1. Introduction
Ovarian development is a complex biological process involving numerous critical signaling pathways and gene regulatory mechanisms [1,2,3]. The process requires precise coordination of various molecular factors, including hormones, growth factors, and transcription factors, to ensure proper folliculogenesis, oocyte maturation, and ovulation [4]. Additionally, factors such as the IGF system, which regulates cellular growth, differentiation, and survival, play key roles in ovarian function and reproductive health [5]. Understanding the molecular and cellular dynamics involved in ovarian development is essential for advancing reproductive biotechnology and improving the management of animal breeding, particularly in aquaculture species [6,7,8].
Complex intraovarian IGF systems have been identified in fish, including spotted scats [2], rainbow trout [9], medaka [10], and zebrafish [11]. These systems comprise multiple ligands, such as IGF1, IGF2a, IGF2b, and IGF3, as well as receptors (IGF1R, IGF1R1, and IGF1R2) and IGF-binding proteins (IGFBPs) [8]. Although teleost fish serve as important models for studying ovarian development and the IGF system, there is limited information on the role of IGFs in ovarian development in golden pompano. The intraovarian expression profiles of the IGF system suggest its involvement in regulating ovarian development in teleosts [12]. In rainbow trout, as follicles mature, the expression of IGF1 and IGF2 transcripts increases in the gonads, similar to a previous study, while igfbp3 decreases, and igfbp6 and IGFBP-related protein-1 (igfbp-rP1) increase [13]. In coho salmon (Oncorhynchus kisutch), IGF1 binding was observed in both theca-interstitial and granulosa cell layers of the ovarian follicle [13,14].
Several studies have highlighted the specific physiological functions of IGFs in fish ovary [8,13,15,16,17,18]. IGF1 and IGF2 have been shown to enhance thymidine incorporation in the vitellogenic follicles of goldfish while also facilitating oocyte maturation in species such as rainbow trout, red seabream, mummichog, and shortfinned eel [17,19]. In vitro analysis of rainbow trout ovaries revealed that IGF1 mRNA levels did not significantly change during the acquisition of follicular maturational competence (FMC); IGF2 mRNA levels were significantly elevated in females exhibiting high FMC [12,20]. This suggests a functional role of IGF2 in folliculogenesis. This aligns with findings in mummichog, where IGF2 stimulates germinal vesicle migration and breakdown (GVBD), which is an indicator of meiosis resumption [21]. Notably, IGF1 has a more immediate and effective impact on oocyte maturation than 17α, 20β-dihydroxy-4-pregnen-3-one, which is the principal maturation-inducing steroid hormone (MIH) produced by the interaction of the theca and granulosa cell layers [22].
Long noncoding RNAs (lncRNAs) are transcripts with a total length of more than 200 nucleotides that do not encode proteins [23]. They are predominantly found in the nucleus, where they often outnumber the mRNAs. LncRNAs perform various biological functions by acting on protein-coding genes in cis and trans forms [24]. They are involved in numerous biological processes, such as germ cell growth, meiosis, gamete production, and sex differentiation [25,26]. Many studies have highlighted the crucial role of lncRNAs in reproductive development in various organisms [25,26,27,28,29]. LncRNAs interact with mRNAs, DNA, or proteins to regulate transcription, post-transcriptional modification, and translation, influencing cellular activities and physiological processes [30,31,32,33]. Although studies have demonstrated that lncRNAs play key roles in growth, energy metabolism, and reproduction, there is still little information on the molecular mechanisms by which lncRNAs regulate ovarian growth, development, and maturation in the golden pompano.
Trachinotus ovatus, commonly known as golden pompano, belongs to the Perciformes order and family Carangidae [34]. It is mainly cultivated along the southern coast of China because of its economic value [35,36]. However, achieving sexual maturity in captivity takes approximately three to four years, which greatly increases both the cost and risks of aquaculture. Our previous study highlighted the role of the IGF system in promoting growth and the reproductive system [34], but its specific involvement in reproductive processes remains poorly understood. Therefore, advancing research on the regulation of reproduction in golden pompano in response to the IGF system is essential for gaining a deeper understanding of the species’ endocrine regulatory network. This knowledge could potentially optimize breeding strategies and reduce the time and costs associated with aquaculture.
