⁺ signalling and regulating ER Ca²⁺ levels.²⁹ In this study, the interaction between ERP44 and IP3R was confirmed using a reciprocal Co-IP assay and IF localisation techniques (online supplemental figure S2A, B). Moreover, the WB results demonstrated that the overexpression of ERP44 inhibited the phosphorylation of IP3R in podocytes (online supplemental figure S2C). Additionally, ERP44-siRNA or NC for ERP44 was transfected into podocytes overexpressing HNF1-β to investigate the role of ERP44 in maintaining podocyte ER homeostasis under the influence of HNF1-β. As expected, the overexpression of HNF1-β inhibited the phosphorylation of IP3R and the activation of the BAX/Caspase-3 signalling pathway induced by LN serum while silencing ERP44 significantly attenuated the function of HNF1-β (figure 5E and online supplemental figure S7). Both flow cytometry analysis of the apoptosis ratio and IF detection of podocyte markers provided supporting evidence for the aforementioned conclusions(figure 5F and G). These findings suggested that ERP44 is essential for HNF1-β-mediated inhibition of IP3R phosphorylation and maintenance of ER homeostasis in podocytes.

Furthermore, in HEK293 cells, elevated expression of HNF1-β corresponded to an increase in the quantity of ERP44 mRNA (online supplemental figure S3A, B). Sequence analysis predicted the ERP44 promoter to contain several transcription factor-binding sites for HNF1-β in the JASPAR database. Specific primers and luciferase vectors were designed to verify the binding of HNF1-β to the ERP44 promoter. The luciferase reporter assay results demonstrated that HNF1-β transcriptionally upregulated ERP44 promoter activity (online supplemental figure S3C). In HPCs, ChIP assays further confirmed the direct binding of HNF1-β to the ERP44 promoter (online supplemental figure S3D). These results suggest that HNF1-β transcriptionally activates ERP44 inhibiting IP3R phosphorylation and intracellular Ca2+release, thereby maintaining ER homeostasis in podocytes.

The absence of HNF1-β exacerbates nephritis-induced renal injury in lupus-prone mice

To assess the role of HNF1-β in the progression of LN-induced renal injury in vivo, we transfected AAV9 vectors to silence HNF1-β or NCs into the kidneys of MRL/lpr mice. At 16 weeks of age, MRL/lpr mice exhibit an early-to-mid stage of disease progression during which HNF1-β levels increase as a compensatory response. It is beneficial to target HNF1-β depletion at this point to confirm its compensatory role in the progression of LN. Consequently, 18 16-week-old MRL/lpr mice were selected for the investigation and divided into three groups at random: The blank control (MRL/lpr), MRL/lpr+AAV shNC and MRL/lpr+AAVsh-HNF1-β groups. Six C57BL/6 mice were used as the normal control group. According to the RT‒qPCR, WB and IHC analyses, the overexpression of HNF1-β, Derlin-1 and VCP in the kidneys that occurred as a result of LN-induced renal injury was reversed in the MRL/lpr+AAV-sh-HNF1-β mice (figure 6A–C, G and H and online supplemental figure S4A). Furthermore, the increase in ER stress concomitant with the activation of the BAX/Caspase-3 signalling pathway observed in MRL/lpr mice was further intensified in MRL/lpr+AAV-sh-HNF1-β mice (figure 6G). Histologically, compared with those of C57BL/6 mice, the kidneys of lupus-prone mice were noticeably larger in size and exhibited significant glomerular injury and collagen deposition and these nephritic changes were further exacerbated following HNF1-β depletion (figure 6H). According to the IF results compared with the AAV-sh-NC mice, the HNF1-β-depleted mice exhibited significantly lower expression of nephrin and greater expression of C1q (figure 6H). Wilms’ tumour-1 protein recognised as a critical podocyte marker was stained in renal tissue sections to quantify the number of podocytes. A decrease in the podocyte count in the kidney resulting from LN-induced renal injury was further reduced in MRL/lpr+AAV-sh-HNF1-β mice (figure 6H). Additionally, compared with C57BL/6 mice, MRL/lpr mice showed notable increases in anti-double-stranded DNA antibody (anti-dsDNA) IgG, serum CRE and urinary protein concentrations which further increased following treatment with AAVsh-HNF1-β (figure 6D, E, F). The collective findings strongly suggest that the depletion of HNF1-β accelerates nephritis-induced renal injury in lupus-prone mice indicating that HNF1-β plays a crucial compensatory protective role in the progression of LN.

