INTRODUCTION
According to the latest data from the World Health Organization (WHO), the global incidence of breast cancer reaches as high as 2.3 million cases, accounting for 11.6% of newly diagnosed cancer patients, ranking second only to lung cancer.1 Screening methods for breast cancer mainly include breast ultrasound, mammography, and magnetic resonance imaging.2 Although these methods are clinically used, they have certain limitations. For example, mammography has its limitations in screening younger women with typically denser breast tissue or with specific tumor phenotype. Besides, mammography causes radiation and severe pain in the subject, which reduces the patient's compliance with screening, leading to possible missed detections and corresponding delayed treatment. Therefore, it is necessary to develop simple, patient-friendly, accurate, and sensitive screening methods for breast cancer. Liquid biopsy utilizes in vitro detection techniques to monitor circulating tumor cells (CTCs), circulating tumor DNA (ctDNA), extracellular vesicles (EVs), and other substances released by tumors or metastatic lesions into body fluids,3–6 enabling non-invasive diagnosis and assisting in the treatment of tumors. The various kinds of materials carried by EVs, such as proteins, microRNAs, piwi-interacting RNAs (piRNAs), mRNAs, etc., can characterize the status of tumor cells, providing new molecular diagnostics for cancers.7,8
Currently, there are extensive studies on miRNAs in cells or exosomes, while research on the role of piRNAs in disease progression and diagnosis is relatively scarce. PIWI-interacting RNAs (piRNAs) are a class of small non-coding RNAs which are approximately 21−35 nucleotides in length and associated with PIWI subfamily of Argonaute proteins.9–11 They play crucial roles in maintaining genome stability, including suppressing transposon activity, assembling telomere protection complexes, and regulating gene expression through epigenetic mechanisms.12–14 Increasing studies suggest that the expression level of piRNAs influences the dynamics of disease occurrence and progression.15,16 For instance, aberrantly expressed piRNAs such as piR-36712, piR-651, piR-021285, and piR-932 have been identified to be in association with breast cancer.17 PiR-651 was discovered to enhance proliferation and migration while inhibiting apoptosis of breast cancer cells by promoting DNMT1-mediated PTEN promoter methylation, and can serve as a potential diagnostic indicator and therapeutic target for breast cancer.18
Currently, detection methods for piRNAs are mainly limited to microarrays, quantitative real-time polymerase chain reaction, and next-generation sequencing, while a few emerging biosensing strategies have also been reported. Lee et al. developed a single-cell breast cancer diagnostic probe, piR-36026 molecular beacon, which successfully imaged the biological occurrence of highly expressed endogenous piR-36026 in the human breast cancer cell line MCF-7 and inhibited piR-36026-mediated tumor progression.19 Jia et al. designed aptamer-functionalized activatable DNA tetrahedral nano probes for imaging and regulating endogenous piRNAs in cancer cells, offering opportunities for breast cancer diagnosis and treatment.20 In recent years, we have been working on developing analytical methods for detecting piRNAs in plasma exosomes and their application in liquid biopsy. They include a universal catalytic hairpin self-assembly detection system,21 three highly efficient enzyme-free isothermal amplification systems in butanol-water biphasic solution,22 and a super sensitive split DNAzyme detection system accelerated by butanol dehydration.23 However, these methods require prior lysis of exosomes and destruction of PIWI protein-piRNA complexes with proteinase K before detection, which is time-consuming and labor-intensive. Therefore, it is necessary to develop a simple and in situ detection method for the analysis of exosomal piRNAs.
Gold nanoflares have been reported to conduct in situ detection and imaging of miRNAs in exosomes by our group and other scientists.24–26 They may also be used to perform in situ detections of piRNAs in exosomes. However, although the length of piRNA is just about 10 nt longer than miRNAs, they always bind to 97 kD-PIWI proteins to present as large-sized complex, which will generate big steric hindrance in the detection reaction by a classical nanoflare probe. In this study, we rationally designed a gold nanoparticle-cored spherical nucleic acid probe named piR-651 probe to in situ detect piR-651 in exosomes. The structure and detection scheme of the probe were deliberately designed to target large-sized PIWI interacting RNA complex, avoiding the steric hindrance and ensuring the detection sensitivity. Based on the piR-651 probe, we established a liquid biopsy assay through plasma exosomal piR-651 detection for breast cancer diagnosis, reaching high accuracy. In situ imaging of piR-651 expression in single living cells was also conducted.
EXPERIMENTAL SECTION
Experimental instruments and materials
The oligonucleotide sequences purified by HPLC and 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, pH = 7.6) buffer were bought from Shanghai Sangon Biotech Co. Ltd., China. Hydrogen tetrachloroaurate (III) trihydrate (HAuCl4•3H2O) was provided by Shanghai Aladdin Bio-Chem Technology Co. Ltd., China. Trisodium citrate dihydrate (C6H5Na3O7•2H2O) was purchased from Guangzhou Chemical Reagent Factory, China. Fetal bovine serum (FBS) was provided by Wuhan Punoasis Life Science & Technology Co., China. Cell culture medium containing dual antibiotics was supplied by Jiangsu Kaiji Biotechnology Co., China. Breast cancer cells MCF-7 and human normal breast epithelial cells MCF-10A were provided by the cell library of School of Pharmaceutical Sciences, Southern Medical University, China. Plasma specimens were collected from China Southern Hospital of Southern Medical University and Shenzhen Baoan District Shiyan People's Hospital after obtaining informed consent from the patients.
