1. Introduction
The systematics, biogeography, and ecology of freshwater fish have undergone a series of updates, particularly with regard to cyprinids in Europe [1,2,3]. Information on geographical distribution plays a central role in understanding biodiversity patterns and providing a solid basis for proper management and conservation policies when accurate mapping processes are carried out [4,5,6]. However, the definition of distribution ranges could be difficult, especially for species belonging to the same genus, which often share portions of their distribution areas, especially in the edges of their distribution ranges. In addition, human-induced faunal translocations can lead to situations that could be very difficult to interpret. The improvement in knowledge about geographical distribution could therefore bring new opportunities and perspectives for the conservation and protection status of many species, but also new challenges [7], especially for organisms of community interest (sensu Habitat Directive 92/43/EEC), that require careful conservation measures. This is the case of the genus Telestes Bonaparte, 1837, which includes primary freshwater fishes inhabiting moderately cold waters of riverine ecosystems with clear and moderate-to-fast-flowing water [8,9]. The genus comprises 15 species distributed mainly in Mediterranean rivers [8,10,11,12,13], but, despite their wide geographical distribution and relatively high local population densities, most aspects of their biology are unknown [14] and the distribution areas are not always clear for each species. Among them, the western vairone Telestes souffia (Risso, 1827) is considered to be relatively widespread despite the lack of information about it [6,10,15]. T. souffia inhabits rivers belonging to the Mediterranean drainages (from the Aude to the Var drainages in France and the Isonzo/Soča drainage in Slovenia and Italy), the Rhine drainages (in Germany and Switzerland), and the Black Sea drainages (in the upper reaches of the Danube drainage from Germany downstream to Romania) [8,16] (Figure 1a).
In Italy, T. souffia is considered a native species only in the Isonzo (Soča in Slovenian) River Basin (Northeastern Italy), while its presence in the Roja Stream Basin (Northwestern Italy) is doubtful, as only hybrids between T. souffia and the Italian riffle dace Telestes muticellus (Bonaparte, 1837) have been observed [8,17]. T. muticellus is widespread in Italy (from the northern areas to Campania and Molise regions) and southern Switzerland (Figure 1a) and is considered endemic to the Italian peninsula [17,18].
T. muticellus is listed as ‘Last Concerned’ in the Red list of Italian Vertebrates, but information on T. souffia is still lacking and the species is classified as ‘Data Deficient’ [19]. T. souffia is also listed in Appendix III of the Bern Convention on the Conservation of European Wildlife and Natural Habitats and Annex II of the European Habitat Directive 92/43/EEC on the Conservation of Natural Habitats and Wild Fauna and Flora. As T. souffia experienced a remarkable decline in its range in the 20th century [9], up-to-date information is needed as it is crucial for the implementation of appropriate conservation measures [6].
In this context, it was deemed of interest to investigate the occurrence of Telestes sp. in the Friuli Venezia Giulia riverine network, where the distribution areas of T. souffia and T. muticellus partially overlap (Figure 1a,b). Our aims were (i) to investigate the occurrence of Telestes sp. in watercourses where it was previously reported, (ii) to perform the biometric analyses and meristic characterization of the observed individuals in populations in order to verify the best trait for the rapid identification of Telestes species in the field, and finally (iii) to genetically characterize the collected specimens.
2. Materials and Methods
2.1. Study Area
The hydrological network of the Friuli Venezia Giulia region is highly diversified and includes many riverine types, such as torrential streams, foothill watercourses, alluvial resurgence watercourses, and lowland rivers [20,21,22] (Figure 1b).
The study for meristic analysis was carried out at 9 sampling sites, which were selected considering previous data on the distribution and density of Telestes sp. [23,24]. Information on the occurrence of Telestes sp. was also obtained from datasets of the Ecological Status Assessment Program in the context of the Friuli Venezia Giulia Regional Water Protection Plan (period 2009–2017). Sampling sites are reported in Figure 1b. Sites 1, 2, 3, and 4 belong to the Isonzo River Basin, where Telestes sp. was formerly considered native in Friuli Venezia Giulia [17]. Sites 5 and 6 are located in the lowland basin of the Grado and Marano Lagoon, while site 7 is placed in the Livenza River Basin, close to the resurgence area between the low and high plains of Friuli Venezia Giulia. Finally, sites 8 and 9 are located in the Tagliamento River Basin, in the central portion of the region, within the foothill/high plain zone.
In order to characterize each site, values of the main chemical-physical features were measured with field probes during the sampling activities, while information regarding the main bottom substrates and main mesohabitats were also recorded. Information regarding the watercourse hydro-morphological characteristics and values of chemico-physical parameters for the investigated watercourses are reported in Table 1.
2.2. Fish Samplings and Biometric and Meristic Analyses
All activities described in the present study were performed according to European (Directive 2010/63/EU), Italian (D. Lgs. 26/14), and Regional laws and were approved by the Regional Authority for the Safeguard of the Fish Heritage of Friuli Venezia Giulia, dealing with procedures for the protection of animals used for scientific purposes. Fish samplings were carried out during spring and autumn 2022 using two backpack electrofishers (IG200/2 and ELT62 II 135 GI manufactured by Hans–Grassl GmbH, Schönau am Königssee, Germania). The analyses described herein required the sacrifice of the specimens, which were performed only for well-structured populations and when high densities of the target species were observed. In these conditions, a statistically significant number of specimens (n = 20, where possible) were seasonally captured (during spring and autumn) and brought to the laboratory for further analysis of the biometric and meristic features. The number of sacrificed specimens was limited in some watercourses, especially when they were heavily affected by the drought periods which occurred during summer 2022. In these cases, autumnal sampling activities were not performed.
All kept specimens were sacrificed via tricaine methane sulfonate MS-222 [25], placed in frozen bags, and immediately brought to the laboratory where they were frozen (−20 °C) until further analyses. All specimens were photographed to obtain information about the total length (TL, cm). These data were taken using the ImageJ software, version 1.54b [26].