Figure 6. Impact of HNF1-[beta] silencing on LN-induced renal injury in vivo. (A-C) Relative mRNA levels of HNF1-[beta], Derlin-1 and VCP in renal tissues were quantified using RT-qPCR. (D-F) Renal function was analysed by measuring the levels of serum anti-dsDNA, urinary protein and serum CRE in mice. (G) WB was performed to assess the expression levels of HNF1-[beta], Derlin-1, VCP, ER stress markers and apoptosis-related indicators in renal tissues. (H-L) Kidney size variations among groups were observed in the AVV experiment. Renal tissue sections from MRL/lpr and C57BL/6 mice (n=6 mice per group) were stained with HE, Picrosirius Red, PAS or IHC targeting HNF1-[beta]. Additionally, IF staining was conducted for synaptopodin, C1q and WT1 (the control represents the relative positive area). p<0.05 indicated statistical significance. The data are presented as the means+-SDs of at least three independent experiments. anti-dsDNA, anti-double-stranded DNA antibody; AVV, adeno-associated virus; CRE, creatinine; ER, endoplasmic reticulum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HNF1-[beta], hepatocyte nuclear factor 1-beta; IF, immunofluorescence; IgG, immunoglobulin G; IHC, immunohistochemistry; LN, lupus nephritis; mRNA, messenger RNA; NC, negative control; PAS, periodic acid-Schiff; RT-qPCR, quantitative real-time-PCR; VCP, valosin-containing protein; WB, Western blot; WT1, Wilms’ tumour-1.

Discussion

LN is caused primarily by immune complex deposition and complement activation.³⁰ This cascade involves tissue inflammation which leads to glomerulosclerosis. Abnormal adaptive and innate immune responses result in the release of inflammatory mediators such as interferon which exacerbates glomerular lesions.³¹ These intricate procedures occur primarily within the glomeruli and contribute to the variety of clinical, biochemical and histological features observed in renal disease. On the Bowman’s space side, the glomerular capillary wall is a structure made up of fenestrated endothelial cells, the glomerular basement membrane and podocytes.³² Podocytes, specialised and highly differentiated cells, form a lining along the exterior of the glomerular capillary which is composed of a central body and extended major processes. These processes intricately branch into foot processes separated by a slit diaphragm.³³ Urine generation is a crucial function of podocytes in which they effectively segregate proteins from the aqueous component of the blood.³⁴ The slit diaphragm, a unique cellular connection, is formed by podocyte-specific proteins such as nephrin and podocin. These proteins interact with the actin cytoskeleton which is an essential structure in podocytes that controls the formation and dynamics of foot processes.³⁵ Foot process effacement is typically triggered by molecular events that affect the integrity of the actin cytoskeleton followed by subsequent podocyte separation. This is a crucial event that contributes to the occurrence of severe proteinuria.³⁶ In SLE, self-reactive lymphocytes release cytokines that promote inflammation as well as antibodies that cross-react with podocyte antigens.³⁷ There is strong evidence that IgG isolated from patient with LN serum leads to podocyte damage and podocytes are a direct or indirect target of immune complex deposits in LNs.³⁸ Histological podocyte injury has been identified in all classes of LN. Foot process effacement is associated with severe proteinuria in both non-proliferative and proliferative types of LN.^{39 40} In proliferative forms of LN, the expression of mature podocyte markers such as synaptopodin and nephrin is decreased.⁴¹ Similarly, in a mouse LN model, podocyte marker expression is reduced at early disease stages implying that podocyte dysfunction could play a role in histological lesion formation.⁴² This modulation of podocyte marker expression occurs at both the protein and mRNA levels. Analyses of urinary sediment from active patients with LN revealed correlations between lupus activity and the levels of nephrin, podocin and synaptopodin mRNA.⁴³ In the present study, podocyte lesions were found in the renal tissue of patients with LN and lupus-prone mice and LN serum stimulation significantly decreased the expression of nephrin and synaptopodin in podocytes. All of these factors make podocyte injury a principal candidate for the pathogenesis of LN in our research.