The exosomes from cell culture were extracted and purified by the high-speed centrifuge (HC-2062, Hunan Herexi Instrument Co.) and the Beckman ultracentrifuge (Optima XPN-100, Beckman Coulter Life Sciences Inc.). The sizes and concentrations of exosomes were determined by the nano particle tracing analyzer (Zeta View Particles Metrix). The fluorescent intensities were measured by a multifunctional microplate detector (Infinite M1000, Tecan). The images of the Au nanoparticles and piR-651 probe were taken by a HITACH H-7650 transmission electron microscope, Japan.
Synthesis and characterization of the piR-651 probe
Gold nanoparticles (AuNPs) with a diameter of 13 nm were first synthesized using the chloroauric acid reduction method27 (detailed in ESI). Subsequently, the piR-651 probe was synthesized by modifying the AuNPs with high density oligonucleotide chains through butanol dehydration acceleration method.28 Briefly, following a 300:1 M ratio of Anchor DNA-Report DNA duplexes to AuNPs, both Anchor DNA and Report DNA (Table 1) of 92 μM at 1.5 μL were mixed, denatured at 95°C for 5 min, and left slowly to room temperature for hybridization into double strands. Then, 46 μL of 10 nM AuNPs sol and 1 μL of 750 mM NaCl were added to form a total volume of 50 μL solution. Subsequently, 450 μL of n-butanol was added and vortexed for 8−9 s until the mixture became transparent, followed by immediate addition of 100 μL of 0.5 × TBE buffer and vortexing for 9 s. The mixture was then centrifuged at 2000 g for 5 s, resulting in red colloidal precipitate at the bottom of the tube. The red precipitate was transferred to another 1.5 mL EP tube using a pipette and subjected to centrifugation at 15,000 rpm and 4°C for 15 min. The supernatant was removed, and the precipitate was washed with 46 μL of 25 mM HEPES (containing 100 mM NaCl, pH = 7.6) under centrifugation at 15,000 rpm and 4°C for 15 min. The washing process was repeated three times, and the precipitate was finally resuspended in 46 μL of 25 mM HEPES. All procedures above should avoid light.
TABLE 1 Sequences of the oligonucleotide chains modified on piR-651 probe, piR-651 nanoflare, and piR-16926 probe.
| Name | Sequence (5′–3′) |
| Anchor DNA on piR-651 probe | CCCGTGCCTTGGAAAGCGTC(A)7-SH |
| Report DNA on piR-651 probe | Cy5-GACGCTTTCCAAGGCACGGGCCCCTCTCT |
| Capture DNA on piR-651 nanoflare | GACGCTTTCCAAGGCACGGGCCCCTCTCT(A)7-SH |
| Report DNA on piR-651 nanoflare | Cy5-CCCGTGCCTTGGAAAGCGTC |
| Anchor DNA on piR-16926 probe | TGCTGGGCCCATAACCCAGA(A)7-SH |
| Report DNA on piR-16926 probe | Cy5-TCTGGGTTATGGGCCCAGCACGCTTCCG |
| piR-651 | AGAGAGGGGCCCGUGCCUUGGAAAGCGUC |
| piR-16926 | CGGAAGCGUGCUGGGCCCAUAACCCAGA |
Characterization of the synthesized piR-651 probe was conducted as follows: UV-Vis absorption spectra were measured in the range of 400–700 nm to determine absorbance peaks and calculate concentration; the hydrated particle sizes and their distribution range were determined using dynamic light scattering (DLS); the potential distribution was determined through Zeta potential measurements; and the transmission electron microscopy (TEM) imaging was employed to observe particle size and morphological features.
A negative control probe named piR-16926 probe to detect piR-16926 with a similar structure to the piR-651 probe and a probe to detect piR-651 with a structure of classical nanoflare29 named piR-651 nanoflare were also synthesized using the butanol dehydration method as described above. The sequences of the modified oligonucleotide chains are listed in Table 1.
Determination of DNA loading on the piR-651 probe
A standard addition method was used to determine the DNA loading on the piR-651 probe. A series of solutions with 0.5 nM piR-651 probe, 40 mM tris-(2-carboxyethyl)-phosphine (TCEP), and Anchor DNA-Report DNA duplexes of concentrations ranging from 0 to 120 nM in 50 μL HEPES, respectively, were prepared and incubated at room temperature in the dark for 30 min. Then, the fluorescence intensity of each solution was measured using a multifunctional microplate reader with an excitation wavelength of 640 nm and an emission wavelength of 665 nm. The fluorescence intensity signal was plotted against the concentration of the Anchor DNA-Report DNA duplexes, and a linear equation was fitted to calculate the DNA loading on the probe.
Determination of anti-DNase I stability of the piR-651 probe
The piR-651 probe of 0.5 nM was added with DNase I at final concentrations ranging from 0 to 500 U/mL in a 384-well plate with a total volume of 50 μL per well. The plate was then incubated at room temperature in the dark for 1 h and the fluorescence intensity of each well was subsequently measured using a multifunctional microplate reader with excitation wavelength at 640 nm and emission wavelength at 665 nm. The fluorescence intensity ratios of sample signal to blank signal were plotted against the concentrations of DNase I. Similarly, a series of solutions with the same composition of piR-651 probe and DNase I as the abovementioned solutions and with an additional EDTA at a final concentration of 1.5 mg/mL in each well were prepared. These solutions were conducted the same procedure as abovementioned to determine the anti-DNase I stability of the piR-651 probe in the presence of EDTA.
