RPSR1, a major quantitative trait locus for Pythium stalk rot resistance in maize

Abstract

Pythium stalk rot (PSR) is a destructive disease of maize, severely affecting yield and grain quality. The identification of quantitative trait loci (QTL) or genes for resistance to PSR forms the basis of disease resistant hybrids breeding. In this study, a major QTL, Resistance to Pythium stalk rot 1 (RPSR1), was iden tified from a set of recombinant inbred lines derived from MS71 and POP. Using a recombinant progeny testing strategy, RPSR1 was fine-mapped in a 472 kb interval. Through candidate gene expression, gene knock-down and knock-out studies, a leucine-rich repeat receptor-like kinase gene, PEP RECEPTOR 2 (ZmPEPR2), was assigned as a PSR resistance gene. These results provide insights into the genetic archi tecture of resistance to PSR in maize, which should facilitate breeding maize for resistance to stalk rot.

Headnote

ABSTRACT

Pythium stalk rot (PSR) is a destructive disease of maize, severely affecting yield and grain quality. The identification of quantitative trait loci (QTL) or genes for resistance to PSR forms the basis of disease resistant hybrids breeding. In this study, a major QTL, Resistance to Pythium stalk rot 1 (RPSR1), was iden tified from a set of recombinant inbred lines derived from MS71 and POP. Using a recombinant progeny testing strategy, RPSR1 was fine-mapped in a 472 kb interval. Through candidate gene expression, gene knock-down and knock-out studies, a leucine-rich repeat receptor-like kinase gene, PEP RECEPTOR 2 (ZmPEPR2), was assigned as a PSR resistance gene. These results provide insights into the genetic archi tecture of resistance to PSR in maize, which should facilitate breeding maize for resistance to stalk rot.

ARTICLE INFO

Article history:

Received 23 July 2024

Revised 29 November 2024

Accepted 10 December 2024

Available online 7 January 2025

Keywords:

Maize

Pythium stalk rot

Quantitative trait loci (QTL)

LRR-RLK

ZmPEPR2

1. Introduction

Stalk rot caused by multiple pathogens, is a devastating and widespread disease of maize. Stalk rot reduces maize yield by dam aging vascular tissue in the stalk, disrupting water and nutrient transport and leading to lodging and light and poorly filled ears. In China, Pythium and Fusarium spp. are the primary pathogens causing the disease [1,2].

Using disease-resistant cultivars is an effective strategy for con trolling stalk rot in maize. Identifying QTL or genes associated with resistance to stalk rot is fundamental for breeding resistant hybrids. A growing number of QTL for pathogen resistance have been identified using various artificial populations. Examples include Rcg1 for Anthracnose stalk rot [3]; qRfg1, qRfg2, and qRfg3 for Gibberella stalk rot [4,5]; and Rpi1, RpiQI319-1, RpiQI319-2, RpiX178-1, and RpiX178-2 for PSR [1,6,7]. However, only a handful of genes have been cloned and characterized thus far. Among them, Rcg1 encodes an NLR (Nucleotide-binding leucine-rich repeat) disease-resistance protein, which delays the occurrence of Anthracnose stalk rot [8]. For Gibberella stalk rot, ZmCCT and ZmAuxRP1 have been identified as the causal genes at the QTL qRfg1 and qRfg2, respectively [9,10]. For ZmCCT, a CACTA-like trans posable element approximately 2.4 kb upstream has been identi ied as the genetic determinant of allelic variation, causing selective depletion of H3K4me3 and enrichment of methylated GC, which suppresses pathogen-induced ZmCCT expression and makes the plant more susceptible to disease [9]. ZmAuxRP1, a plas tid stroma-localized auxin-regulated protein coding gene, expresses at a high level to promote the synthesis of the plant hor mone indole-3-acetic acid (IAA). On pathogen invasion, ZmAuxRP1 expression is swiftly down-regulated, leading to increased synthe sis of benzoxazinoid defense compounds, thus contributes to bal anced plant growth and disease resistance [10]. More recently, a b-glucosidase ZmBGLU17 and a G-type lectin receptor kinase ZmLecRK1, have been identified by a genome-wide association study (GWAS) as conferring resistance to PSR [11,12]. ZmBGLU17 regulates disease resistance by adjusting the accumulation of lig nin and DIMBOA (2,4-dihydroxy-7-methoxy-1,4-benzoxazin-3-on e) without compromising yield. A 240-bp insertion in the promoter region of resistance allele increases the transcriptional efficiency of ZmBGLU17, while an SNP near the splice donor site in intron 5 of susceptible allele results in alternative splicing and reduces the accumulation of functional transcripts [11]. A naturally occurring A404S variant in ZmLecRK1 determines the ZmLecRK1-ZmBAK1 interaction, and thus affects disease resistance [12]. These findings provide molecular mechanisms underlying stalk rot resistance, which offer promising avenues for the development of targeted breeding strategies to enhance disease resistance in maize.

Leucine-rich repeat receptor-like kinases (LRR-RLKs) represent the largest family of receptor-like kinases (RLKs) involved in plant disease resistance [13-16], including well-known FLS2, EFR, Xa21, and Xa26 [17-20]. LRR-RLKs can be classified into 20 subgroups based on their kinase domains, with subgroup XI involved in the recognition of self-peptides and subgroup XII implicated in the recognition of pathogen-associated molecular patterns (PAMPs) [21-24]. Among the LRR-RLKs, plant elicitor peptide receptors (PEPRs) are widely distributed across plant species and belong to subgroup XI [25]. PEPRs can recognize endogenous peptides, thereby triggering immune responses [26]. In Arabidopsis, rice, and maize, two homologs of PEPR have been identified, along with at least six, seven, and five precursors of plant elicitor peptides (PROPEPs), respectively [25,27,28]. The PEP-PEPR systems are involved in combating various biotic and abiotic stresses. In Ara bidopsis, AtPEP1 confers resistance to Pythium irregulare, while AtPEP3 increases salt tolerance [29,30]. In rice, the PEP-PEPR sys tems contribute to resistance against the piercing-sucking insect brown planthopper, the fungal pathogen Magnaporthe oryzae, and the bacterial pathogen Xanthomonas oryzae [28]. Similarly, in maize, ZmPEP1 increased resistance to southern leaf blight disease and anthracnose stalk rot [31]. Whether the PEP-PEPR systems confer resistance to diseases caused by other maize pathogens has not been reported.