Persistent and intense ER stress often induces the activation of apoptosis which is one of the important causes of podocyte injury in LN.⁴⁴ The ER is a vital organelle within cells and is often depicted as a series of membrane structures and tubules. It has essential functions, notably in protein synthesis, ensuring proper folding and modification of proteins.^{5 6} ERAD is a cellular process responsible for identifying and degrading misfolded or unwanted proteins within the ER. Its primary function lies in quality control, ensuring that only properly folded proteins proceed to their designated cellular locations while aberrant proteins are targeted for degradation. ERAD involves a series of coordinated steps in which misfolded proteins are recognised, retrotranslocated across the ER membrane, ubiquitinated and eventually degraded by the proteasome.⁴⁵ When ERAD malfunctions or is impaired, it leads to the accumulation of misfolded proteins within the ER. This protein buildup causes ER stress, disrupting cellular homeostasis and potentially triggering inflammatory responses and cell death pathways. ER stress and the consequent accumulation of misfolded proteins are linked to various diseases including autoimmune disorders and metabolic syndromes. Maintaining an efficient ERAD system is crucial for maintaining cellular health, ensuring proper protein quality control and preventing the onset of associated pathologies. The Derlin-1/VCP/VIMP complex constitutes a crucial cellular assembly involved in the process of ERAD. Derlin-1 acts as a transmembrane protein within the ER, working alongside VCP and VIMP. This complex plays a pivotal role in recognising, extracting and targeting misfolded or unwanted proteins within the ER for degradation. Derlin-1 functions as a recognition factor, identifying misfolded proteins and facilitating their retrotranslocation from the ER lumen into the cytosol. Once in the cytosol, VCP collaborates with VIMP to extract these proteins from the ER membrane and facilitate their ubiquitination, allowing them to be degraded by the proteasome. The absence or malfunctioning of the Derlin-1 complex disrupts ERAD efficiency leading to the accumulation of misfolded proteins in the ER. This accumulation triggers ER stress, perturbs cellular homeostasis and potentially induces cellular dysfunction or death. Dysregulation of this complex has been associated with various diseases. In autoimmune diseases such as SLE and rheumatoid arthritis impaired ER protein quality control due to dysfunction of the Derlin-1 complex may contribute to the generation of autoantigens.⁴⁶ The accumulation of misfolded proteins can lead to ER stress triggering immune responses and the production of autoantibodies against self-proteins. Furthermore, CKD often involves ER stress which is attributed to dysfunctional ER protein degradation mechanisms involving the Derlin-1 complex.¹² The buildup of misfolded proteins within kidney cells can contribute to renal cell damage, inflammation and fibrosis accelerating the progression of CKD. In this study, we also observed the important role of the Derlin-1 complex in maintaining the ER homeostasis of podocytes and knocking down the expression of Derlin-1 or VCP using siRNA significantly exacerbates lupus serum-induced podocyte injury. All of these findings emphasise its critical role in maintaining proper protein quality control within the ER and its impact on overall cellular health.

Ca²⁺ plays a significant role in modulating the assembly and stability of protein complexes within the cell, particularly within the ER.⁴⁷ Proper calcium signalling is crucial for maintaining the integrity and functionality of protein complexes essential for diverse cellular functions. However, excessive Ca²⁺ can disrupt the structural integrity and interactions among proteins leading to the breakdown of protein complexes crucial for cellular functions. For example, calpain establishes intricate complexes with cytoskeletal proteins, notably actin and tubulin which are fundamental for preserving cellular architecture and functionality. However, heightened Ca²⁺ influx can disrupt the binding of calpain to these cytoskeletal proteins, potentially leading to the disintegration or deformation of these complexes. This disturbance significantly undermines the stability and functionality of the cellular cytoskeleton. Within muscle cells, an optimal concentration of Ca²⁺ is imperative for the precise execution of muscle cell contraction. Nonetheless, an excess of calcium triggers the breakdown of calcium–protein complexes within the muscle impeding the contraction process. Additionally, elevated calcium levels might induce structural alterations in presynaptic complexes within neuronal synapses or modifications in protein interactions leading to the dissociation of these complexes. Notably, within the ER, perturbations in calcium levels can impact the stability of complexes involved in protein folding, quality control mechanisms such as ERAD and protein translocation processes. Disassembly of these complexes can compromise their functionality, potentially leading to protein misfolding, aggregation or impaired cellular trafficking. These disruptions in protein complex stability can have detrimental effects on essential cellular processes reliant on these complexes impacting cellular homeostasis and function.⁴⁸ The ER is a potential intracellular Ca²⁺ source and IP3R, a Ca²⁺ channel located primarily in this region may release Ca²⁺ into the cytoplasm in response to stress-related stimuli. IP3 receptors have been shown to modulate a variety of different processes in distinct tissues and play important roles in mitochondrial bioenergetics and the modulation of apoptotic processes.⁴⁹ ERP44, an ER resident protein, serves as a crucial regulator of protein folding and ER calcium homeostasis. It acts as a molecular chaperone, facilitating proper protein folding and assembly within the ER.²⁷ Notably, ERP44 significantly inhibited the functionality of IP3Rs and ER Ca²⁺ release dynamics. Through direct interaction with IP3R, ERP44 modulates IP3R stability and activity, impacting its ability to regulate intracellular Ca²⁺ release from ER stores. This interaction fine-tunes Ca²⁺ signalling by governing the opening and closing of IP3R channels, thereby regulating cellular processes reliant on calcium signalling. In the present study, pronounced ER Ca²⁺ release significantly disrupted the aggregation of Derlin-1 complex constituents in podocytes indicating the crucial role of sustained Ca²⁺ levels in maintaining the structural integrity of Derlin-1 complexes and maintaining the homeostasis of the ER. Interestingly, blocking HNF-1 not only enhances angiotensin 2-induced ER Ca²⁺ release but also interferes with the aggregation of the Derlin-1 complex. This observation suggested that HNF1-β might help maintain the aggregation and stability of the Derlin-1 complex by inhibiting ER Ca²⁺ release.