Detection of piR-651 in the solution
The piR-651 probe of 0.5 nM was mixed with 0–50 nM piR-651 solution in 50 μL HEPES buffer in a 384-well plate and incubated at room temperature in the dark for 1 h. The fluorescence intensity of each solution was then measured using a multifunctional microplate reader at an excitation wavelength of 640 nm and an emission wavelength of 665 nm. The signal-to-background ratio (S/B) was plotted against the concentration of piR-651 to evaluate its detection sensitivity in the solution system.
Determination of the selectivity of the piR-651 probe to nucleic acids
The piR-651 probe of 0.5 nM was mixed, respectively, with 20 nM of piR-651, DNA analogs of miR-1246, miR-21, and other random DNAs (Table 2) in 50 μL HEPES buffer and incubated at room temperaturein the dark for 1 h. A blank piR-651 probe solution without any addition of target nucleic acid was prepared as the same procedure. Subsequently, the fluorescenceintensity of each well was measured using a multifunctional microplate reader with excitation and emission wavelengths of 640 and 665 nm, respectively. The bar chart of signal-to-background ratio (S/B) was plotted against the type of nucleic acid to evaluate the detection selectivity of the piR-651 probe.
TABLE 2 DNA sequences used in the determination of the selectivity of piR-651 probe.
| Name | Sequence (5′–3′) |
| miR-21 analog | TAGCTTATCAGACTGATGTTGA |
| miR-1246 analog | AATGGATTTTTGGAGCAGG |
| Random DNA-1 | AGAGAGGGCCCCGTGCCTTGGAAAGCGTC |
| Random DNA-2 | AGAGAGGGCCCCGTGCCTGGGAAAGCGTC |
| Random NDA-3 | AGAGAGGGCCCCGAGCCTGGGAAAGCGTC |
Isolation, extraction, and identification of exosomes
MCF-7 and MCF-10 A cells were cultured in 10-cm dishes under 5% CO2 at 37°C. MCF-7 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin, while MCF-10A cells were cultured in specialized MCF-10A medium containing 5% horse serum, 10 μg/mL insulin, 20 mg/mL epidermal growth factor, 100 ng/mL cholera toxin, and 0.5 μg/mL hydrocortisone in DMEM/F12 (1:1). When the cells reached 50%–60% confluency, the medium was replaced with DMEM containing 10% exosome-depleted FBS, and the cells were further cultured until reaching approximately 90% confluency. The cell culture supernatant was then collected, and exosomes were isolated using differential centrifugation, which involved sequential centrifugation steps at 4°C and under 300 × g for 10 min, 2000 × g for 20 min, and 10,000 × g for 30 min to remove residual cells, dead cells, and cell debris, respectively. Subsequently, the supernatant was centrifuged at 4°C and 110,000 × g for 70 min. The pellet was washed with PBS and centrifuged at 4°C and 110,000 × g for 80 min. The supernatant was discarded, and the exosome pellet was resuspended in 100 μL of PBS and stored at −80°C for later use. Characterization of the isolated exosomes were performed as follows: the concentration and size distribution of exosomes were determined using a nanoparticle tracking analyzer (NTA); the morphology and size of exosomes were observed using transmission electron microscopy (TEM); and the characteristic proteins of exosomes were analyzed by Western blot (WB) (details are provided in the ESI).
In situ detection of piR-651 encased in exosomes
To reduce false positive signal generated by nucleic acids released from a small number of exosomes ruptured during ultracentrifugation and proteins co-precipitated with exosomes, MCF-7 exosomes ranging from 0 to 5.0 × 108 particles/μL were first treated sequentially with 0.1 mg/mL of proteinase K at 37°C for 30 min to disrupt proteins and RNA-protein complexes, 5 mM proteinase K inhibitor PMSF at room temperature for 20 min to terminate the proteinase K reaction, and 5 U/mL of RNase A at 37°C for 30 min to degrade the released RNAs. Then, 1 nM of the piR-651 probe was added and incubated at room temperature in the dark for 2 h. The fluorescence intensity emitted by each solution at a wavelength of 665 nm under excitation at 640 nm was measured using a multifunctional microplate reader, and the signal-to-background ratio (S/B) was plotted against the exosome concentration. The quantitative responses of both piR-651 nanoflare and the negative control of piR-16926 probe to the MCF-7 exosomes were also performed as the above-mentioned procedure.
Diagnosis of breast cancer by plasma exosomal piR-651 detection
Plasma samples (40 μL each) from 21 breast cancer patients and 22 healthy individuals were pretreated as the method described in 2.8. Then, 1 nM of the piR-651 probe was added to each treated sample and the mixture was incubated at room temperature for 2 h. A PBS of 40 μL was treated in the same manner as a blank. The fluorescence intensity of each sample solution was measured using a multifunctional microplate reader with excitation at 640 nm and emission at 665 nm. Scatter plots and receiver operating characteristic (ROC) curves were conducted for the diagnosis of breast cancer.