In this study, we identified a major QTL, RPSR1, that confers resistance to PSR in maize. ZmPEPR2, encoding an LRR-RLK, was determined as one of the casual genes for RPSR1. Although ZmPEPR2 distribute in most maize inbred lines, two detrimental alleles were isolated by natural variation analysis, which should be removed by molecular marker-assisted breeding.

2. Materials and methods

2.1. Plant materials

MS71 is one of the 26 fully sequenced founders of the Maize Nested Association Mapping Population (NAM). Strawberry pop corn (POP) is an American landrace of Indiana. F6 RILs (RILs-F6), consisting of 201 lines derived from MS71 POP, were used for PSR phenotyping. Two heterozygous inbred families (HIFs) within the RPSR1 confidence interval were self-crossed to generate recom binants and F7-F10 generations were employed for fine mapping. Near-isogenic lines (NILs) were developed from the two HIFs. The inbred line KN5585 was used for generating CRISPR/Cas9-edited ZmPEPR2 knockout mutants. All materials were planted either in Sanya, Hainan (2020-2023) or Shangzhuang, Beijing (2021- 2023), for progeny reproduction.

2.2. Construction of genetic map

Genotyping was performed based on a genome-wide Maize6H 60 K SNP array chip (DONGYA SEED, Shenyang), with all SNPs mapped to the B73 RefGen_v3 reference genome [32]. Each line of the RIL-F6 population, along with parents MS71 and POP, was planted, and leaf samples from three plants per line were collected for DNA extraction. SNP detection accuracy was evaluated with two replicates from one lineage. Non-polymorphic SNPs between MS71 and POP were removed, and low-quality SNPs were filtered out based on missing rate > 40%, minimum allele frequency (MAF) < 0.3, and heterozygosity rate > 10%. The remaining high quality SNPs were used to construct bin markers using a sliding window method [33], with a window size of 25 SNPs and a step size of 2 SNPs. The genotype of each window was assigned based on SNP ratios from both parents. If more than 75% of SNPs within a window originated from a single parent, the genotype of the win dow was assigned as homozygous for that parent; otherwise as heterozygous. These SNPs were then merged into 2691 recombina tion bin markers using the "binmapr" package in R software (Fig. S1). A genetic map was constructed based on these 2691 bin markers. The total span of the genetic bin map is 1595.65 centi Morgan (cM), with an average distance of 0.59 cM per bin (Fig. S2; Table S1).

2.3. Pythium aphanidermatum inoculation

Cultivation and zoospore induction of P. aphanidermatum were performed as described [12]. For inoculation at the germination stage, maize seeds were soaked in saturated CaSO4 for 8 h and ger minated in a humid, dark environment at 28 °ó ‡£C for 2 d. Filter paper strips (2 cm wide) were fully saturated in a uniformly suspension of P. aphanidermatum hyphae. The primary roots ( 1 cm long) were carefully placed onto the filter paper strips, and an additional strip was placed on top, overlapping with the bottom layer to ensure complete infiltration of the suspension into the roots. The setup was incubated in a dark at 25 °ó ‡£C. Disease severity was recorded at 24 h post-inoculation (hpi).

For inoculation and phenotype evaluation at the seeding stage, a wheat-sand medium was mixed with sterilized nutrient soil, while steriled nutrient soil served as the control, and transferred to pots (diameter = 9 cm, height = 8 cm). Uniformly germinated seeds (6 per pot) were planted, covered with sterilized nutrient soil, and grown in a greenhouse (23 °ó ‡£C, 16-h light/8-h dark cycle). Plant height, fresh weight, and wilting ratio were recorded after 7- 14 d as indicators of resistance [34-37].

For inoculation and phenotype evaluation at the adult stage. In the pot experiment, four seeds were planted per pot (diameter 30 cm, height 33 cm). At the heading stage, the midpoints of the third and fourth stalk nodes exposed to the soil were punctured, and 10 lL of zoospore suspension (150-200 zoospores lL 1 ) of P. aphanidermatum was injected into each hole. The phenotype of the parents, MS71 and POP, was recorded at 7 d post-inoculation. The infection ratio, calculated as lesion length divided by stalk length, was used to represent the severity of PSR. The phenotype of the zmpepr2 mutants was recorded starting when the infected stalks became softor some plants began to fall over (approxi mately two weeks post-inoculation). Finally, the stalks were longi tudinally cut to assess the severity of PSR. According to the stalk severity, four scores were assigned: 1, inoculation center was infected and other region was scarcely infected; 2, the infection spreads outward from the center and has not yet filled the stem pith; 3, the infection fills the whole stem pith; 4, infection perme ates the entire pith and fibrosis of the pith tissue. In the field exper iment, the same inoculation method was applied, but phenotypes were evaluated at kernel maturity ( 2 months). According to the stalk severity, four scores were assigned: 1, only the inoculated stalk nodes are infected; 2, both the upper and lower nodes of the inoculated stalk nodes are infected; 3, the infection extends directly down to the root; 4, the whole pith and the stalk are fibrotic.

2.4. QTL mapping

For QTL mapping, the phenotypic data (Table S2) and genetic data were statistical analyzed with R/qtl [38], using the multiple QTL interval mapping method [39]. The logarithm of odds (LOD) threshold was determined using the permutation method (n. perm = 1000) [40], for a significance threshold of P = 0.05. QTL con f idence intervals were defined using the 1.5 LOD drop method.

2.5. Fine mapping of the RPSR1

To develop markers for fine mapping, we identified InDels in the RPSR1 region, which determined by the 1.5 LOD drop method, based on the B73 reference genome and predicted 147 InDels. Based on their flanking regions, we designed 147 primer pairs to amplify both parental lines MS71 and POP. Following screening, 16 polymorphic InDel markers were screened. Six InDel markers (Table S3) were chosen for their amplification efficiency and phys ical location. The recombinant-derived progeny test strategy [41] was used for fine-mapping. A significant difference of PSR resis tance between two parental genotypic plants represents a QTL placed in the heterozygous fragment, otherwise represents the QTL located outside the heterozygous fragment.