The HNF1 family comprises two members: HNF1a and HNF1-β. The DNA-binding domain of these genes was identified to bind to the palindromic consensus sequence GTTAATNATTANC. At the N-terminus, a dimerisation domain allows HNF1a and HNF1-β to form homodimers or heterodimers.⁵⁰ The HNF1a and HNF-1β genes produce three isoforms that have distinct tissue-specific functions. Initially discovered as a liver-specific transcription factor, HNF1-β was later found to be expressed in a diverse range of tissues and organs, notably including the kidney where it fulfils crucial functions. HNF1-β binding motifs have been identified across multiple gene families and do not appear to be exclusive to the liver. Numerous genes, both hepatic and non-hepatic, include HNF1-β binding motifs in their promoter and enhancer regions. This finding demonstrates the presence of multiple transcriptional regulatory networks involving HNF1-β that extend beyond liver development and function. Importantly, HNF1-β governs the development of several tissues including the embryo, pancreas, kidney and intestines through intricate auto and cross-regulatory circuits. Abnormalities in HNF1-β function are associated with congenital anomalies of the kidney and urinary tract leading to structural defects in the kidneys or urinary tract during fetal development. These anomalies might include renal cysts, hypoplasia or multicystic dysplastic kidneys, affecting renal function and predisposing individuals to CKD. Dysfunction or mutation of HNF1-β can manifest as a spectrum of conditions affecting glucose metabolism and kidney development highlighting its significance in maintaining organ homeostasis and development. Recently, the significance of HNF1 in apoptosis-related research has been highlighted as it extends the scope of its action beyond the developmental roles of particular organs. Wobser et al⁵¹ discovered that suppressing HNF-1 in rat insulinoma cells results in mitochondrial malfunction, cell death and enhanced ceramide sensitivity. Kataoka et al⁵² revealed that ING1 inhibits HNF-1 transcription through direct DNA binding and is involved in the control of a variety of events ranging from the cell cycle and cellular senescence to apoptosis. Additionally, the reduction in HNF-1β expression induced by RNA interference induced apoptotic cell death in ovarian clear cell carcinoma cells.⁵³ These studies led us to speculate on the association between the function of HNF1-β and cellular apoptosis-related podocyte injury in the progression of LN.

In the present study, a significant decrease in HNF1-β protein expression within the glomeruli of patients with LN was evident compared with that in normal kidney tissues. Specifically, at 16 weeks, MRL/lpr mice exhibited elevated levels of HNF1-β in kidney tissues compared with those in C57BL/6 mice. However, a subsequent decrease in HNF1-β levels within the kidneys of MRL/lpr mice was observed by the 28th week. As a protective protein for maintaining normal cellular function, we speculate that the early increase in HNF1-β expression in the kidneys of animal models is a compensatory increase shifting toward a depletive decrease during the decompensation phase. Additionally, the present study revealed the active participation of HNF1-β in the transcriptional activation of Derlin-1 and the expression of VCP. Concurrently, HNF1-β can also transcribe ERP44 mRNA while inhibiting IP3R phosphorylation-mediated Ca²⁺ release in the ER. This discovery not only underscores the regulatory role of HNF1-β in the expression of pivotal proteins within the Derlin-1 complex but also signifies its impact on the polymerisation of these key proteins through the regulation of Ca²⁺ release (figure 7). This dual-signal regulation is undoubtedly an efficient and energy-conserving biological behaviour exhibited by transcription factors. These findings may lead to the use of an alternative approach to further explore the functional intricacies of transcription factors.

Figure 7. The role and molecular mechanism of HNF1-[beta] in LN-induced renal injury. ERP44, endoplasmic reticulum protein 44; HNF1-[beta], hepatocyte nuclear factor 1-beta; IP3R, inositol trisphosphate receptors; LN, lupus nephritis; VCP, valosin-containing protein; VIMP, VCP-interacting membrane selenoprotein.