For each specimen, meristic features were investigated using a stereomicroscope, considering the most significant characters for taxonomical identification, according to the literature [6,10,27,28,29,30,31]. Meristic characters included in the analysis and values reported in the literature are shown in Table 2. Finally, a dorsal fin clip sample was collected from each individual to perform genetic analysis.
2.3. Genetic Samplings
One hundred fish fins were collected seasonally (spring and autumn) for genetic analyses from a subset of 7 of the 9 sites, namely from the Brentella, Chiarò, Isonzo, Ledra, Miliana, Natisone and Tagliamento rivers. The samples were preserved in ethanol and kept refrigerated in the Genetics and Zoology Laboratory of the Department of Life Sciences (DSV) until the extraction of genomic DNA.
2.4. Genetic Analyses
DNA was extracted from each sample using the PCRBIO Rapid Extract PCR Kit (PCR Biosystems, London, UK) according to the manufacturer’s instructions. Two different molecular markers were analyzed, one of which belongs to mitochondrial DNA, cytochrome b (cyt b), and was used to determine the species affiliation of the maternal line of each sample. For individuals identified as belonging to T. souffia using cyt b, the analysis was continued with the amplification of a nuclear marker, RAG1, to determine whether the T. souffia identified using mitochondrial DNA were hybrids or not. The primers used are listed in Table 3.
The RAG1 primers published and originally used in López et al. [33] proved to be less successful in amplification, even when the RAG1R2 primer was used as the alternative recommended in the article. To overcome this problem, a genus-specific system on a polymorphic region of the RAG1 marker, called RAG1_CM, was developed to distinguish T. souffia from T. muticellus. PCRs were performed in 1× 2× PCRBIO HS Taq mix (PCRBIO), with 0.4 µM of each primer and 20–30 ng of DNA at a final volume of 15 µL. For cyt b, the thermal profile was an initial denaturation step at 95 °C for 2 min followed by 40 cycles: 95 °C for 15 s, 52 °C for 15 s, and 72 °C for 40 s, with a final extension step at 72 °C for 2 min. For RAG1_CM, the thermal profile was an initial denaturation step at 95 °C for 2 min followed by 35 cycles: 95 °C for 15 s, 59 °C for 40 s, and 72 °C for 1 min, with a final extension step at 72 °C for 2 min. All the PCR products were checked on an agarose gel 1.5% in TAE. Amplicons of the expected cyt b size were purified with Exonuclease I-Shrimp Alkaline Phosphatase (ExoI-rSAP) (New England BioLabs, Inc., Ipswich, MA, USA), while RAG 1 amplicons were purified with the Mag-Bind® TotalPure NGS Kit (Omega Biotek, Norcross, GA, USA) using 0.55× beads. The purified PCRs were then sent to an external Sanger sequencing center (Eurofins Genomics, Ebersberg, Germany). Once available, chromatograms were checked and, if necessary, corrected manually. A similarity search was then performed on the NCBI portal using the BlastN algorithm [34]
Phylogenetic trees were created by first aligning the sequences using MEGAX software [35] and using a MUSCLE alignment. Subsequently, the sequences were processed in NG Phylogeny [36] using Mr Bayes (100,000 generations, 4 chains, GTR model). The resulting tree was graphically processed using iTOL v.6.8.1 [37].
2.5. Statistical Analyses
Meristic characters were analyzed to investigate the differences among populations from each watercourse and to highlight the potentially useful features for discrimination between T. souffia and T. muticellus. The Kruskal–Wallis nonparametric test was used to highlight the significant differences for each meristic character among populations of different watercourses. The Conover–Iman test was used as a post hoc test [38,39]. Parameters that did not show significant differences were excluded from following analyses [40,41]. Non-metric multidimensional scaling (N-MDS) was used to visualize the differences among the populations groups. For this purpose, a resemblance matrix was obtained using the Bray–Curtis measure. The NMDS was considered good if stress < 0.2 [42,43]. To assess the differences between the groups (populations), the ANOSIM test was used [44]; the ANOSIM test was chosen after the application of the PERMDISP procedure [45], which was significant. Finally, the SIMPER test [40,41] was used to highlight the contribution of each meristic character to the observed variability.
All the analyses were performed using RStudio, version 2021.9.0.351 [46,47], and the ‘vegan’ package [48], considering a p-level equal to 0.5 for significance. Figures reported in the present work are produced with RStudio and Inkscape software (version 0.92).
3. Results
3.1. Biometric and Meristic Characterization
A total of 245 individuals were analyzed. The distribution of size classes for the specimens collected in watercourses monitored in spring and autumn are reported in Figure 2.
Populations observed in the Isonzo River, Chiarò Creek, Natisone River, Tagliamento River, and Ledra River were abundant and well structured, allowing for the sampling repetition in autumn. Autumnal fish samplings were not performed in the lowland ditches (Brentella, Cerclizza, and Miliana) nor in the Cividina Ditch to avoid additional stress for the populations. A summary of biometric and meristic characterization is reported in Table S1. The application of the non-parametric Kruskal–Wallis test allowed us to detect differences for all the analyzed variables (Kruskal–Wallis test: H > 30.9, d.f. = 8, p < 0.001), except for the number of scales above the lateral line (SALL) and the number of rays on caudal fin (PC) (Kruskal–Wallis test: H < 11.0, d.f. = 8, p > 0.2). Therefore, those meristic characters were excluded from the analyses described below. Values of the meristic characters observed in the collected specimens were compared with those reported in the literature for T. souffia and T. muticellus. On the basis of this analysis, it was possible to identify all the specimens collected in the Isonzo River as T. souffia, while those belonging to the other populations were all identified as T. muticellus (Table S1). The results of the Non-metric Multidimensional Scaling (NMDS) are reported in Figure 3. The NMDS converged on a two-dimensional solution with an acceptable stress level (non-metric fit r2 = 0.99; linear fit r2 = 0.96; stress = 0.108) [41]. Groups represented by specimens collected in the Tagliamento River and in the Isonzo River take place on the opposite sides of the graph, while other groups (=watercourses) overlap in the central section of the plot. The application of the ANOSIM allowed us to highlight that the differences among groups are significant (ANOSIM Rstatistic: 0.615, p < 0.001). The results of the SIMPER test are reported in Table 4.