2.6. Detection of gene expression

The primary roots of maize seeds were treated with P. aphani dermatum or water. Samples were collected at 6 hpi, pooling three roots per sample, and three biological replicates were performed. Total RNA was extracted using an RNA isolator and cDNA was syn thesized with a cDNA Synthesis Kit. qRT-PCR was performed using SYBR qPCR Mix, with two technical replicates. ZmACTIN served as an internal control. The primers used are listed in Table S3.

2.7. Gene Knock-down/out in maize

Virus-induced gene silencing (VIGS) was used to knock-down candidate genes and performed as described [11,42]. ZmPEPR2 was knock-out using Clustered Regularly Interspaced Short Palin dromic Repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) tool in maize inbred line KN5585 with two guide RNAs (gRNAs), CAAUUCCUUGAGUGGUAACA and CUUGGUGGAAAUAUUCUUGG. Primers for identification of zmpepr2 mutants are listed in Table S3.

2.8. InDel detection

Due to the lengthy 4642-bp DNA sequence, designing primers based on conserved sequences at both ends is challenging for PCR detection and may lead to false negatives. To address this, a forward primer was placed within the 4642-bp insertion and a reverse primer on a conserved sequence, allowing amplification of a 1000-bp segment to characterize the 4642-bp insertion. For the 57-bp InDel, primers flanking the conserved sequences were used to amplify 165-bp and 108-bp fragments, identified by 4% agarose gel electrophoresis.

The 8-bp InDel is difficult to detect with conventional methods, so we included the 8-bp sequence in one primer. Inbred lines lack ing this sequence would not be amplified. An additional primer pair verified PCR accuracy, producing a distinct fragment size for differentiation. Both primer pairs amplified independently, and products were visualized using 2% agarose gel electrophoresis. The primers used are listed in Table S3. In the detection of the above three InDels, MS71 and POP were used as controls.

2.9. Transient expression and reactive oxygen species (ROS) detection

The CDS of ZmPEPR2B73 and ZmPEPR2POP were driven by the 35S promoter, and the constructs were transformed into Agrobacterium tumifaciens strain GV3101. The concentrations of Agrobacterium suspensions were adjusted to OD600 = 0.5 and used to infect Nico tiana. benthamiana leaves. Eight discs were taken from each sample using a 4-mm diameter punch 48 h after agroinfiltration, with one disc placed per well in a 96-well plate containing 200 lL sterile deionized water overnight. Sterile deionized water was replaced by 200 lL working solution [15 mg L 1 luminol, 10 mg L 1 horse radish peroxidase]. Fifty microliters of 0.4 lmol L 1 ZmPEP3 (TRTPPWPPCPPEEGSGGNGGSHN) was added to each well before luminescence was recorded with a microplate detector every 1 min for 50 min.

3. Results

3.1. Resistance to PSR in two maize varieties

To investigate the genetic basis of natural variation in resistance to PSR, MS71 and POP were inoculated with the pathogen at three different growth stages. At the germination stage, root tip rot was observed in MS71 as early as 24 hpi, while POP showed few to no signs of rot (Fig. 1A, B). At the seedling stage, inoculation with P. aphanidermatum significantly inhibited the growth of MS71, lead ing to a reduction in plant height and wilt of seedling. In contrast, POP displayed only a slight decrease in height and no signs of seed ling wilt (Fig. 1C, D). At the adult stage, both MS71 and POP were inoculated with P. aphanidermatum zoospores in their stalks. The results showed that POP was more resistance to PSR than MS71 (Fig. 1E, F). These results suggested that POP contains genes for resistance to PSR.

3.2. QTL mapping of PSR resistance in maize at the germination stage

To identify potential PSR resistance genes in POP, a set of RILs, developed from a cross between MS71 and POP, were inoculated with P. aphanidermatum at the germination stage. Phenotype in the RILs was non-normally distributed (Fig. 2A, B), indicating the presence of a few major QTL that may be responsible for control ling resistance to PSR in this population.

Combining phenotypic and genetic data of the RILs, a significant locus RPSR1 on chromosome 1 was identified by QTL analysis. This QTL spans the physical region from 211.49 to 218.36 Mb (B73 RefGen_v4) and accounts for 23.57% of the total phenotypic varia tion (Fig. 2C). Subsequently, we conducted a t-test based on the genotypes at the RPSR1 LOD peak. The MS71 alleles showed the highest disease severity, followed by the heterozygotes, while the POP alleles showed the lowest disease severity (Fig. 2D). These findings suggest that the disease-resistant locus originates from the POP genotype.

In the RPSR1 region, two heterozygous inbred families (HIFs) from the RIL-F6 population were identified using the flanking markers M 1 and M 2. Two pairs of near isogenic lines (NILs) based on the two HIFs were developed and inoculated with P. aphanidermatum at the germination and seeding stages. At the ger mination stage, NILPOP showed stronger resistance than NILMS71 (Fig. S3A-D). At the seedling stage, both NIL pairs showed a similar growth trend without inoculation. However, NILPOP showed a higher plant height than NILMS71 after inoculation. Leaves of NILMS71-1 appeared to curl, while the leaves of NILPOP-1 remained uncurled (Figs. 2E, F, S3E, F). These results suggest the presence of candidate genes linked to PSR resistance within the RPSR1 con fidence interval.

3.3. Fine mapping of RPSR1

To narrow down the RPSR1 region, a sequential strategy for fine mapping of recombinant-derived progeny was performed. The two HIFs were grown in the field for self-pollination to generate recom binants. The M 1 and M 2 markers were used to identify the recombinants of the F7 generation. Four additional markers were developed to identify further types of recombinants of the F8 to F10 generations. In total, 10 types of recombinants were character ized from a population of 7112 individuals spanning generations F7 to F10. The disease symptom of each recombinant's progeny was scored after being inoculated with P. aphanidermatum at the germi nation stage, and the corresponding genotype was performed using one of the six markers. The RPSR1 region was fine-mapped to an interval of 472 kb, defined by markers M 6 and M 3. According to the maize B73 genome v4, there were nine high-confidence genes located in this candidate region (Fig. 3; Table S4).