Although the role of HNF1-β in immune cell function has not been determined, our study confirmed its functionality in immune cells through significant increases in spleen volume and serum anti-dsDNA IgG levels in mice treated with AAV sh-HNF1-β. This finding suggested that, in addition to its direct protective effects on podocytes, HNF1-β may also be involved in suppressing immune cell-mediated inflammatory responses. There are several limitations in this study. Primarily, due to constraints in the number and variety of human samples, the gene expression level of HNF1-β in the kidney tissues of patients with LN was not measurable. The currently available clinicopathological parameters cannot be correlated with HNF1-β expression which is pivotal for identifying HNF1-β as a prospective candidate for early LN diagnosis and as a novel therapeutic target. Second, our observations were restricted to mouse kidney tissues at 16 and 28 weeks which does not provide a comprehensive depiction of the role of HNF1-β in the processes involved in LN-induced renal injury. Additionally, we did not overexpress HNF1-β in MRL/lpr mice at the 28 week mark, thus precluding our ability to definitively determine whether an elevated level of HNF1-β in vivo could potentially delay LN-induced renal injury in these mice.

Conclusions

This study elucidates the regulatory mechanisms of HNF1-β in LN highlighting its influence on the Derlin-1/VCP/VIMP complex, ER stress and podocyte apoptosis. These findings lead a novel perspective on the regulatory mechanism of HNF1-β and provide a foundation for future research into early LN diagnosis and treatment.

We would like to express our deepest gratitude to all the patients and volunteers who participated in this study. Your willingness to contribute to medical research and to help advance our understanding of this disease is truly commendable. Additionally, we acknowledge with sorrow and respect the animals that sacrificed their lives for the purposes of this research and we are committed to ensuring that their contributions are used to further scientific knowledge and improve human health. Furthermore, we would like to thank all the editors and reviewers who have taken the time to critically evaluate our manuscript and provide insightful and constructive feedback. Your comments and suggestions have been invaluable in refining our work and improving the quality of this paper.

Data availability statement

Data are available upon reasonable request.

Ethics statements

Patient consent for publication

Not applicable.

Ethics approval

This study involves human participants and was approved by Ethics Committee of Guizhou Medical University, 2022 No. 44. Participants gave informed consent to participate in the study before taking part.

Footnote

H-mZ, JY and Y-yR contributed equally.

Contributors FZ is guarantor. FZ and BG conceptualised the project and design of the research; HZ, JY and YR carried out the experiments; YX, XA, PC and YL participated in part of the experiment; HZ and MS contributed to data collection and analysis; JL, ML and LX collected human tissue and blood samples; HZ wrote the manuscript; FZ and BG revised the manuscript, provided grant support and supervised the study. All authors read and approved the submitted manuscript.

Funding This study was supported by the National Natural Science Foundation of China (82360147 and 82460148), the Science and Technology Foundation of Guizhou Provincial Health Commission (gzwkj2023-209), the National Natural Science Foundation of China’s (NSFC) Cultivation Project (gyfynsfc(2022)-53) and the Natural Science Foundation of Guizhou Province (Grant numbers QianKeHeJiChu-ZK(2022) General 409 and QianKeHeJiChu-ZK(2022) General 378).

Competing interests None declared.

Patient and public involvement Patients and/or the public were not involved in the design, or conduct, or reporting, or dissemination plans of this research.

Provenance and peer review Not commissioned; externally peer reviewed.

Supplemental material This content has been supplied by the author(s). It has not been vetted by BMJ Publishing Group Limited (BMJ) and may not have been peer-reviewed. Any opinions or recommendations discussed are solely those of the author(s) and are not endorsed by BMJ. BMJ disclaims all liability and responsibility arising from any reliance placed on the content. Where the content includes any translated material, BMJ does not warrant the accuracy and reliability of the translations (including but not limited to local regulations, clinical guidelines, terminology, drug names and drug dosages), and is not responsible for any error and/or omissions arising from translation and adaptation or otherwise.

References

¹ Masahiro N, Mineto O, Yusuke T, et al. Distinct transcriptome architectures underlying lupus establishment and exacerbation. Cell 2022; 185: 3375–89.