Analyses allowed us to state that, for the considered watercourses, the most discriminant meristic character between T. souffia and T. muticellus is the number of lateral line scales (LL), which in T. souffia showed values significantly higher than T. muticellus (Figure 4).
3.2. Genetical Characterization
The mitochondrial analysis of the 100 randomly selected specimens collected in the target basins identified the fish from Brentella, Chiarò, Ledra, Miliana, Tagliamento, and most of the samples from the Natisone basins as T. muticellus. Samples from the Cerclizza Ditch were excluded from analysis, as this watercourse is situated very close to the Miliana Ditch, which was already selected as a representative for the same hydrological basin. Similarly, samples from the Cividina Ditch were not analyzed because it is an artificial watercourse within the Natisone–Isonzo system, and other watercourses from the same area had already been examined. Specimens collected from the Isonzo river along with a single specimen from the Natisone river were identified as T. souffia. To further confirm species identification, all individuals initially classified as T. souffia based on mitochondrial DNA were subsequently analyzed using the nuclear marker RAG1. This additional nuclear DNA analysis confirmed all specimens determined as T. souffia, verifying their classification at both the mitochondrial and nuclear levels.
3.3. Phylogenetic Tree
The cyt b sequences were aligned using Telestes croaticus as the outgroup (GenBan IDs ON866740, -41 and -42) and other sequences available at NCBI. For T. souffia, MG372548-51, MG372656 and MG372578-86 [8], AY509859-62 [15], HM560224 [49], and MG806721 [50] were aligned. The samples originated from Slovenia, Croatia, and France. For T. muticellus, MG372604-21 [8], MG806719 [50], and MK482049 [51] (direct submission to NCBI) were used, all sequences derived from the samples harvested in Italy (both Adriatic and Tyrrhenian areas).
Figure 5 presents the Bayesian tree based on the cytochrome b (cyt b) gene for all the samples from the Friuli Venezia Giulia watercourses collected in the present study, compared with reference sequences available from NCBI.
Notably, one sequence, listed in NCBI as T. muticellus (MG372614, haplotype MUT28 by Buj et al.) [8], unexpectedly clustered with T. souffia. However, this sequence exhibited distinct genetic divergence in the cyt b region from the other T. souffia specimens, raising the possibility of a hybridization event or the presence of an unrecognized subspecies. This genetic anomaly warrants further investigation to clarify its taxonomic status.
4. Discussion
The present study reports new data about the distribution of T. muticellus and T. souffia in an overlapping distribution area like the Friuli Venezia Giulia region, supported by both genetic and meristic analyses. The biometric analysis showed that the investigated populations were generally well structured, allowing it to be used to support the study.
Our results about the distribution of these species partially agree with the literature, as our data highlight the occurrence of T. muticellus in most of the analyzed watercourses, while T. souffia was detected only in the Isonzo River and in the Natisone River. On the Adriatic side of its distribution area, T. muticellus is reported as native from the Brenta River Basin to the Vomero River Basin [10] and endemic in the Po Plain district [17,52,53]. On the other hand, T. souffia was reported in the Isonzo River Basin [8] where it is considered as a native species [6,10,17]. Historically, Telestes sp. was once believed to be non-native in Friuli Venezia Giulia watercourses, where its presence was formerly not reported, except within the system represented by the rivers Isonzo, Torre, and Natisone [23,54], where the genus was considered native. Stoch et al. [23] highlighted that the sporadic presence of Telestes sp. in other basins of this region at the end of the 1990s (and especially the Tagliamento River Basin) can be the result of translocations due to anthropogenic activities. In fact, the presence of Telestes sp. showed an increasing trend in the Tagliamento River Basin and in the Friuli Venezia Giulia Lowland [24]. Marchetto et al. [55,56] reported and genetically analyzed a population of T. muticellus from the Tagliamento River, including it in a group of populations from the Po Plain district. It is likely possible that T. muticellus is expanding the eastern margin of its distribution area, and that anthropogenic translocations heavily affect the process, despite T. muticellus showing low dispersal abilities and human-induced faunal translocations, which are commonly considered as not relevant [53,55,57]. In fact, as observed for other fishes, species translocation from one river to another represents a common practice and one of the main sources for genetic introgression and the loss of endemic populations [58,59,60]. As our results did not highlight the presence of T. muticellus in the Isonzo River, the Natisone River seems to represent an overlapping watercourse, as both species were observed. It is worth reporting also that on the T. muticellus side, this study did not further investigate the possible presence of hybrids in specimens with T. muticellus mitochondrial DNA. However, no hybrids were detected in fish with T. souffia mitochondrial DNA by using the nuclear RAG1 markers, and further analyses are needed to clarify this point. In fact, Kottelat and Freyhof [10] report the Isonzo River Basin as an introgression area for T. souffia and T. muticellus, and hybrids of T. muticellus and T. souffia have been reported from the margins of their adjacent ranges [7,8,61,62].
Regarding the meristic analyses, values reported in the present study for T. souffia agree with those generally reported in the literature [6,10,28,29,30]; values for T. muticellus generally agree with those reported by Tortonese et al. [27] and by Gandolfi et al. [31], though some data ranges partially overlap (especially PP and PV). However, morphological variability can occur, as observed by Veličković et al. [6] for T. souffia populations in the Balkan area. The number of lateral line scales is a meristic character with pivotal importance for species identification and for the determination of different populations within species, as noted in many identification keys and related resources [63]. In this context, the variability observed in our samples for the T. muticellus range was expected, though our range overlapped with values reported in the literature. The taxonomy of the genus Telestes has not been resolved for a long time, and there was a possibility that several species might have been misidentified [6,10]. Our results indicate the number of lateral line scales (LL) as the most discriminant character, with the highest contribution to the observed variability, as highlighted by the SIMPER test. The genetic characterization fully supported the meristic analysis with 100% agreement in assigning the species to each specimen, allowing us to state that LL can be considered as a consistent and costless quick in-field tool for taxonomical determination that can also be used by non-expert workers.