3.4. Analysis of candidate genes

To identify the causative gene in RPSR1, we analyzed the tran scriptional expression of candidate genes with or without P. aphanidermatum infection. Four of the nine genes showed no expression, whether or not the plants were treated with P. aphani dermatum (Fig. S4A), suggesting that these genes are not involved in RPSR1. The remaining five genes contained two differentially expressed genes (DEGs), Zm00001d032116 and Zm00001d032117 (Figs. 4A, S4B). The expression level of Zm00001d032116 was induced in POP after P. aphanidermatum infection, while only a slight increase was observed in MS71. In contrast, the other gene, Zm00001d032117, showed a similar expression pattern in both POP and MS71, regardless of pathogen inoculation. According to gene annotation, Zm00001d032116 encodes an LRR-RLK known as ZmPEPR2 (Table S4). Orthologs of ZmPEPR2 have been reported to play a role in disease resistance in plants like Arabidopsis and rice. The other gene, Zm00001d032117, encodes a protein involved in cell division regulation.

To evaluate whether the two DEGs are functional genes related to RPSR1, we used VIGS to knock down these genes in the maize inbred line B73. Detached leaves were subsequently inoculated with P. aphanidermatum. Plants silenced for ZmPEPR2 showed lar ger lesion areas than control plants, while those silenced for Zm00001d032117 showed lesion areas similar to the control group (Fig. 4B-D). These findings suggest that the down-regulation of ZmPEPR2 in maize increases susceptibility to P. aphanidermatum, whereas silencing Zm00001d032117 does not influence resistance to the pathogen. By integrating the gene expression with the phe notypes of VIGS plants, we assigned ZmPEPR2 as a candidate gene for resistance to P. aphanidermatum.

3.5. Natural variation and association analysis of ZmPEPR2

Next, we investigated whether there are functional polymor phisms of ZmPEPR2 between POP and MS71. ZmPEPR2 contains two exons and one intron. The genomic DNA (gDNA) and coding DNA sequence (CDS) lengths for ZmPEPR2 in POP are 3751 and 3312 bp, respectively. In comparison, the gDNA and CDS lengths for ZmPEPR2 in MS71 are 8448 and 2615 bps, respectively. Sequence comparison revealed a 4642-bp insertion in the first exon, along with 8-bp and 57-bp insertions in the second exon, and a 10-bp deletion in the intron of the ZmPEPR2MS71 allele. The 4642-bp and 8-bp insertion in ZmPEPR2MS71 may lead to a trun cated protein (Fig. 5A). The 4642-bp insertion in ZmPEPR2MS71 was predicted using Repeatmasker (https://www.repeatmasker. org) as a retrotransposon of the LTR/Ty1 family, featuring a GGAAT repeat sequence at both ends of the insertion site (Fig. S5A). In con trast, the ZmPEPR2POP allele has only a single GGAAC sequence at the corresponding location (Fig. S5B).

Along with the insertions and deletions (InDels), a total of 36 single nucleotide polymorphisms (SNPs) were identified in the entire coding region of ZmPEPR2 between MS71 and POP. Of these, 9 SNPs resulted in nonsynonymous mutations within the coding region (Fig. 5B; Table S5). We extended the sequence comparisons to include more inbred lines, including the 26 founders of the NAM population, MO17, and W22. None of those inbred lines but MS71 harbored the 4642-bp transposable element (TE) insertion in geno mic fragment of ZmPEPR2. However, five inbred lines (MS71, CML277, HP301, P39 and CML322) do have the 8-bp insertion. CML277, HP301, and P39 showed an identical sequence to MS71, except for the absence of 4642-bp TE insertion, which included the GGAAT sequence (Fig. S6; Table S6). These findings imply that the 8-bp insertion is tightly linked to the GGAAT sequence.

Specific primers were developed to identify the InDels of 4642 bp, 8-bp, and 57-bp in 373 different maize inbred lines from a diverse natural population (Table S3), representing global maize diversity [43]. Since the B73 genome is the most commonly used reference, we used the ZmPEPR2B73 allele as the standard type, which contains the 57-bp sequence and lacks the 4642-bp and 8 bp sequences. The results showed that none of the inbred lines possess the 4642-bp insertion. However, the 8-bp insertion was present in 28 inbred lines, and the 57-bp deletion was found in 136 inbred lines (Fig. 5C). Assuming that the 8-bp insertion might be closely linked to the GGAAT sequence, we proceeded to amplify and sequence the sequences containing either GGAAT or GGAAC in the 28 inbred lines with the 8-bp insertion. The results showed that 26 inbred lines contain the GGAAT sequences, while only 2 inbred lines have the GGAAC sequences (Table S7). These results further support the notion that the 8-bp insertion is closely linked to the GGAAT sequence.

In our previous analysis, 189 inbred lines from the natural pop ulation were phenotyped for P. aphanidermatum resistance [11]. The association of phenotype and genotype in this population revealed that inbred lines with the 57-bp deletion (Del-57) showed only a slight increase in disease severity score. In contrast, those with the 8-bp insertion (Ins-8) showed higher disease severity than those with the common allele (Fig. 5D). The del-57 occurs in a non-critical domain of ZmPEPR2 and does not disrupt the nor mal translation of ZmPEPR2, which likely explains why it results in only minor phenotypic change in maize resistance to PSR. To test this hypothesis, N. benthamiana leaves transiently expressing ZmPEPR2B73 and ZmPEPR2POP proteins were treated with ZmPEP3, a known elicitor of ZmPEPR2. The resulting ROS burst trend indicated that ZmPEPR2POP was a functional protein. The peak value of ROS triggered by ZmPEPR2POP was only slightly lower than that of ZmPEPR2B73 (Fig. 5E), which further suggests that the del-57 had minimal impact on the functionality of ZmPEPR2POP . In contrast, the Ins-8 occurred in the crucial serine/threonine kinase domain of ZmPEPR2 (Fig. 5A), leading to premature termination of ZmPEPR2 and significantly weakening maize resistance to PSR. These analyses strongly support ZmPEPR2 as the functional gene for RPSR1.