² Ye B, Chen B, Guo C, et al. C5a-C5aR1 axis controls mitochondrial fission to promote podocyte injury in lupus nephritis. Mol Ther 2024; 32: 1540–60. doi:10.1016/j.ymthe.2024.03.003

³ Zhao X-Y, Li S-S, He Y-X, et al. SGLT2 inhibitors alleviated podocyte damage in lupus nephritis by decreasing inflammation and enhancing autophagy. Ann Rheum Dis 2023; 82: 1328–40. doi:10.1136/ard-2023-224242

⁴ Irena K, Katerina TT, Sonja T, et al. Nephrinuria and podocytopathies. Adv Clin Chem 2022; 108: 1–36. doi:10.1016/bs.acc.2021.08.001

⁵ Gao Y, Zhang H, Tian X. Integrated analysis of TCGA data identifies endoplasmic reticulum stress-related lncRNA signature in stomach adenocarcinoma. Oncologie (Paris) 2024; 26: 221–37. doi:10.1515/oncologie-2023-0394

⁶ Zhang G, Wang N, Ma S, et al. SLC25 family with energy metabolism and immunity in malignant tumors. Oncol (Paris) 2024; 26: 65–77. doi:10.1515/oncologie-2023-0280

⁷ Komeili-Movahhed T, Heidari F, Moslehi A. Chlorogenic acid alleviated testicular inflammation and apoptosis in tunicamycin induced endoplasmic reticulum stress. Physiol Int 2023; 110: 19–33. doi:10.1556/2060.2023.00132

⁸ Yoshida S, Wei X, Zhang G, et al. Endoplasmic reticulum-associated degradation is required for nephrin maturation and kidney glomerular filtration function. J Clin Invest 2021; 131: e143988. doi:10.1172/JCI143988

⁹ Do HA, Baek KH. Cellular functions regulated by deubiquitinating enzymes in neurodegenerative diseases. Ageing Res Rev 2021; 69: 101367. doi:10.1016/j.arr.2021.101367

¹⁰ Shrestha N, Torres M, Zhang J, et al. Integration of ER protein quality control mechanisms defines β cell function and ER architecture. J Clin Invest 2023; 133: e163584. doi:10.1172/JCI163584

¹¹ Song W-M, Elmas A, Farias R, et al. Multiscale protein networks systematically identify aberrant protein interactions and oncogenic regulators in seven cancer types. J Hematol Oncol 2023; 16: 120. doi:10.1186/s13045-023-01517-2

¹² Zhang F, Zhou X, Zou H, et al. SAA1 is transcriptionally activated by STAT3 and accelerates renal interstitial fibrosis by inducing endoplasmic reticulum stress. Exp Cell Res 2021; 408: 112856. doi:10.1016/j.yexcr.2021.112856

¹³ Hou X, Wei H, Rajagopalan C, et al. Dissection of the Role of VIMP in Endoplasmic Reticulum-Associated Degradation of CFTRΔF508. Sci Rep 2018; 8: 4764. doi:10.1038/s41598-018-23284-8

¹⁴ Gao G, Zhu C, Liu E, et al. Reticulon and CLIMP-63 regulate nanodomain organization of peripheral ER tubules. PLoS Biol 2019; 17: e3000355. doi:10.1371/journal.pbio.3000355

¹⁵ Sugiyama T, Murao N, Kadowaki H, et al. Chemical chaperones ameliorate neurodegenerative disorders in Derlin-1-deficient mice via improvement of cholesterol biosynthesis. Sci Rep 2022; 12: 21840. doi:10.1038/s41598-022-26370-0

¹⁶ Kelli G, Martine S, Ludovica R, et al. HNF1B Alters an Evolutionarily Conserved Nephrogenic Program of Target Genes. J Am Soc Nephrol 2023; 34: 412–32.

¹⁷ Chandra S, Srinivasan S, Batra J. Hepatocyte nuclear factor 1 beta: A perspective in cancer. Cancer Med 2021; 10: 1791–804. doi:10.1002/cam4.3676

¹⁸ Ogata K, Shimamura Y, Hamada K, et al. Upregulation of HNF-1β during experimental acute kidney injury plays a crucial role in renal tubule regeneration. Am J Physiol Renal Physiol 2012; 303: F689–99. doi:10.1152/ajprenal.00086.2012

¹⁹ Chan SC, Zhang Y, Shao A, et al. Mechanism of Fibrosis in HNF1B-Related Autosomal Dominant Tubulointerstitial Kidney Disease. J Am Soc Nephrol 2018; 29: 2493–509. doi:10.1681/ASN.2018040437

²⁰ Qi Y-Y, Zhou X-J, Cheng F-J, et al. Increased autophagy is cytoprotective against podocyte injury induced by antibody and interferon-α in lupus nephritis. Ann Rheum Dis 2018; 77: 1799–809. doi:10.1136/annrheumdis-2018-213028

²¹ Baechler BL, Bloemberg D, Quadrilatero J. Mitophagy regulates mitochondrial network signaling, oxidative stress, and apoptosis during myoblast differentiation. Autophagy 2019; 15: 1606–19. doi:10.1080/15548627.2019.1591672