5. Conclusions
The data presented herein have a pivotal importance for the implementation of appropriate conservation measures because the information on T. souffia results is incomplete, as the species is classified as ‘Data Deficient’ in the Italian Red list of Vertebrates [19], and it has experienced a remarkable decline in its range in the past century [9]. Proper and updated knowledge of fish geographical distribution is critical for biodiversity conservation, particularly for species of community interest that require precise protection measures. Biodiversity hotspots, such as the highly diversified hydrological networks in Northeastern Italy, demand special attention, especially when species like T. muticellus and T. souffia share their distribution areas. Moreover, our study can help to improve the knowledge about the current distribution status of the species investigated in one of their overlapping zones, represented by the Friuli Venezia Giulia region. To the best of our knowledge, no previous studies genetically characterized Telestes sp. while taking into account the Tagliamento River Basin and lowland area of the Friuli Venezia Giulia in order to improve the dataset of the distribution of the T. muticellus and T. souffia in the eastern portion of the Po Plain district. Conservation efforts should focus on these regions to ensure that the delicate balance of species diversity is maintained, especially considering human-induced changes to species’ distribution ranges.
Conceptualization, E.P. and P.G.G.; methodology, M.B., C.M. and E.P.; formal analysis, M.B. and C.M.; investigation and data curation, M.B. and C.M.; writing—original draft preparation, M.B.; writing—review and editing, M.B., C.M. and P.P.; supervision E.P., C.M., P.G.G. and A.P.; project administration, E.P. and P.G.G.; funding acquisition, E.P. and P.G.G. All authors have read and agreed to the published version of the manuscript.
All activities described in the present study were performed according to European (Directive 2010/63/EU), Italian (D. Lgs. 26/14), and Regional laws. Activities have been approved by the Regional Authority for the Safeguard of the Fish Heritage of Friuli Venezia Giulia, dealing with procedures for the protection of animals used for scientific purposes.
Data are contained within the article and
We would like to thank Davide Lesa who collaborated during the sampling operations and the meristic analysis, Andrea Aiello, who worked on some samples during his internship, although this project was not part of his master’s thesis.
The authors declare no conflicts of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 1. Distribution areas of T. souffia (yellow), T. muticellus (blue), and shared zones (green) (a); study area in the Friuli Venezia Giulia region and sampling sites analyzed for the presence of Telestes sp. In the present study (b), 1 = Isonzo River; 2 = Chiarò Creek; 3 = Natisone River; 4 = Cividina Ditch; 5 = Miliana Ditch; 6 = Cerclizza Ditch; 7 = Brentella Ditch; 8 = Ledra River; 9 = Tagliamento River. The yellow dots represent sites whose samples were used for genetic investigations.
Enlarge this image.Figure 2. Total length frequency distributions observed for Telestes sp. specimens in watercourses where sampling operations were performed.
Enlarge this image.Figure 3. Non-Metric Multi-Dimensional Scaling (N-MDS) obtained analyzing the meristic characters observed for Telestes sp. specimens monitored in the present study (LL = number of lateral line scales; SBLL = number of scales below the lateral line; PD = number of rays in dorsal fin; PC = number of rays in caudal fin; PP = number of rays in pectoral fin; PA = number of rays in anal fin; PV = number of rays in ventral fin).
Enlarge this image.Figure 4. Box-plot for the number of lateral line scales recorded at each sampling site for Telestes sp. specimens analyzed in the present study. Results of the comparisons performed via the Kruskal–Wallis non-parametric test and Conover-Iman test are reported.
Enlarge this image.Figure 5. cyt b rooted Bayesian tree. In red, the cluster of T. croaticus is used as an outgroup. In green, the cluster indicates the sequences of T. muticellus, and in black, the cluster of T. souffia. With an asterisk, a single sequence reported as T. muticellus is shown, with clustering in T. souffia. Bootstrap support is shown for each branch. GenBank IDs for all the sequences are provided in Table S2.
Values of the main chemico-physical water parameters and information regarding habitat composition and riverbed substrates observed in sites where Telestes sp. specimens were collected.
| Site | Watercourse | Coordinates | Temperature | pH | Dissolved Oxygen | Conductivity | PO43− | NO3− | NH4+ | Environmental | Main | Vegetation | ||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Longitude | Latitude | (°C) | (mg L−1) | (%) | (µS cm−1) | (mg L−1) | (mg L−1) | (mg L−1) | (Mesohabitat) | Substrates | Cover (%) | |||
| 1 | Isonzo River | 13.604039 | 45.948905 | 16.5 | 8 | 9.8 | 100.5 | 291.5 | 0.1 | 3.2 | 0.1 | Uniform flow areas (30%), pools (70%) | Cobbles and boulders 60%, coarse gravel and cobbles 30%, coarse and fine gravel 10% | Absent |
| 2 | Chiarò Creek | 13.459667 | 46.063598 | 14.9 | 7.6 | 9.3 | 91 | 488.5 | 0.1 | 3.3 | 0.1 | Uniform flow areas (30%), pools (70%), riffles (20%), glides (10%) | Cobbles and boulders 10%, coarse gravel and cobbles 60%, coarse and fine gravel 30% | Absent |