Imaging of piR-651 in live cells by piR-651 probe
Cytotoxicity assays of the piR-651 probe to MCF-7 cells were first conducted. Approximately 5000 MCF-7 cells were seeded per well in a 96-well plate and were incubated in a 37°C, 5% CO2 incubator for 24 h. Then, the culture medium was removed and replaced by 100 μL of fresh medium containing 8 μL of piR-651 probe and returned to the incubator for six different times from 0 to 24 h, respectively. At the respective end points, the culture medium of different groups was removed and a 10-fold diluted MTT solution was added for an extending 4h-incubation. Finally, the solution in the wells was removed, and 100 μL of DMSO was added and mixed thoroughly. The absorbance at 492 nm of each well was measured using a microplate reader. Cell viability was plotted against time. MTT assays to test cytotoxicity of the AuNPs and piR-651 probe to MCF-10A cells were also performed after they were co-inhabited for 24 h.
For the imaging, MCF-7 or MCF-10A cells were first seeded at ∼5000 cells per confocal dish for 24 h. Then, each dish was added with 0.5 nM of the piR-651 probe and incubated at 37°C for 0.5–4 h. Next, 500 μL of Hoechst 3342 dye was added to each dish, and the cells were further incubated for 20 min. After washing three times with PBS, the dishes were added with fresh medium and were observed under an inverted confocal laser scanning microscope (CLSM). The imaging of MCF-7 cells with the negative control probe piR-16926 was also performed following a similar procedure.
Another two MCF-7 cell lines with piR-651 up-regulated and down-regulated respectively and an untreated control MCF-7 cell line were also performed CLSM imaging with a similar procedure except some difference in the sample treatment. Briefly, 3 confocal dishes were first seeded with ∼5000 cells and cultured until the cell density reached 70%–80%. Then, 300 nM of piR-651 analog and piR-651 antisense sequences were transfected to two of the dishes with Lipo-8000. After they were incubated in the incubator for 2 h, the medium was discarded and the cells were washed three times with PBS. The 3 sample dishes were then incubated with 0.5 nM of the piR-651 probe at 37°C for 3 h and finally performed staining and CLSM imaging with a similar method as described above.
RESULTS AND DISCUSSION
Design and detection principle of the piR-651 probe
For the purpose of in situ detection of large-sized PIWI-interacting piRNA complexes in exosomes, we designed the 13-nm gold nanoparticles (AuNPs)-cored spherical nucleic acid probe named piR-651 probe (Scheme 1). The double stranded oligonucleotide chains modified on the AuNPs are composed of Anchor DNAs and Report DNAs (Table 1). Each anchor DNA strand has a thiol at the 3′ end and conjugates with AuNP cores through an Au-S bond. Each Report DNA, which is designed as an anti-sense DNA of piR-651 and marked with a fluorophore Cy5 at the 5′ end, was partially hybridized with an Anchor DNA strand. The fluorophores on the piR-651 probe generate little fluorescence because of their proximity to the surface of the AuNP core, which is a strong fluorescence quencher. However, when piR-651 is present, the target nucleic acids will competitively hybridize with the Report DNAs by forming perfect complementary duplexes and detach them from the probes. The Cy5s on the detached Report DNAs away from the gold core will emit fluorescence under excitation light, with the intensity quantitatively correlated with the concentration of the target nucleic acid.
[IMAGE OMITTED. SEE PDF]
Notably, the structure and detection mechanism of the piR-651 probe are different from the classical nanoflare probe. In piR-651 nanoflare, it is the capture DNAs (Table 1) that have fully complementary sequences to the target nucleic acids. When detecting piR-651, more stable and longer Capture DNA-piR-651 duplexes on the probe will form, leading to displacement of the shorter Report DNAs from the gold core and thus the emission of fluorescent signals. Since piRNAs in cells and exosomes always bind to the 97 kDa PIWI proteins, in a detection reaction by Nanoflare, as the amount of large-sized PIWI protein-RNA complex bound to the capture DNA increases, the nucleic acid modification region on the probe will become more and more crowded, which may augment steric hindrance in further reactions and thus affect the speed and sensitivity of detection. In contrast, the structure of the piR-651 probe and its detection scheme make the space of the probes increase as the detection reaction proceeds because the Report DNAs were moved away from the gold core by hybridizing with the targets, thus being beneficial for the subsequent reactions (Scheme 1).
Synthesis and characteristics of the piR-651 probe
After synthesizing the piR-651 probe using the butanol dehydration method, we first compared the changes in particle size of the piR-651 probe with AuNPs using UV-visible spectroscopy. As shown in Figure 1A, the maximum absorption peaks of the sol of AuNPs and the piR-651 probe were at 519 and 524 nm, respectively. The red shift in the surface plasmon resonance absorption indicates that the particle size of the piR-651 nanoprobe is larger than that of the AuNPs. Additionally, an absorption peak at 645 nm appeared in the absorption spectrum of the piR-651 probe, which was not observed in the spectrum of AuNPs, indicating the successful modification of the Report DNA containing the Cy5 on the surface of the probe. Based on the peak absorbance values in the two spectra and sample dilution factors, the concentrations of the AuNPs and the piR-651 probe were calculated to be 10 and 6.7 nM, respectively, using the Beer-Lambert law (molar extinction coefficient ε = 2.7 × 108 L mol−1 cm−1). Furthermore, dynamic light scattering measurements revealed that the average hydrated particle diameters of the piR-651 probe and AuNPs were 41.43 and 14.88 nm, respectively (Figure 1B), both showing uniform and narrow size distributions with the polymer dispersity indexes as 0.282 and 0.178, respectively. The Zeta potentials of the piR-651 probe and AuNPs sols also showed that the probe had a higher negative charge density (Figure 1C), suggesting that a large number of nucleic acid chains with negative charges were successfully grafted on the piR-651 probe. The morphology and size of the gold nanoparticles (Figure 1D) and the piR-651 probe (Figure 1E) observed under transmission electron microscopy showed spherical and a uniform particle size distribution, exhibiting no aggregation. Through 275 particles in the TEM image, the average diameter of AuNPs was calculated as 13.18 ± 0.98 nm (Figure 1F).