²² Raina R, Chakraborty R, Sethi SK, et al. Diagnosis and Management of Renal Cystic Disease of the Newborn: Core Curriculum 2021. Am J Kidney Dis 2021; 78: 125–41. doi:10.1053/j.ajkd.2020.10.021

²³ Li XY, Tao SS, Xu ZQ, et al. SMURF1 activates the cGAS/STING/IFN-1 signal axis by mediating YY1 ubiquitination to accelerate the progression of lupus nephritis. Autoimmunity 2023; 56: 2281235. doi:10.1080/08916934.2023.2281235

²⁴ Ye Y, Shibata Y, Kikkert M, et al. Recruitment of the p97 ATPase and ubiquitin ligases to the site of retrotranslocation at the endoplasmic reticulum membrane. Proc Natl Acad Sci USA 2005; 102: 14132–8. doi:10.1073/pnas.0505006102

²⁵ Yin C, Lyu Q, Dong Z, et al. Well-defined alginate oligosaccharides ameliorate joint pain and inflammation in a mouse model of gouty arthritis. Theranostics 2024; 14: 3082–103. doi:10.7150/thno.95611

²⁶ Espitia-Corredor JA, Boza P, Espinoza-Pérez C, et al. Angiotensin II Triggers NLRP3 Inflammasome Activation by a Ca²⁺ Signaling-Dependent Pathway in Rat Cardiac Fibroblast Ang-II by a Ca²⁺-Dependent Mechanism Triggers NLRP3 Inflammasome in CF. Inflammation 2022; 45: 2498–512. doi:10.1007/s10753-022-01707-z

²⁷ Law ME, Yaaghubi E, Ghilardi AF, et al. Inhibitors of ERp44, PDIA1, and AGR2 induce disulfide-mediated oligomerization of Death Receptors 4 and 5 and cancer cell death. Cancer Lett 2022; 534: 215604. doi:10.1016/j.canlet.2022.215604

²⁸ Hisatsune C, Ebisui E, Usui M, et al. ERp44 Exerts Redox-Dependent Control of Blood Pressure at the ER. Mol Cell 2015; 58: 1015–27. doi:10.1016/j.molcel.2015.04.008

²⁹ Higo T, Hattori M, Nakamura T, et al. Subtype-Specific and ER Lumenal Environment-Dependent Regulation of Inositol 1,4,5-Trisphosphate Receptor Type 1 by ERp44. Cell 2005; 120: 85–98. doi:10.1016/j.cell.2004.11.048

³⁰ Kern A, Barabás E, Balog A, et al. Characterization of the thrombin generation profile in systemic lupus erythematosus. Physiol Int 2017; 104: 35–41. doi:10.1556/2060.104.2017.1.5

³¹ Xipell M, Lledó GM, Egan AC, et al. From systemic lupus erythematosus to lupus nephritis: The evolving road to targeted therapies. Autoimmun Rev 2023; 22: 103404. doi:10.1016/j.autrev.2023.103404

³² Kriz W, Löwen J, Gröne H-J. The complex pathology of diabetic nephropathy in humans. Nephrol Dial Transplant 2023; 38: 2109–19. doi:10.1093/ndt/gfad052

³³ Smerkous D, Mauer M, Tøndel C, et al. Development of an automated estimation of foot process width using deep learning in kidney biopsies from patients with Fabry, minimal change, and diabetic kidney diseases. Kidney Int 2024; 105: 165–76. doi:10.1016/j.kint.2023.09.011

³⁴ Qi Y, Xu M, Lu H, et al. Hepatic Biotransformation of Renal Clearable Gold Nanoparticles for Noninvasive Detection of Liver Glutathione Level via Urinalysis. Angew Chem Int Ed Engl 2024; 63: e202409477. doi:10.1002/anie.202409477

³⁵ Lizotte F, Rousseau M, Denhez B, et al. Deletion of protein tyrosine phosphatase SHP-1 restores SUMOylation of podocin and reverses the progression of diabetic kidney disease. Kidney Int 2023; 104: 787–802. doi:10.1016/j.kint.2023.06.038

³⁶ Boi R, Bergwall L, Ebefors K, et al. Podocyte Geranylgeranyl Transferase Type-I Is Essential for Maintenance of the Glomerular Filtration Barrier. J Am Soc Nephrol 2023; 34: 641–55. doi:10.1681/ASN.0000000000000062

³⁷ Zhang Y, Morris R, Brown GJ, et al. Rare SH2B3 coding variants in lupus patients impair B cell tolerance and predispose to autoimmunity. J Exp Med 2024; 221: e20221080. doi:10.1084/jem.20221080