3.6. Functional validation of ZmPEPR2 for resistance to PSR with CRISPR/Cas9 edited knockout mutants

To confirm the role of ZmPEPR2 in maize resistance to PSR, two independent CRISPR/Cas9-edited knockout mutants (zmpepr2-1 and zmpepr2-2) were created in the KN5585 inbred line. The zmpepr2-1 allele contains a 366-bp deletion that disrupts the LRR18-LRR23 motifs of ZmPEPR2KN5585 , while zmpepr2-2 harbors a 365-bp deletion in the coding sequence resulting in a truncated protein (Figs. 6A, S7).

Upon inoculation during the germination stage, we observed that the primary roots of zmpepr2-1 and zmpepr2-2 were significantly more infected than those of KN5585 (Fig. 6B, C). At the seed ling stage, both KN5585 and the two mutants without pathogen inoculation exhibited vigorous growth with no significant differ ences in plant height and fresh weight. However, in the presence of P. aphanidermatum, zmpepr2-1 and zmpepr2-2 displayed decreased plant height, reduced fresh weight and a higher degree of wilt compared to KN5585 (Fig. 6D-G). These results indicate that the two zmpepr2 mutant lines were more susceptible to P. aphanidermatum during the seeding stage. To validate this observa tion, we further analyzed the disease phenotype of these materials in the adult stage. In the field experiment, phenotypic evaluation was conducted after ear maturity. Following pathogen inoculation, the stalks exhibited varying degrees of yellowing and hardness, with some plants displaying lodging. The ears of lodging plants showed signs of mold or sprouting, while ears of plants with severe stalk rot displayed shriveled grains. (Fig. S8). To assess the severity of maize PSR, the maize stalks were longitudinally split. The results showed that the zmpepr2-1 and zmpepr2-2 mutants exhibited more severe stalk rot than that of KN5585 (Fig. 6H, I). In the pot exper iment, a higher lodging rate was observed in the zmpepr2-1 and zmpepr2-2 mutants after inoculation (Fig. S9A). Longitudinal sec tions of maize stalks revealed a greater degree of decay or fibrosis in the pith of zmpepr2-1 and zmpepr2-2 mutants than that of KN5585 (Fig. S9B, C), indicating compromised resistance to PSR. These findings strongly suggested that ZmPEPR2 confers resistance to PSR in maize.

4. Discussion

In this study, we identified a major QTL, RPSR1, that confers resistance to PSR. RPSR1 is located on chromosome 1, which also hosts several previously reported QTL linked to resistance against maize stalk rot [1,4,7,10,11,44,45], indicating that chromosome 1 may be a region enriched with genes associated with stalk rot resistance. The finding that the confidence interval for RPSR1 did not overlap with the reported QTL suggests that RPSR1 is a novel QTL.

L. We further demonstrated that ZmPEPR2 is one of the candidate genes for RPSR1. We employed two independently CRISPR/Cas9 edited mutants to validate the function of ZmPEPR2. Among the two mutant lines, zmpepr2-1 carries a 366-bp deletion, while zmpepr2-2 has a 365-bp deletion. Both mutants showed increased susceptibility to PSR, but zmpepr2-2 appeared to have a more sev ere disease phenotype (Fig. 6). We propose two hypotheses to explain this observation: i) The gene editing vector may have ran domly inserted itself into the maize genome, or off-target effects of gene editing may have occurred. This interference could affect other genes in the genome, potentially influencing the disease resistance; ii) The deletion in zmpepr2-1 is a multiple of three nucleotides, which might allow it to retain partial functionality.

This partial functionality could result in zmpepr2-1 exhibiting a weaker susceptibility compared to zmpepr2-2.

It was found that a 4642-bp insertion or an 8-bp insertion may cause the ZmPEPR2 in the MS71 line to lose its function. Both inser tions are rare or minor variations. The 4642-bp insertion is exclu sively found in the MS71 line, while the 8-bp insertion is present in 28 inbred lines out of a natural variation population of 373 lines (Fig. 5C). This may explain why the locus could not be identified in a recent GWAS based on the natural population [11], as GWAS often lack the ability to detect low-frequency variants [46-49].

In this study, we identified a 4642-bp insertion in MS71, pre dicted to be an LTR/Ty1family retrotransposon (Fig. S5A). In maize, TEs account for nearly 85% of the genome [50]. These TEs have con tributed to the diversity of the maize genome and have influenced various biological processes, including disease resistance in maize [9,51-53]. The repeated sequence at the end of the TE insertion in ZmPEPR2MS71 is GGAAT, while the flanking sequence in ZmPEPR2POP is GGAAC (Fig. S5B). We speculate that GGAAT serves as the specific recognition sequence for the TE insertion. However, the NAM founder lines CML277, HP301, and P39 also have the same GGAAT sequence as MS71 in ZmPEPR2, but do not have the TE insertion. These three inbred lines have the same 8-bp insertion in ZmPEPR2 as MS71, suggesting that this GGAAT sequence is tightly linked to the 8-bp insertion. In addition, 26 of the 28 inbred lines that con tain the 8-bp insertion in the natural population also have the GGAAT sequences (Table S7). This observation further indicates a strong linkage between the GGAAT sequence and 8-bp insertion. We hypothesize that these inbred lines are affected by a similar TE at the GGAAT site, and the insertion of the TE in MS71 occurred very recently. Given that inbred lines with 8-bp or TE insertions are more susceptible to PSR, it is feasible to reduce the spread of these alleles using molecular marker-assisted selection.

CRediT authorship contribution statement

Shengfeng He: Writing - original draft, Methodology, Investi gation, Formal analysis, Data curation. Junbin Chen: Writing - review & editing, Supervision, Methodology. Chuang Liu: Method ology, Investigation. Dandan Liu: Methodology. Lei Wang: Resources. Canxing Duan: Resources, Methodology. Wangsheng Zhu: Writing - review & editing, Supervision, Project administra tion, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing finan cial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

We thank Professor Zhongwei Lin (China Agricultural Univer sity) for providing the maize RIL population, Professor Tao Zhou (China Agricultural University) for providing maize gene VIGS toolkit. This work was supported by National Natural Science Foundation of China (32302371 to Junbin Chen), the National Key Research and Development Program, Ministry of Science and Technology of China (2022YFD1201802 to Wangsheng Zhu), and Research Program from State Key Laboratory of Maize Bio breeding (SKLMB2424 to Wangsheng Zhu).