[IMAGE OMITTED. SEE PDF]
Furthermore, we demonstrated the successful synthesis of the piR-651 probe by determining the nucleic acid loading on the probe using the standard addition method. When the ordinate value of the standard curve equaled to the fluorescence background of AuNPs, the corresponding abscissa value was −36.72 nM (Figure S1), indicating that there were 36.72 nM Anchor-Report DNA duplexes on the 0.5 nM piR-651 probe, averaging 73 pairs of Anchor-Reporter DNA per probe. Herein, we used the “flash” butanol dehydration method to synthesize the spherical nucleic acid probe, which was first developed by Deng's group.28 The method is very effective and rapid and can obtain products with good reproducibility as well. Compared to miR-1246 probe we previously reported using the freezing method,24 piR-651 probe has approximately twice the amount of modified oligonucleotide duplexes, indicating another merit of the butanol dehydration method, which is consistent with the results of Deng's report.
Detection performance in buffer and anti-DNase stability of the piR-651 probe
We first investigated the piR-651 detection reaction kinetics in HEPES buffer. As shown in Figure 2A, the probe exhibited a rapid response to piR-651, with a sharp increase in signal intensity within 60 min. Therefore, we chose to incubate the 0.5 nM piR-651 probe with piR-651 in HEPES buffer at room temperature for 1 h to investigate the quantitative response of the piR-651 probe to the target. The results (Figure 2B) showed that the probe exhibited a linear response to piR-651 in the range of 0–30 nM, with a correlation coefficient (R2) of 0.9993. The sensitivity of the response was 1.12 folds/nM, and the detection limit was 178 pM (calculated by 3σ/sensitivity). Beyond 30 nM of piR-651, the fluorescence signal of the 0.5 nM probe reached saturation, which was consistent with the approximately 73 strands of Report DNA loaded on each probe. To investigate the selectivity of the piR-651 probe, we designed and synthesized DNA analogs of miR-21, miR-1246 and three random DNAs which were different from piR-651 by 1, 2, and 3 bases, respectively (Table 2). Figure 2C shows the response signals of the 0.5 nM piR-651 probe to those nucleic acids at 20 nM, indicating that the probe has good selectivity in detecting piR-651 and generates little interfering signal to those nucleic acids such as miR-21 and miR-1246 coexisting inside MCF-7 exosomes.
[IMAGE OMITTED. SEE PDF]
In blood plasma, there are abundant endogenous nucleases which may lead to probe degradation, resulting in false-positive signals. Therefore, we tested the anti-DNase stability of the piR-651 probe by incubating 0.5 nM of the probe with DNase I at concentrations of 0–500 U/mL, respectively, for 1 h and measuring fluorescence afterward. As shown in Figure 2D, when the concentration of DNase I reached 10 U/mL, the fluorescence began to rise as the Anchor-Report DNAs with Cy5s were hydrolyzed to leave away from the AuNPs quencher. The degree of degradation increased as the concentration of DNase enzyme increased. However, the stability of the probe was significantly enhanced when 1.5 mg/mL EDTA was added to the solution. Even though the activity of DNase I reached 500 U/mL, the probe basically remained intact to generate little false positive signal. Since blood plasma samples collected for cancer diagnosis contained EDTA anticoagulants, the piR-651 probe can be used for nucleic acid detection in blood plasma.
Performance of piR-651 probe for in situ detection of cell piR-651
One of the most important features of oligonucleotide spherical Au nanoparticles is that they can be easily internalized by cells and interact with the inner ingredients. Thus, we applied the piR-651 probe for in situ imaging of piR-651 in breast cancer cells and normal breast cells to visually display the level difference of the biomarker. After confirming the low toxicity of the piR-651 probe to MCF-7 cells and normal human breast cells (Figure S2), we first observed the confocal laser scanning microscopic (CLSM) images of the piR-651 probe and the negative control piR-16926 probe in MCF-7 cells. The significant difference in the intensity of the fluorescence in Figure 3A and Figure S3 suggested that piR-651 in the cells was specifically lighted by piR-651 probe. To further confirm that the red light was truly triggered by the reaction of piR-651 and the probe, two extra MCF-7 cell lines, which were respectively up-regulated and down-regulated of piR-651, were also treated with piR-651 probe for 3 h and CLSM imaging was performed afterward. As shown in Figure 4, the significant different intensities of the red light from weak to strong were seen in the cells from the down-regulated to the up-regulated. This result demonstrates that piR-651 probe can in situ detect and differentiate piR-651 levels in the cells. We subsequently incubated piR-651 probe with MCF-7 and MCF-10A cells, respectively, to observe the fluorescent image. As shown in Figure 3A, light in the Cy5 channel significantly increased over time in MCF-7 cells. In comparison, images in MCF-10A cells (Figure 3B) showed only weak Cy5 fluorescence over time, significantly lower than that in MCF-7 cells. This result suggests that piR-651 is expressed at higher levels in MCF-7 cells than in the normal breast cells, which is consistent with a previous report.17
[IMAGE OMITTED. SEE PDF]
[IMAGE OMITTED. SEE PDF]
Performance of piR-651 probe for in situ detection of exosomal piR-651
Before we evaluated the performance of piR-651 probe in detecting piR-651 encased in exosomes, we first validated the subtype of the EVs which were isolated from MCF-7 cell culture. NTA was employed to determine their size distribution and concentration. As shown in Figure 5A, the EVs with sizes ranging from 45 to 195 nm account for 80% of the total number of particles. The mean and median sizes were 153.3 and 138.1 nm, respectively. The diameter distribution is consistent with the size range of exosome subtypes. The total concentration of EVs resuspended in 100 μL of PBS was determined to be 1.4 × 109 particles/μL. TEM images (Figure 5B) revealed that the isolated products possessed membrane structures and distinct circular profiles. Protein immunoblot analysis (Figure 5C) demonstrated clear bands of the transmembrane protein CD63 and the luminal protein TSG101 in accordance with the characteristic proteins of exosomes.30 These results confirm the exosome attributes of the extracted EVs and can be used as model exosomes for performance tests of piR-651 probe.