| 3 | Natisone River | 13.384925 | 46.037147 | 24.5 | 8.7 | 8.1 | 96 | 268 | 0.1 | 6.8 | 0.1 | Uniform flow areas (60%), pools (30%), riffles (10%), glides (10%) | Coarse gravel and cobbles 50%, coarse and fine gravel 40%, fine gravel 10% | Absent |
| 4 | Cividina Ditch | 13.258357 | 46.171388 | - | - | - | - | - | - | - | - | Uniform flow areas (100%) | Artificial (concrete) 100% | 60% |
| 5 | Miliana Ditch | 13.093943 | 45.872071 | 18.5 | 7.9 | 10.2 | 108 | 598 | 0.1 | 23.6 | 0 | Uniform flow areas (50%), pools (30%), riffles (10%), glides (20%) | Coarse and fine gravel 20%, sand and fine gravel 40%, mud 40% | 60% |
| 6 | Cerclizza Ditch | 13.081191 | 45.873725 | 18.6 | 8 | 10.7 | 105 | 595 | 0.1 | 19.5 | 0.1 | Uniform flow areas (50%), pools (30%), riffles (10%), glides (20%) | Cobbles and gravel 20%, coarse and fine gravel 30%, sand and fine gravel 20%, mud 30% | Absent |
| 7 | Brentella Ditch | 12.797391 | 45.993459 | 19 | 8.1 | 10.1 | 100 | 487 | 0 | 9.9 | 0.1 | Uniform flow areas (60%), pools (20%), riffles (20%) | Coarse and fine gravel 30%, sand and fine gravel 30%, mud 40% | 40% |
| 8 | Ledra River | 13.061988 | 46.199219 | 14.5 | 8.2 | 10.7 | 109 | 516.5 | 0.1 | 6.1 | 0.1 | Uniform flow areas (50%), pools (30%), riffles (20%) | Coarse gravel and cobbles 10%, coarse and fine gravel 50%, sand and fine gravel 10%, mud 20%, woody debris and roots 10% | 30% |
| 9 | Tagliamento River | 13.093955 | 46.280339 | 13.8 | 7.8 | 9.7 | 97.5 | 503.5 | 0.1 | 6.1 | 0.1 | Uniform flow areas (60%), pools (30%), riffles (10%) | Cobbles and boulders 30%, coarse gravel and cobbles 40%, coarse and fine gravel 20%, sand and fine gravel 10% | Absent |
Comparison between the main meristic characters reported in the literature for T. souffia and T. muticellus (LL = number of lateral line scales; SALL = number of scales above the lateral line; SBLL = number of scales below the lateral line; PD = number of rays in dorsal fin; PC = number of rays in caudal fin; PP = number of rays in pectoral fin; PV = number of rays in ventral fin; PA = number of rays in anal fin).
| Telestes souffia | Telestes muticellus | |||
|---|---|---|---|---|
| Kottelat and Freyhof [ | Veličković | Gandolfi | Tortonese | |
| LL | 50–57 + 2–3 | 50–53 + 2–3 | 45–51 | 45–53 |
| SALL | 8–9 | 8–10 | ||
| SBLL | 41/2–5 | 5 | 4–5 | 4–5 |
| PD | 7 | 7 | 10–12 | 8–10 |
| PC | 17–21 | 18–20 | 19–21 | |
| PP | 14–16 | |||
| PV | 10 | 9 | 8 | |
| PA | 11 | 11 | 10–12 | 8–10 |
Primers used for amplifications of mitochondrial and nuclear markers.
| Marker | Primer Name | Sequence (5′-3′) | Reference |
|---|---|---|---|
| cyt b | Glu-F | GAAGAACCACCGTTGTTATTCAA | Zardoya et al. [ |
| Thr-R | ACCTCCRATCTYCGGATTACA | ||
| RAG1 | RAG1F1 | CTGAGCTGCAGTCAGTACCATAAGATGT | López et al. [ |
| RAG1R1 | CTGAGTCCTTGTGAGCTTCCATRAAYTT | ||
| RAG1R2 | TGAGCCTCCATGAACTTCTGAAGRTAYTT | ||
| RAG1_CM | RAG1_CM_FW | TGGGAGATGTCAGCGAGAAG | This work |
| RAG1_CM_RV | ATCCAGAGTAGGCTGGGTCT |
Application of the SIMPER test for values of the meristic characters observed for Telestes sp.
| Meristic Characters | Code | Average | Contribution % | Cumulative Contribution % |
|---|---|---|---|---|
| Number of lateral line scales | LL | 1.37 | 44.54 | 44.54 |
| Number of rays in anal fin | PA | 0.62 | 20.37 | 64.91 |
| Number of rays in dorsal fin | PD | 0.37 | 12.07 | 76.98 |
| Number of rays in pectoral fin | PP | 0.35 | 11.31 | 88.28 |
| Number of rays in ventral fin | PV | 0.21 | 6.87 | 95.16 |
| Number of scales below the lateral line | SBLL | 0.15 | 4.85 | 100.00 |
Supplementary Materials
The following supporting information can be downloaded at
References
1. Costedoat, C.; Gilles, A. Quaternary pattern of freshwater fishes in Europe: Comparative phylogeography and conservation perspective. Open Conserv. Biol. J.; 2009; 3, pp. 36-48. [DOI: https://dx.doi.org/10.2174/1874839200903010036]
2. Schiavon, A.; Comoglio, C.; Candiotto, A.; Spairani, M.; Hölker, F.; Tarena, F.; Watz, J.; Nyqvist, D. Navigating the drought: Upstream migration of a small-sized Cypriniformes (Telestes muticellus) in response to drying in a partially intermittent mountain stream. Knowl. Manag. Aquat. Ecosyst.; 2024; 425, 6. [DOI: https://dx.doi.org/10.1051/kmae/2024003]
3. Miqueleiz, I.; Miranda, R.; Cancellario, T. European water frame directive ecoregions do not adequately represent freshwater fish biogeography. Ecol. Inform.; 2024; 81, 102629. [DOI: https://dx.doi.org/10.1016/j.ecoinf.2024.102629]
4. Wisz, M.S.; Hijmans, R.J.; Li, J.; Peterson, A.T.; Graham, C.H.; Guisan, A. NCEAS Predicting Species Distributions Working Group. Effects of sample size on the performance of species distribution models. Divers. Distrib.; 2008; 14, pp. 763-773. [DOI: https://dx.doi.org/10.1111/j.1472-4642.2008.00482.x]
5. Münzel, F.M.; Salzburger, W.; Sanetra, M.; Grabherr, B.; Meyer, A. Genetic structure of the vairone Telestes souffia in the eastern part of Lake Constance, central Europe. J. Fish Biol.; 2010; 77, pp. 1158-1164. [DOI: https://dx.doi.org/10.1111/j.1095-8649.2010.02767.x]
6. Veličković, T.Z.; Simić, V.M.; Šanda, R.; Radenković, M.D.; Milošković, A.M.; Radojković, N.M.; Marić, S.P. New Record of a Population of Telestes souffia (Risso, 1827) (Actinopterygii: Cyprinidae) in Serbia. Acta Zool. Bulg.; 2020; 72, pp. 13-20.