Footnote

â‡' Corresponding authors.

E-mail addresses: [email protected] (J. Chen), [email protected] (W. Zhu).

References

References

[1] F.J. Song, M.G. Xiao, C.X. Duan, H.J. Li, Z.D. Zhu, B.T. Liu, S.L. Sun, X.F. Wu, X.M. Wang, Two genes conferring resistance to Pythium stalk rot in maize inbred line Qi319, Mol. Genet. Genomics 290 (2015) 1543-1549.

[2] D.E. Yang, C.L. Zhang, D.S. Zhang, D.M. Jin, M.L. Weng, S.J. Chen, H. Nguyen, B. Wang, Genetic analysis and molecular mapping of maize (Zea mays L.) stalk rot resistant gene Rfg1, Theor. Appl. Genet. 108 (2004) 706-711.

[3] M. Jung, T. Weldekidan, D. Schaff, A. Paterson, S. Tingey, J. Hawk, Generation means analysis and quantitative trait locus mapping of anthracnose stalk rot genes in maize, Theor. Appl. Genet. 89 (1994) 413-418.

[4] Q. Yang, G. Yin, Y. Guo, D. Zhang, S. Chen, M. Xu, A major QTL for resistance to Gibberella stalk rot in maize, Theor. Appl. Genet. 121 (2010) 673-687.

[5] C. Ma, X. Ma, L. Yao, Y. Liu, F. Du, X. Yang, M. Xu, qRfg3, a novel quantitative resistance locus against Gibberella stalk rot in maize, Theor. Appl. Genet. 130 (2017) 1723-1734.

[6] D.E. Yang, D.M. Jin, B. Wang, D.S. Zhang, H.T. Nguyen, C.L. Zhang, S.J. Chen, Characterization and mapping of Rpi1, a gene that confers dominant resistance to stalk rot in maize, Mol. Genet. Genomics 274 (2005) 229-234.

[7] C. Duan, F. Song, S. Sun, C. Guo, Z. Zhu, X. Wang, Characterization and molecular mapping of two novel genes resistant to Pythium stalk rot in maize, Phytopathology 109 (2019) 804-809.

[8] T.J. Frey, T. Weldekidan, T. Colbert, P.J.C.C. Wolters, J.A. Hawk, Fitness evaluation of Rcg1, a locus that confers resistance to Colletotrichum graminicola (Ces.) G.W. Wils. using near-isogenic maize hybrids, Crop Sci. 51 (2011) 1551-1563.

[9] C. Wang, Q. Yang, W. Wang, Y. Li, Y. Guo, D. Zhang, X. Ma, W. Song, J. Zhao, M. Xu, A transposon-directed epigenetic change in ZmCCT underlies quantitative resistance to Gibberella stalk rot in maize, New Phytol. 215 (2017) 1503-1515.

[10] J. Ye, T. Zhong, D. Zhang, C. Ma, L. Wang, L. Yao, Q. Zhang, M. Zhu, M. Xu, The auxin-regulated protein ZmAuxRP1 coordinates the balance between root growth and stalk rot disease resistance in maize, Mol. Plant 12 (2019) 360- 373.

[11] C. Liu, S. He, J. Chen, M. Wang, Z. Li, L. Wei, Y. Chen, M. Du, D. Liu, C. Li, C. An, V. Bhadauria, J. Lai, W. Zhu, A dual-subcellular localized b-glucosidase confers pathogen and insect resistance without a yield penalty in maize, Plant Biotechnol. J. 22 (2024) 1017-1032.

[12] Z. Li, J. Chen, C. Liu, S. He, M. Wang, L. Wang, V. Bhadauria, S. Wang, W. Cheng, H. Liu, X. Yang, M. Xu, Y.-L. Peng, W. Zhu, Natural variations of maize ZmLecRK1 determine its interaction with ZmBAK1 and resistance patterns to multiple pathogens, Mol. Plant 17 (2024) 1606-1623.

[13] S.H. Shiu, A.B. Bleecker, Expansion of the receptor-like kinase/pelle gene family and receptor-like proteins in Arabidopsis, Plant Physiol. 132 (2003) 530-543.

[14] A. Dievart, C. Gottin, C. Périn, V. Ranwez, N. Chantret, Origin and diversity of plant receptor-like kinases, Annu. Rev. Plant Biol. 71 (2020) 131-156.

[15] Z. Yin, J. Liu, D. Dou, RLKdb: a comprehensively curated database of plant receptor-like kinase families, Mol. Plant 17 (2024) 513-515.

[16] Q. Liu, Q. Fu, Y. Yan, Q. Jiang, L. Mao, L. Wang, F. Yu, H. Zheng, Curation, nomenclature, and topological classification of Receptor-like kinases from 528 plant species for novel domain discovery and functional inference, Mol. Plant 17 (2024) 658-671.

[17] L. Gómez-Gómez, T. Boller, FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis, Mol. Cell 5 (2000) 1003-1011.

[18] G. Kunze, C. Zipfel, S. Robatzek, K. Niehaus, T. Boller, G. Felix, The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants, Plant Cell 16 (2004) 3496-3507.

[19] X. Sun, Y. Cao, Z. Yang, C. Xu, X. Li, S. Wang, Q. Zhang, Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein, Plant J. 37 (2004) 517-527.

[20] R.N. Pruitt, B. Schwessinger, A. Joe, N. Thomas, F. Liu, M. Albert, M.R. Robinson, L.J. Chan, D.D. Luu, H. Chen, O. Bahar, A. Daudi, D. de Vleesschauwer, D. Caddell, W. Zhang, X. Zhao, X. Li, J.L. Heazlewood, D. Ruan, D. Majumder, M. Chern, H. Kalbacher, S. Midha, P.B. Patil, R.V. Sonti, C.J. Petzold, C.C. Liu, J.S. Brodbelt, G. Felix, P.C. Ronald, The rice immune receptor XA21 recognizes a tyrosine sulfated protein from a Gram-negative bacterium, Sci. Adv. 1 (2015) e1500245.