[IMAGE OMITTED. SEE PDF]
Since we have observed false positive signals generated by reactions of nucleic acid probes with contaminants outside exosomes in our previous study, to ensure that we performed in situ detection of piR-651 encased in the exosomes, we next investigated if similar interference would occur to piR-651 probe. We incubated piR-651 probe with MCF-7 exosomes which were untreated or pretreated with proteinase K and RNase A using the method in 2.8 and compared the fluorescence signals. As shown in Figure S4, signals from the untreated exosomes were stronger than those from the treated ones, which were consistent with the results we obtained in the cases of Au nanoflare and molecular beacon in our previous reports.24,31 However, the false positive signals from piR-651 probe detecting untreated exosomes were much higher. We inferred that the longer Report DNAs-Anchor DNAs on the piR-651 probe than Report-Capture DNAs on miRNA-targeted nanoflares would trigger more non-specific bond of them with the proteins and RNAs released from some broken EVs during the ultracentrifugal separation, thus making Report DNA leave off the probe to generate false positive signals. Therefore, it is very important to pretreat exosomes following the recommendation of the International Society for Extracellular Vesicles in all the following experiments involving EVs to exclude false positive signals from the outside of exosomes.
We then measured the kinetics of exosomal piR-651 detection by piR-651 probe. Fluorescence was observed to increase with time of incubation, reaching a significant difference from the background after 30 min and reaching the maximum response around 2 h (Figure S5). Thus, we measured the response signal of the probe with MCF-7 exosomes at different concentrations after 2 h of co-incubation. The fluorescence signal to blank (S/B) exhibited a significantly positive correlation with the EV concentration, showing an estimated detection limit of 5 × 107 particles/μL (Figure 6A). The S/B value at 5 × 108 particles/μL reached a quite high level of 17.03, showing the high response sensitivity of the probe. Figure 6A also shows concentration dependent signals when detecting EVs secreted by normal breast cells MCF-10A, but the intensities were much lower than those generated by the same concentration of MCF-7 EVs. This difference is consistent with the level difference of piR-651 in the two types of exosomes determined by RT-qPCR in our previous report.21 To confirm that the signals were actually from piR-651 in the exosomes, we fabricated a negative control probe piR-16926 probe to conduct the similar tests with MCF-7 exosomes. Similar to the cell image, the signal produced by piR-16926 in MCF-7 EVs did not vary significantly with changes in EV concentration and remained lower than the response signal of the piR-651 probe (Figure 6B), which is in the line with the much lower expression of piR-16926 than piR-651 in the MCF-7 exosomes measured by next generation sequencing (Table S1). This indicates that the fluorescence signals from both piR-651 and piR-16926 probes are specially caused by their respective target piRNAs other than false positive signals from their interaction with surface proteins or other impurities outside the EVs. The in situ detection of piR-651 encased in EVs was further supported by imaging using super-resolution optical microscopy and transmission electron microscopy after co-incubation of the piR-651 probes with MCF-7 EVs. As shown in Figure 6D, EVs stained with PKH67 produced green fluorescence, and the release of the Cy5-labeled reporter sequence generated red fluorescence. Merged images from the path of PKH67 and path Cy5 revealed overlaps of red and green light spots, demonstrating that the signal generated by the probe mainly originates from inside the EVs. Observation under TEM (Figure 6E and Figure S6) also revealed the entry of piR-651 probes into EVs after 2 h of incubation. The entry was heterogeneous, with some EVs showing no probe entry, while others showed entry of 3–8 probes.