7. Gilles, A.; Costedoat, C.; Barascud, B.; Voisin, A.; Banarescu, P.; Bianco, P.G.; Economidis, P.S.; Marić, D.; Chappaz, R. Speciation pattern of Telestes souffia complex (Teleostei, Cyprinidae) in Europe using morphological and molecular markers. Zool. Scr.; 2010; 39, pp. 225-242. [DOI: https://dx.doi.org/10.1111/j.1463-6409.2010.00417.x]
8. Buj, I.; Marčić, Z.; Ćaleta, M.; Šanda, R.; Geiger, M.F.; Freyhof, J.; Machordom, A.; Vukić, J. Ancient connections among the European rivers and watersheds revealed from the evolutionary history of the genus Telestes (Actinopterygii; Cypriniformes). PLoS ONE; 2017; 12, e0187366. [DOI: https://dx.doi.org/10.1371/journal.pone.0187366]
9. Curtean-Bănăduc, A.; Didenko, A.; Guti, G.; Bănăduc, D. Telestes souffia (Risso, 1827) species conservation at the eastern limit of Range–Vişeu river basin, Romania. Appl. Ecol. Envirion. Res.; 2018; 16, pp. 291-303. [DOI: https://dx.doi.org/10.15666/aeer/1601_291303]
10. Kottelat, M.; Freyhof, J. Handbook of European Freshwater Fishes; Kottelat, Cornol, Freyhof: Berlin, Germany, 2007.
11. Marčić, Z.; Buj, I.; Duplić, A.; Ćaleta, M.; Mustafić, P.; Zanella, D.; Zupančič, P.; Mrakovčić, M. A new endemic cyprinid species from the Danube drainage. J. Fish Biol.; 2011; 79, pp. 418-430. [DOI: https://dx.doi.org/10.1111/j.1095-8649.2011.03038.x]
12. Bogutskaya, N.G.; Zupančič, P.; Bogut, I.; Naseka, A.M. Two new freshwater fish species of the genus Telestes (Actinopterygii, Cyprinidae) from karst poljes in Eastern Herzegovina and Dubrovnik littoral (Bosnia and Herzegovina and Croatia). ZooKeys; 2012; 180, pp. 53-80. [DOI: https://dx.doi.org/10.3897/zookeys.180.2127] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22539906]
13. Froese, R.; Pauly, D. “Species in Genus Telestes”, FishBase. World Wide Web Electronic Publication, January 2024 Version. Available online: http://www.fishbase.org (accessed on 2 November 2024).
14. Barbieri, R.; Stoumboudi, M.; Kalogianni, E.; Leonardos, I. First report on the spawning migration and early life development of a cyprinid species of the genus Telestes. J. Appl. Ichthyol.; 2020; 36, pp. 817-824. [DOI: https://dx.doi.org/10.1111/jai.14094]
15. Ketmaier, V.; Bianco, P.G.; Cobolli, M.; Krivokapic, M.; Caniglia, R.; De Matthaeis, E. Molecular phylogeny of two lineages of Leuciscinae cyprinids (Telestes and Scardinius) from the peri-Mediterranean area based on cytochrome b data. Mol. Phylogenet. Evol.; 2004; 32, pp. 1061-1071. [DOI: https://dx.doi.org/10.1016/j.ympev.2004.04.008] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/15288075]
16. Freyhof, J.; Kottelat, M. Telestes souffia. The IUCN Red List of Threatened Species 2008: e.T61397A12461824. Available online: https://www.iucnredlist.org/species/61397/137342065 (accessed on 19 August 2024).
17. Lorenzoni, M.; Borghesan, F.; Carosi, A.; Ciuffardi, L.; De Curtis, O.; Delmastro, G.B.; Di Tizio, L.; Franzoi, P.; Maio, G.; Mojetta, A. et al. Check–List Dell’ittiofauna Delle Acque Dolci Italiane. Version 3.0.5. AIIAD. 2019; Available online: http://www.aiiad.it/sito/images/docs/sistematica/Check%20list%20ittiofauna%20Italiana_GdL3.0_05032021.pdf (accessed on 20 August 2024).
18. Crivelli, A.J.; Bianco, P.G. Telestes muticellus. The IUCN Red List of Threatened Species 2006: e.T61389A12458554. Available online: https://www.iucnredlist.org/species/61389/137341872 (accessed on 19 August 2024).
19. Rondinini, C.; Battistoni, A.; Teofili, C. Lista Rossa IUCN dei Vertebrati Italiani 2022; Comitato Italiano IUCN e Ministero dell’Ambiente e della Sicurezza Energetica: Rome, Italy, 2022.
20. Mosetti, F. Quaderni, E.T.P. Sintesi Sull’idrologia del Friuli-Venezia Giulia; E.T.P.—Regione Friuli Venezia Giulia: Udine, Italy, 1983.
21. Pastorino, P.; Bertoli, M.; Squadrone, S.; Brizio, P.; Piazza, G.; Oss Noser, A.G.; Prearo, M.; Abete, M.C.; Pizzul, E. Detection of trace elements in freshwater macrobenthic invertebrates of different functional feeding guilds: A case study in Northeast Italy. J. Ecohydrol. Hydrobiol.; 2019; 19, pp. 428-440. [DOI: https://dx.doi.org/10.1016/j.ecohyd.2019.04.006]
22. Bertoli, M.; Piazza, G.; Pastorino, P.; Prearo, M.; Cozzoli, F.; Vignes, F.; Basset, A.; Pizzul, E. Macrobenthic invertebrate energy densities and ecological status in freshwater watercourses (Friuli Venezia Giulia, Northeast Italy). Aquat. Ecol.; 2021; 55, pp. 501-518. [DOI: https://dx.doi.org/10.1007/s10452-021-09840-x]
23. Stoch, F.; Paradisi, S.; Buda Dancevich, M. Carta Ittica del Friuli–Venezia Giulia; Regione Autonoma Friuli–Venezia Giulia, Arti Grafiche Friulane: Udine, Italy, 1992.