[21] M.D. Lehti-Shiu, C. Zou, K. Hanada, S.H. Shiu, Evolutionary history and stress regulation of plant receptor-like kinase/pelle genes, Plant Physiol. 150 (2009) 12-26.

[22] J. Jose, S. Ghantasala, S. Roy Choudhury, Arabidopsis transmembrane receptor like kinases (RLKs): a bridge between extracellular signal and intracellular regulatory machinery, Int. J. Mol. 21 (2020) 4000.

[23] B.P.M. Ngou, M. Wyler, M.W. Schmid, Y. Kadota, K. Shirasu, Evolutionary trajectory of pattern recognition receptors in plants, Nat. Commun. 15 (2024) 308.

[24] C. Furumizu, A.K. Krabberod, M. Hammerstad, R.M. Alling, M. Wildhagen, S. Sawa, R.B. Aalen, The sequenced genomes of nonflowering land plants reveal the innovative evolutionary history of peptide signaling, Plant Cell 33 (2021) 2915-2934.

[25] E. Poretsky, K. Dressano, P. Weckwerth, M. Ruiz, S.N. Char, D. Shi, R. Abagyan, B. Yang, A. Huffaker, Differential activities of maize plant elicitor peptides as mediators of immune signaling and herbivore resistance, Plant J. 104 (2020) 1582-1602.

[26] Y. Yamaguchi, G. Pearce, C.A. Ryan, The cell surface leucine-rich repeat receptor for AtPep1, an endogenous peptide elicitor in Arabidopsis, is functional in transgenic tobacco cells, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 10104-10109.

[27] Y. Yamaguchi, A. Huffaker, A.C. Bryan, F.E. Tax, C.A. Ryan, PEPR2 is a second receptor for the Pep1 and Pep2 peptides and contributes to defense responses in Arabidopsis, Plant Cell 22 (2010) 508-522.

[28] W. Shen, X. Zhang, J. Liu, K. Tao, C. Li, S. Xiao, W. Zhang, J.F. Li, Plant elicitor peptide signalling confers rice resistance to piercing-sucking insect herbivores and pathogens, Plant Biotechnol. J. 20 (2022) 991-1005.

[29] A. Huffaker, G. Pearce, C.A. Ryan, An endogenous peptide signal in Arabidopsis activates components of the innate immune response, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 10098-10103.

[30] K. Nakaminami, M. Okamoto, M. Higuchi-Takeuchi, T. Yoshizumi, Y. Yamaguchi, Y. Fukao, M. Shimizu, C. Ohashi, M. Tanaka, M. Matsui, K. Shinozaki, M. Seki, K. Hanada, AtPep3 is a hormone-like peptide that plays a role in the salinity stress tolerance of plants, Proc. Natl. Acad. Sci. U. S. A. 115 (2018) 5810-5815.

[31] A. Huffaker, N.J. Dafoe, E.A. Schmelz, ZmPep1, an ortholog of Arabidopsis elicitor peptide 1, regulates maize innate immunity and enhances disease resistance, Plant Physiol. 155 (2011) 1325-1338.

[32] H. Tian, Y. Yang, H. Yi, L. Xu, H. He, Y. Fan, L. Wang, J. Ge, Y. Liu, F. Wang, J. Zhao, New resources for genetic studies in maize (Zea mays L.): a genome-wide Maize6H-60K single nucleotide polymorphism array and its application, Plant J. 105 (2021) 1113-1122.

[33] X. Huang, Q. Feng, Q. Qian, Q. Zhao, L. Wang, A. Wang, J. Guan, D. Fan, Q. Weng, T. Huang, G. Dong, T. Sang, B. Han, High-throughput genotyping by whole genome resequencing, Genome Res. 19 (2009) 1068-1076.

[34] Y. Song, P. Ma, J. Gao, C. Dong, Z. Wang, Y. Luan, J. Chen, D. Sun, P. Jing, X. Zhang, W. Song, Z. Zhou, J. Wu, Natural variation in maize gene ZmSBR1 confers seedling resistance to Fusarium verticillioides, Crop J. 12 (2024) 836-844.

[35] P. Ma, E. Liu, Z. Zhang, T. Li, Z. Zhou, W. Yao, J. Chen, J. Wu, Y. Xu, H. Zhang, Genetic variation in ZmWAX2 confers maize resistance to Fusarium verticillioides, Plant Biotechnol. J. 21 (2023) 1812-1826.

[36] G.P. Munkvold, J.K. O'Mara, Laboratory and growth chamber evaluation of fungicidal seed treatments for maize seedling blight caused by Fusarium species, Plant Dis. 86 (2002) 143-150.

[37] L.D. Williams, A.E. Glenn, C.W. Bacon, M.A. Smith, R.T. Riley, Fumonisin production and bioavailability to maize seedlings grown from seeds inoculated with Fusarium verticillioides and grown in natural soils, J. Agric. Food Chem. 54 (2006) 5694-5700.

[38] K.W. Broman, H. Wu, S. Sen, G.A. Churchill, R/qtl: QTL mapping in experimental crosses, Bioinformatics 19 (2003) 889-890.

[39] J. Wang, X. Zhang, Z. Lin, QTL mapping in a maize F2 population using Genotyping-by-Sequencing and a modified fine-mapping strategy, Plant Sci. 276 (2018) 171-180.

[40] G.A. Churchill, R.W. Doerge, Empirical threshold values for quantitative trait mapping, Genetics 138 (1994) 963-971.

[41] Q. Yang, D. Zhang, M. Xu, A sequential quantitative trait locus fine-mapping strategy using recombinant-derived progeny, J. Integr. Plant Biol. 54 (2012) 228-237.

[42] R. Wang, X. Yang, N. Wang, X. Liu, R.S. Nelson, W. Li, Z. Fan, T. Zhou, An efficient virus-induced gene silencing vector for maize functional genomics research, Plant J. 86 (2016) 102-115.

[43] X. Yang, S. Gao, S. Xu, Z. Zhang, B.M. Prasanna, L. Li, J. Li, J. Yan, Characterization of a global germplasm collection and its potential utilization for analysis of complex quantitative traits in maize, Mol. Breed. 28 (2010) 511-526.