[IMAGE OMITTED. SEE PDF]
To validate whether the structure design of piR-651 probe avoided the potential steric hindrance from PIWI proteins-RNA complex on the detection sensitivity, we synthesized a classical Nanoflare-structured piR-651 probe, piR-651 nanoflare (Table 1). In solution, the sensitivity and detection limit of piR-651 nanoflare to the free piR-651 DNA analog without protein attachments (Figure S7) were very close to those of the piR-651 probe (Figure 2B). However, when detecting piR-651 in MCF-7 EVs, the piR-651 probe exhibited a much higher sensitivity than that of piR-651 Nanoflare (Figure 6B). To investigate if this difference is indeed due to the different detection mechanisms caused by the structural differences between the two probes, we treated MCF-7 EVs with Triton X-100 to lysis the membrane and then used proteinase K to disrupt the PIWI proteins-RNA complexes. Then, we used both types of probes to detect piR-651. We found that piR-651 Nanoflare and the piR-651 probe produced approximately equal fluorescence signals (Figure 6C). Since the basic structures of the piR-651 probe and piR-651 Nanoflare are similar, and they have the same fluorophore modifications, their entry efficiencies into MCF-7 EVs are also similar theoretically. Therefore, the much higher detection sensitivity to the exosomal piR-651 by piR-651 probe than that of piR-651 Nanoflare demonstrated that the structure of the piR-651 probe indeed avoids the steric hindrance caused by the large-sized PIWI protein-RNA complex. This structure of the probe contributes to improve detection sensitivity.
Application of the piR-651 probe in breast cancer diagnosis
According to previous studies,18,32 piR-651 is upregulated in breast cancer tissues, cells, and circulating extracellular vesicles compared to normal controls, enhancing the proliferation and migration of breast cancer cells. This suggests that piR-651 can serve as a molecular marker for breast cancer diagnosis. Since the piR-651 probe can quantitatively respond to the level of piR-651 in extracellular vesicles, we applied it in liquid biopsy diagnosis of breast cancer by the in situ detection of piR-651 in plasma extracellular vesicles from peripheral blood samples. After simple pretreatment of plasma from breast cancer patients (n = 21) and healthy controls (n = 22) with proteinase K and RNase A, the piR-651 probe was employed to detect piR-651 in the plasmal exosomes. The signal-to-background (S/B) data revealed an average value of 11.06 ± 1.86 (mean ± SD) for the breast cancer patient group and 6.88 ± 1.53 (mean ± SD) for the normal control group. T-test results showed a significant difference in the average signal levels between the two groups (p < 0.0001) (Figure 7A). Through receiver operating characteristic curve analysis (Figure 7B), at the best cutoff value of S/B = 9.193, the sensitivity and specificity of breast cancer diagnosis were calculated to be 85.7% and 100% respectively. The area under the curve (AUC) was 0.9913, indicating high diagnostic accuracy.
[IMAGE OMITTED. SEE PDF]
CONCLUSIONS
This study presented a new design of spherical gold nanoprobes for the in situ detection of piRNAs in extracellular vesicles. We have demonstrated the much better sensitivity of piR-651 probe than a classical nanoflare. The structure of the Anchor-Report DNA strands and the corresponding detection mechanism avoid the possible increasing steric hindrance during the detection reaction of piR-651 with large sized PIWI protein-RNA complexes. The design strategy of this probe may be extended to the construction of biosensors for other large-volume targets. Based on this probe, we established a liquid biopsy method through in situ detection of the biomarker piR-651 in plasma extracellular vesicles for breast cancer diagnosis, which is simple and accurate. The probe can also be used in live-cell imaging for piRNA detection. In summary, we provided a new method for in situ detection of piRNAs in cells and exosomes, which are potentially developed for applications in clinical molecular diagnosis of cancers and gene therapy research.
ACKNOWLEDGMENTS
We are grateful to the Guangdong Basic and Applied Basic Research Foundation (2022A1515011369) from the Department of Science and Technology of Guangdong Province and the foundation from Shenzhen Baoan District Shiyan People's Hospital (2023SY03).
CONFLICT OF INTEREST STATEMENT
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.
ETHICS STATEMENT
Plasma specimens were collected from China Southern Hospital of Southern Medical University and Shenzhen Baoan District Shiyan People's Hospital after obtaining informed consent from the patients.
Saudi Med. J. 2024, 45, 326.
E. Wellings, L. Vassiliades, R. Abdalla, Cureus 2016, 8, e945.
M. Nikanjam, S. Kato, R. Kurzrock, J. Hematol. Oncol. 2022, 15, 131.
C. Alix‐Panabières, K. Pantel, Cancer Discov. 2021, 11, 858.
M. Ignatiadis, G. W. Sledge, S. S. Jeffrey, Nat. Rev. Clin. Oncol. 2021, 18, 297.
P. Pinzani, V. D'Argenio, M. Del Re, C. Pellegrini, F. Cucchiara, F. Salvianti, S. Galbiati, Clin. Chem. Lab. Med. 2021, 59, 1181.
R. Kalluri, V. S. LeBleu, Science 2020, 367, 6977.
J. J. Lai, Z. L. Chau, S. Y. Chen, J. J. Hill, K. V. Korpany, N. W. Liang, L. H. Lin, Y. H. Lin, J. K. Liu, Y. C. Liu, R. Lunde, W. T. Shen, Adv. Sci. 2022, 9, [eLocator: 2103222].
A. Girard, R. Sachidanandam, G. J. Hannon, M. A. Carmell, Nature 2006, 442, 199.
S. T. Grivna, E. Beyret, Z. Wang, H. Lin, Genes Dev. 2006, 20, 1709.
T. Watanabe, A. Takeda, T. Tsukiyama, K. Mise, T. Okuno, H. Sasaki, N. Minami, H. Imai, Genes Dev. 2006, 20, 1732.
D. M. Ozata, I. Gainetdinov, A. Zoch, D. O'Carroll, P. D. Zamore, Nat. Rev. Genet. 2019, 20, 89.
H. Y. Ku, H. Lin, Natl. Sci. Rev. 2014, 1, 205.
B. Czech, M. Munafò, F. Ciabrelli, E. L. Eastwood, M. H. Fabry, E. Kneuss, G. J. Hannon, Annu. Rev. Genet. 2018, 52, 131.