24. Pizzul, E.; Moro, A.; Battiston, F. Pesci e Acque Interne del Friuli–Venezia Giulia, Aggiornamento Parziale Alla Carta Ittica 1992; Ente Tutela Pesca del Friuli Venezia Giulia: Udine, Italy, 2006; Available online: www.entetutelapesca.it (accessed on 24 April 2023).
25. Topic Popovic, N.; Strunjak-Perovic, I.; Coz-Rakovac, R.; Barisic, J.; Jadan, M.; Persin Berakovic, A.; Sauerborn Klobucar, R.S. Tricaine methane-sulfonate (MS-222) application in fish anaesthesia. J. Appl. Ichthyol.; 2012; 28, pp. 553-564. [DOI: https://dx.doi.org/10.1111/j.1439-0426.2012.01950.x]
26. Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods; 2012; 9, pp. 671-675. [DOI: https://dx.doi.org/10.1038/nmeth.2089]
27. Tortonese, E. Fauna d’Italia. Osteichthyes (Pesci ossei); Calderini Ed.: Bologna, Italy, 1970.
28. Vuković, T.; Ivanović, B. Freswater Fishes of Jugoslavija; Zemaljski muzej BiH: Sarajevo, Bosnia, 1971; (In Bosnian)
29. Simonović, P. Freshwater Fish of Serbia; NNK Internacional, Zavod za Zaštitu Prirode Srbije, Biološki Fakultet: Beograd, Serbia, 2001; (In Bosnian)
30. Keith, P.; Allardi, J. Atlas of Freshwater Fishes of France (Atlas des Poissons d’eau Douce de France); Muséum National d’Histoire Naturelle: Paris, France, 2001; (In French)
31. Gandolfi, G.; Zerunian, S.; Torricelli, P.; Marconato, A. I Pesci Delle Acque Interne Italiane; Istituto Poligrafico e Zecca dello Stato—Libreria dello Stato: Roma, Italia, 1991.
32. Zardoya, R.; Doadrio, I. Phylogenetic relationships of Iberian cyprinids: Systematic and biogeographical implications. Proc. R. Soc. B Biol. Sci.; 1998; 265, pp. 1365-1372. [DOI: https://dx.doi.org/10.1098/rspb.1998.0443]
33. Lopez, J.A.; Chen, W.; Ortì, G. Esociform phylogeny. Copeia; 2004; 2004, pp. 449-464. [DOI: https://dx.doi.org/10.1643/CG-03-087R1]
34. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol.; 1990; 215, pp. 403-410. [DOI: https://dx.doi.org/10.1016/S0022-2836(05)80360-2]
35. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol. Biol. Evol.; 2021; 38, pp. 3022-3027. [DOI: https://dx.doi.org/10.1093/molbev/msab120] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33892491]
36. Lemoine, F.; Correia, D.; Lefort, V.; Doppelt-Azeroual, O.; Mareuil, F.; Cohen-Boulakia, S.; Gascuel, O. NGPhylogeny.fr: New generation phylogenetic services for nonspecialists. Nucleic Acids Res.; 2019; 47, pp. W260-W265. [DOI: https://dx.doi.org/10.1093/nar/gkz303]
37. Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res.; 2021; 49, pp. W293-W296. [DOI: https://dx.doi.org/10.1093/nar/gkab301] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33885785]
38. Conover, W.J.; Iman, R.L. On Multiple-Comparisons Procedures; Technical Report LA-7677-MS Los Alamos Scientific Laboratory: Los Alamos, NM, USA, 1979.
39. Conover, W.J. Practical Nonparametric Statistics; John Wiley & Sons: Hoboken, NJ, USA, 1999; Volume 350.
40. González-Castro, M.; Rosso, J.J.; Mabragaña, E.; Díaz de Astarloa, J.M. Surfing among species, populations and morphotypes: Inferring boundaries between two species of new world silversides (Atherinopsidae). Comptes Rendus Biol.; 2016; 339, pp. 10-23. [DOI: https://dx.doi.org/10.1016/j.crvi.2015.11.004]
41. Glon, M.G.; Thoma, R.F.; Daly, M.; Freudenstein, J.V. Lacunicambarus chimera: A new species of burrowing crayfish (Decapoda: Cambaridae) from Illinois, Indiana, Kentucky, and Tennessee. Zootaxa; 2019; 4544, pp. 451-478. [DOI: https://dx.doi.org/10.11646/zootaxa.4544.4.1]
42. McCune, B.; Grace, J.B.; Urban, D.L. Analysis of Ecological Communities; MjM Software Design: Gleneden Beach, OR, USA, 2002.
43. Fetzner, J.W.; Taylor, C.A. Two new species of freshwater crayfish of the genus Faxonius (Decapoda: Cambaridae) from the Ozark Highlands of Arkansas and Missouri. Zootaxa; 2018; 4399, pp. 491-520. [DOI: https://dx.doi.org/10.11646/zootaxa.4399.4.2]
44. Clarke, K.R. Non-parametric multivariate analyses of changes in community structure. Aust. J. Ecol.; 1993; 18, pp. 117-143. [DOI: https://dx.doi.org/10.1111/j.1442-9993.1993.tb00438.x]
45. Anderson, M.J. Distance-based tests for homogeneity of multivariate dispersions. Biometrics; 2006; 62, pp. 245-253. [DOI: https://dx.doi.org/10.1111/j.1541-0420.2005.00440.x]
46. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021; Available online: https://www.R-project.org/ (accessed on 1 September 2024).