[44] M.E. Pè, L. Gianfranceschi, G. Taramino, R. Tarchini, P. Angelini, M. Dani, G. Binelli, Mapping quantitative trait loci (QTL) for resistance to Gibberella zeae infection in maize, Mol. Gen. Genet. 241 (1993) 11-16.

[45] D. Zhang, Y. Liu, Y. Guo, Q. Yang, J. Ye, S. Chen, M. Xu, Fine-mapping of qRfg2, a QTL for resistance to Gibberella stalk rot in maize, Theor. Appl. Genet. 124 (2012) 585-596.

[46] S.A. Flint-Garcia, A.C. Thuillet, J. Yu, G. Pressoir, S.M. Romero, S.E. Mitchell, J. Doebley, S. Kresovich, M.M. Goodman, E.S. Buckler, Maize association population: a high-resolution platform for quantitative trait locus dissection, Plant J. 44 (2005) 1054-1064.

[47] Y. Luo, M. Zhang, Y. Liu, J. Liu, W. Li, G. Chen, Y. Peng, M. Jin, W. Wei, L. Jian, J. Yan, A.R. Fernie, J. Yan, Genetic variation in YIGE1 contributes to ear length and grain yield in maize, New Phytol. 234 (2022) 513-526.

[48] J. Yu, G. Pressoir, W.H. Briggs, I. Vroh Bi, M. Yamasaki, J.F. Doebley, M.D. McMullen, B.S. Gaut, D.M. Nielsen, J.B. Holland, S. Kresovich, E.S. Buckler, A unified mixed-model method for association mapping that accounts for multiple levels of relatedness, Nat. Genet. 38 (2006) 203-208.

[49] Z. Zhang, E. Ersoz, C.Q. Lai, R.J. Todhunter, H.K. Tiwari, M.A. Gore, P.J. Bradbury, J. Yu, D.K. Arnett, J.M. Ordovas, E.S. Buckler, Mixed linear model approach adapted for genome-wide association studies, Nat. Genet. 42 (2010) 355-360.

[50] P.S. Schnable, D. Ware, R.S. Fulton, J.C. Stein, F. Wei, S. Pasternak, C. Liang, J. Zhang, L. Fulton, T.A. Graves, P. Minx, A.D. Reily, L. Courtney, S.S. Kruchowski, C. Tomlinson, C. Strong, K. Delehaunty, C. Fronick, B. Courtney, S.M. Rock, E. Belter, F. Du, K. Kim, R.M. Abbott, M. Cotton, A. Levy, P. Marchetto, K. Ochoa, S. M. Jackson, B. Gillam, W. Chen, L. Yan, J. Higginbotham, M. Cardenas, J. Waligorski, E. Applebaum, L. Phelps, J. Falcone, K. Kanchi, T. Thane, A. Scimone, N. Thane, J. Henke, T. Wang, J. Ruppert, N. Shah, K. Rotter, J. Hodges, E. Ingenthron, M. Cordes, S. Kohlberg, J. Sgro, B. Delgado, K. Mead, A. Chinwalla, S. Leonard, K. Crouse, K. Collura, D. Kudrna, J. Currie, R. He, A. Angelova, S. Rajasekar, T. Mueller, R. Lomeli, G. Scara, A. Ko, K. Delaney, M. Wissotski, G. Lopez, D. Campos, M. Braidotti, E. Ashley, W. Golser, H. Kim, S. Lee, J. Lin, Z. Dujmic, W. Kim, J. Talag, A. Zuccolo, C. Fan, A. Sebastian, M. Kramer, L. Spiegel, L. Nascimento, T. Zutavern, B. Miller, C. Ambroise, S. Muller, W. Spooner, A. Narechania, L. Ren, S. Wei, S. Kumari, B. Faga, M.J. Levy, L. McMahan, P. Van Buren, M.W. Vaughn, K. Ying, C.T. Yeh, S.J. Emrich, Y. Jia, A. Kalyanaraman, A.P. Hsia, W.B. Barbazuk, R.S. Baucom, T.P. Brutnell, N.C. Carpita, C. Chaparro, J.M. Chia, J.M. Deragon, J.C. Estill, Y. Fu, J.A. Jeddeloh, Y. Han, H. Lee, P. Li, D.R. Lisch, S. Liu, Z. Liu, D.H. Nagel, M.C. McCann, P. Sanmiguel, A.M. Myers, D. Nettleton, J. Nguyen, B.W. Penning, L. Ponnala, K.L. Schneider, D.C. Schwartz, A. Sharma, C. Soderlund, N.M. Springer, Q. Sun, H. Wang, M. Waterman, R. Westerman, T.K. Wolfgruber, L. Yang, Y. Yu, L. Zhang, S. Zhou, Q. Zhu, J.L. Bennetzen, R.K. Dawe, J. Jiang, N. Jiang, G.G. Presting, S.R. Wessler, S. Aluru, R.A. Martienssen, S.W. Clifton, W.R. McCombie, R.A. Wing, R.K. Wilson, The B73 maize genome: complexity, diversity, and dynamics, Science 326 (2009) 1112-1115.

[51] C. Chen, Y. Zhao, G. Tabor, H. Nian, J. Phillips, P. Wolters, Q. Yang, P. Balint Kurti, A leucine-rich repeat receptor kinase gene confers quantitative susceptibility to maize southern leaf blight, New Phytol. 238 (2023) 1182- 1197.

[52] M. Zhang, Y. Cao, Z. Wang, Z.Q. Wang, J. Shi, X. Liang, W. Song, Q. Chen, J. Lai, C. Jiang, A retrotransposon in an HKT1 family sodium transporter causes variation of leaf Na+ exclusion and salt tolerance in maize, New Phytol. 217 (2018) 1161-1176.

[53] Z. Zhang, X. Zhang, Z. Lin, J. Wang, H. Liu, L. Zhou, S. Zhong, Y. Li, C. Zhu, J. Lai, X. Li, J. Yu, Z. Lin, A large transposon insertion in the stiff1 promoter increases stalk strength in maize, Plant Cell 32 (2020) 152-165.

Appendix A. Supplementary data

Supplementary data for this article can be found online at https://doi.org/10.1016/j.cj.2024.12.009.