Y. Lin, J. Zheng, D. Lin, Semin. Cancer Biol. 2020, 104, 111.
P. Maleki Dana, M. A. Mansournia, S. M. Mirhashemi, Cell Biosci. 2020, 10, 44.
Y. Liu, M. Dou, X. Song, Y. Dong, S. Liu, H. Liu, J. Tao, W. Li, X. Yin, W. Xu, Mol. Cancer 2019, 18, 123.
T. Liu, J. Wang, L. Sun, M. Li, X. He, J. Jiang, Q. Zhou, Cell Cycle 2021, 20, 1603.
Y. J. Lee, S. U. Moon, M. G. Park, W. Y. Jung, Y. K. Park, S. K. Song, J. G. Ryu, Y. S. Lee, H. J. Heo, H. N. Gu, S. J. Cho, B. A. Ali, A. A. Al‐Khedhairy, I. Lee, S. Kim, Biomaterials 2016, 101, 143.
R. Jia, X. He, W. Ma, Y. Lei, H. Cheng, H. Sun, J. Huang, K. Wang, Anal. Chem. 2019, 91, 15107.
L. M. Zhang, Q. X. Gao, J. Chen, B. Li, M. M. Li, L. Zheng, J. X. Chen, W. J. Duan, Anal. Chim. Acta 2022, 1192, [eLocator: 339382].
L. M. Zhang, Q. X. Gao, B. P. Xie, J. Chen, W. J. Duan, Chem. Commun. 2022, 58, 5793.
Q. X. Gao, L. M. Zhang, Q. Q. Wu, F. F. Guo, J. Chen, M. M. Li, Y. Y. Wu, B. P. Xie, W. J. Duan, Sensor. Actuator. B. Chem. 2023, 393, [eLocator: 134272].
L. Y. Zhai, M. X. Li, W. L. Pan, Y. Chen, M. M. Li, J. X. Pang, L. Zheng, J. X. Chen, W. J. Duan, ACS Appl. Mater. Interfaces 2018, 10, 39478.
Y. Li, J. Deng, Z. Han, C. Liu, F. Tian, R. Xu, D. Han, S. Zhang, J. Sun, J. Am. Chem. Soc. 2021, 143, 1290.
J. Li, J. Wang, S. Liu, N. Xie, K. Quan, Y. Yang, X. Yang, J. Huang, K. Wang, Angew. Chem. Int. Ed. 2020, 59, 20104.
J. Liu, Y. Lu, Nat. Protoc. 2006, 1, 246.
Y. Hao, Y. J. Li, L. Song, Z. X. Deng, J. Am. Chem. Soc. 2021, 143, 3065.
D. S. Seferos, D. A. Giljohann, H. D. Hill, A. E. Prigodich, C. A. Mirkin, J. Am. Chem. Soc. 2007, 129, 15477.
A. Purushothaman, in The Extracellular Matrix, Vol. 1952 (Eds: D. Vigetti, A.D. Theocharis), Humana Press, New York, NY 2019, 1952, pp. 233–244.
Y. Chen, L. Y. Zhai, L. M. Zhang, X. S. Ma, Z. Liu, M. M. Li, J. X. Chen, W. J. Duan, Analyst 2021, 146, 2264.
P. Maleki Dana, M. A. Mansournia, S. M. Mirhashemi, Cell Biosci. 2020, 10, 44.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2025. This work is published under http://creativecommons.org/licenses/by/4.0/ (the "License"). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Increasing studies have demonstrated that PIWI‐interacting RNAs (piRNAs) in circulating exosomes can serve as novel molecular biomarkers for tumor liquid biopsy. However, methods for in situ detection of piRNAs encased in exosomes are limited. In this study, we designed a spherical nucleic acid probe named piR‐651, which can enter exosomes simply by incubating with them for 2 h and in situ detect piR‐651 with a detection limit of 5 × 107 particles/μL. Based on this probe, we established a liquid biopsy method for the in situ detection of piR‐651 in plasma exosomes. The assay could distinguish the expression levels of piR‐651 between 21 breast cancer patients and 22 healthy individuals. The receiver operating characteristic curve shows an area under the curve as 0.9931 and the diagnostic sensitivity and specificity at the best cutoff are 85.7% and 100%, respectively. The probe can also easily perform in situ imaging of piR‐651 in living cells. To avoid low sensitivity and kinetics in detecting large‐sized PIWI‐interacting RNA complexes, we rationally designed the structure and detection scheme of piR‐651 probe, which was synthesized by modifying 13‐nm gold particles with high‐density Anchor‐Report DNA duplexes through the butanol dehydration method. The new design of the gold nanoparticle nucleic acid probe can be applied to the fabrication of nucleic acid probes targeting other large‐volume nucleic acids for developing more molecular biomarker‐based liquid biopsy for cancer diagnosis.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
1 Guangdong Provincial Key Laboratory of New Drug Screening, School of Pharmaceutical Sciences, NMPA Key Laboratory for Research and Evaluation of Drug Metabolism and Guangdong‐Hong Kong‐Macao Joint Laboratory for New Drug Screening, Southern Medical University, Guangzhou, China
2 Pharmacy Department, Shenzhen Baoan District Shiyan People's Hospital, Shenzhen, China