47. RStudio Team. RStudio: Integrated Development Environment for R; R Studio, PBC: Boston, MA, USA, 2021; Available online: http://www.rstudio.com/ (accessed on 1 September 2024).
48. Oksanen, J.; Blanchet, F.G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P.R.; O’Hara, R.B.; Simpson, G.L.; Solymos, P. et al. Vegan: Community Ecology Package. R Package Version 2.5-2. 2018; Available online: http://CRAN.Rproject.org/package=vegan (accessed on 11 July 2024).
49. Perea, S.; Bohme, M.; Zupančič, P.; Freyhof, J.; Šanda, R.; Ozuluğ, M.; Abdoli, A.; Doadrio, I. Phylogenetic relationships and biogeographical patterns in Circum-Mediterranean subfamily Leuciscinae (Teleostei, Cyprinidae) inferred from both mitochondrial and nuclear data. BMC Evol. Biol.; 2010; 10, 265. [DOI: https://dx.doi.org/10.1186/1471-2148-10-265]
50. Schönhuth, S.; Vukić, J.; Šanda, R.; Yang, L.; Mayden, R.L. Phylogenetic relationships and classification of the Holarctic family Leuciscidae (Cypriniformes: Cyprinoidei). Mol. Phylogenet. Evol.; 2018; 127, pp. 781-799. [DOI: https://dx.doi.org/10.1016/j.ympev.2018.06.026]
51. Benovics, M. Host-Specific Parasites (Dactylogyrus, Monogenea) as Indicator of Evolution and Historical Dispersion of Their Cyprinid Fish Hosts in the Mediterranean Region. Ph.D. Thesis; Department of Botany and Zoology, Masaryk University: Brno, Czechia, 2020.
52. Stefani, F.; Galli, P.; Zaccara, S.; Crosa, G. Genetic variability and phylogeography of the cyprinid Telestes muticellus within the Italian peninsula as revealed by mitochondrial DNA. J. Zool. Syst. Evol. Res.; 2004; 42, pp. 323-331. [DOI: https://dx.doi.org/10.1111/j.1439-0469.2004.00272.x]
53. Zaccara, S.; Stefani, F.; Delmastro, G.B. Phylogeographical structure of vairone Telestes muticellus (Teleostei, Cyprinidae) within three European peri-Mediterranean districts. Zool. Scr.; 2007; 36, pp. 443-453. [DOI: https://dx.doi.org/10.1111/j.1463-6409.2007.00294.x]
54. Gridelli, E. I Pesci D’acqua Dolce Della Venezia Giulia; Del Bianco e Figlio: Udine, Italy, 1936.
55. Marchetto, F.; Zaccara, S.; Muenzel, F.M.; Salzburger, W. Phylogeography of the Italian vairone (Telestes muticellus, Bonaparte 1837) inferred by microsatellite markers: Evolutionary history of a freshwater fish species with a restricted and fragmented distribution. BMC Evol. Biol.; 2010; 10, 111. [DOI: https://dx.doi.org/10.1186/1471-2148-10-111]
56. GBIF.org. GBIF Home Page. 2024; Available online: https://www.gbif.org (accessed on 11 October 2024).
57. Bianco, P.G. Factors affecting the distribution of freshwater fishes especially in Italy. Cybium; 1995; 19, pp. 241-259.
58. Chiesa, S.; Filonzi, L.; Ferrari, C.; Vaghi, M.; Bilò, F.; Piccinini, A.; Zuccon, G.; Wilson, R.C.; Ulheim, J.; Nonnis Marzano, F. Combinations of distinct molecular markers allow to genetically characterize marble trout (Salmo marmoratus) breeders and stocks suitable for reintroduction plans. Fish. Res.; 2016; 176, pp. 55-64. [DOI: https://dx.doi.org/10.1016/j.fishres.2015.12.009]
59. Gandolfi, A.; Ferrari, C.; Crestanello, B.; Girardi, M.; Lucentini, L.; Meraner, A. Population genetics of pike, genus Esox (Actinopterygii, Esocidae), in Northern Italy: Evidence for mosaic distribution of native, exotic and introgressed populations. Hydrobiologia; 2017; 794, pp. 73-92. [DOI: https://dx.doi.org/10.1007/s10750-016-3083-1]
60. Zaccara, S.; Quadroni, S.; Vanetti, I.; Carosi, A.; La Porta, G.; Crosa, G.; Britton, R.; Lorenzoni, M. Morphologic and genetic variability in the Barbus fishes (Teleostei, Cyprinidae) of Central Italy. Zool. Scr.; 2019; 48, pp. 289-301. [DOI: https://dx.doi.org/10.1111/zsc.12341]
61. Salzburger, W.; Brandstätter, A.; Gilles, A.; Parson, W.; Hempel, M.; Sturmbauer, C.; Meyer, A. Phylogeography of the vairone (Leuciscus souffia, Risso 1826) in Central Europe. Mol. Ecol.; 2003; 12, pp. 2371-2386. [DOI: https://dx.doi.org/10.1046/j.1365-294X.2003.01911.x]
62. Dubut, V.; Fouquet, A.; Voisin, A.; Costedoat, C.; Chappaz, R.; Gilles, A. From Late Miocene to Holocene: Processes of Differentiation within the Telestes Genus (Actinopterygii: Cyprinidae). PLoS ONE; 2012; 7, e34423. [DOI: https://dx.doi.org/10.1371/journal.pone.0034423]
63. Webb, J.F.; Ramsay, J.B. New Interpretation of the 3-D Configuration of Lateral Line Scales and the Lateral Line Canal Contained within Them. Copeia; 2017; 105, pp. 339-347. [DOI: https://dx.doi.org/10.1643/CG-17-601]
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Giulianini, Piero Giulio 1
; Pallavicini, Alberto 1
; Pastorino, Paolo 2
; Pizzul, Elisabetta 1
1 Department of Life Science, University of Trieste, Via Giorgieri 10, 34127 Trieste, Italy;
2 Experimental Zooprofilactic Institute of Piedmont, Liguria and Valle d’Aosta, Via Bologna 148, 10154 Turin, Italy;