³⁸ Pan X, Chen S, Shen R, et al. HOXA11-OS participates in lupus nephritis by targeting miR-124-3p mediating Cyr61 to regulate podocyte autophagy. Mol Med 2022; 28: 138. doi:10.1186/s10020-022-00570-w

³⁹ Guo M, Xie X, Lin W, et al. Association of podocyte injury with clinical features and prognosis in patients with mesangial proliferative lupus nephritis. Lupus (Los Angel) 2023; 32: 231–8. doi:10.1177/09612033221141269

⁴⁰ Zheng L, Sinniah R, Hsu SI-H. In situ glomerular expression of activated NF-kappaB in human lupus nephritis and other non-proliferative proteinuric glomerulopathy. Virchows Arch 2006; 448: 172–83. doi:10.1007/s00428-005-0061-9

⁴¹ Nawata A, Hisano S, Shimajiri S, et al. Podocyte and endothelial cell injury lead to nephrotic syndrome in proliferative lupus nephritis. Histopathology 2018; 72: 1084–92. doi:10.1111/his.13454

⁴² Knapp J, Braunstein M, Berg SIT, et al. HSPB5 suppresses renal inflammation and protects lupus-prone NZB/W F1 mice from severe renal damage. Arthritis Res Ther 2022; 24: 267. doi:10.1186/s13075-022-02958-9

⁴³ Wang G, Lai FM-M, Tam L-S, et al. Messenger RNA expression of podocyte-associated molecules in urinary sediment of patients with lupus nephritis. J Rheumatol 2007; 34: 2358–64.

⁴⁴ Jin J, Zhao L, Zou W, et al. Activation of Cyclooxygenase-2 by ATF4 During Endoplasmic Reticulum Stress Regulates Kidney Podocyte Autophagy Induced by Lupus Nephritis. Cell Physiol Biochem 2018; 48: 753–64. doi:10.1159/000491904

⁴⁵ Guan L, Ge R, Ma S. Newsights of endoplasmic reticulum in hypoxia. Biomed Pharmacother 2024; 175: 116812. doi:10.1016/j.biopha.2024.116812

⁴⁶ Cai Y, Xu K, Aihaiti Y, et al. Derlin-1, as a Potential Early Predictive Biomarker for Nonresponse to Infliximab Treatment in Rheumatoid Arthritis, Is Related to Autophagy. Front Immunol 2022; 12: 795912. doi:10.3389/fimmu.2021.795912

⁴⁷ Nair-Gill E, Bonora M, Zhong X, et al. Calcium flux control by Pacs1-Wdr37 promotes lymphocyte quiescence and lymphoproliferative diseases. EMBO J 2021; 40: e104888. doi:10.15252/embj.2020104888

⁴⁸ Luganini A, Serra V, Scarpellino G, et al. The US21 viroporin of human cytomegalovirus stimulates cell migration and adhesion. MBio 2023; 14: e0074923. doi:10.1128/mbio.00749-23

⁴⁹ Verma A, Pittala S, Alhozeel B, et al. The role of the mitochondrial protein VDAC1 in inflammatory bowel disease: a potential therapeutic target. Mol Ther 2022; 30: 726–44. doi:10.1016/j.ymthe.2021.06.024

⁵⁰ Bantounas I, Rooney KM, Lopes FM, et al. Human pluripotent stem cell-derived kidney organoids reveal tubular epithelial pathobiology of heterozygous HNF1B-associated dysplastic kidney malformations. Stem Cell Reports 2024; 19: 859–76: S2213-6711(24)00117-6. doi:10.1016/j.stemcr.2024.04.011

⁵¹ Wobser H, Düssmann H, Kögel D, et al. Dominant-negative suppression of HNF-1 alpha results in mitochondrial dysfunction, INS-1 cell apoptosis, and increased sensitivity to ceramide-, but not to high glucose-induced cell death. J Biol Chem 2002; 277: 6413–21. doi:10.1074/jbc.M108390200

⁵² Kataoka H, Bonnefin P, Vieyra D, et al. ING1 represses transcription by direct DNA binding and through effects on p53. Cancer Res 2003; 63: 5785–92.

⁵³ Tsuchiya A, Sakamoto M, Yasuda J, et al. Expression profiling in ovarian clear cell carcinoma: identification of hepatocyte nuclear factor-1 beta as a molecular marker and a possible molecular target for therapy of ovarian clear cell carcinoma. Am J Pathol 2003; 163: 2503–12. doi:10.1016/s0002-9440(10)63605-x