In the present study, RNA sequencing was performed to identify specific lncRNAs and mRNAs expressed in T. ovatus ovaries at stage III of development in response to IGF1 and IGF2 recombinant protein stimulation in vitro. Differentially expressed genes were identified, a protein–protein interaction (PPI) network was constructed, and key regulatory mechanisms involving lncRNAs and mRNAs related to ovarian development and maturation were identified. Given the economic and nutritional value of T. ovatus in aquaculture, challenges remain in its genetic breeding. Therefore, this study enhances our understanding of the physiological functions of IGFs and identifies prospective intervention targets for genetic enhancement in aquaculture.
2. Materials and Methods
2.1. Ethics Statement
All experiments were approved by the Animal Research and Ethics Committees of the Fisheries College of Guangdong Ocean University, Zhanjiang, Guangdong, China (ethical batch number: GDOU-IACUC-2021-A1229). All efforts were made to minimize pain.
2.2. Sample Treatment
First, we obtained recombinant IGF1 and IGF2 proteins; briefly, recombinant IGF1 and IGF2 proteins were produced by amplifying the T. ovatus coding sequence [34] using primers designed with Primer Premier 6 (Table S1). His-SUMO-tagged IGF1 (Wuhan GeneCreate Biological Engineering Co., Ltd., Wuhan, China) was cloned into the pET-SUMO vector; glutathione S-transferase (GST)-tagged IGF2 (LMAIBio, Shanghai, China) was cloned into the pGEXT-4T1 vector. Constructs were transformed into Escherichia coli rosetta2 (DE3) (Huamei Biotechnology, Wuhan, China) and cultured in 200 mL Luria–Bertani (LB) medium supplemented with antibiotics (IGF1: 50 µg/mL ampicillin and 50 µg/mL kanamycin; IGF2: 100 µg/mL ampicillin and 50 µg/mL chloramphenicol) at 37 °C until the OD600 reached 0.6–0.8. Protein was induced with 1 mM isopropyl β-D-thiogalactoside (IPTG, YEASEN, Shanghai, China) for 4–5 h at 37 °C, followed by cell lysis via sonication in Tris-HCl buffer (pH 8.0, 0.5 M NaCl). Proteins were purified using Ni-NTA affinity chromatography [37], and purity was confirmed by 12% SDS-PAGE.
Ovary samples were collected from six female T. ovatus with a body weight of 900 ± 20 g (mean ± SEM, n = 6). The in vitro incubation of ovarian tissue was performed according to the method described in our previous study [23], as shown in Figure 1. The treatment group was supplemented with a medium containing 1 nM and 5 nM of IGF1 and IGF2 recombinant proteins, respectively, while the control group was incubated without IGF1 and IGF2 recombinant proteins (n = 6 for each group). After 6 h of incubation, the samples were collected and stored at −80 °C for RNA extraction. Additionally, tissue samples were collected from three female (n = 3) and three male (n = 3) golden pompano. Twelve distinct tissues were isolated from each fish: brain, pituitary, gill, heart, liver, kidney, spleen, stomach, intestine, muscle, ovary (from females), and testis (from males). Each tissue type was collected in triplicate for subsequent RNA isolation.
2.3. RNA Library Construction and Sequencing
RNA extraction was performed using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s protocol. Briefly, tissues were homogenized in TRIzol, followed by phase separation with chloroform, RNA precipitation with isopropanol, and washing with ethanol. The purified RNA was dissolved in RNAse-free water. RNA concentration was quantified using a Qubit 3.0 (Thermo Fisher Scientific, Waltham, MA, USA) with RNA-specific fluorescent dyes to ensure accuracy, and RNA integrity was assessed using an Agilent 2100 (Agilent Technologies, Santa Clara, CA, USA), which generates an RNA Integrity Number (RIN; 1–10 scale) via microfluidic capillary electrophoresis. Samples with RIN > 7.0 were retained for downstream analysis, and RNA purity was confirmed by 1% agarose gel electrophoresis to visualize intact 28S/18S rRNA bands and rule out degradation or contamination. After quality control, the RNA was used to construct an RNA library. Initially, rRNA was removed using the Ribo-Zero Gold Kit (Epicentre Technologies, Madison, WI, USA), and the RNA was fragmented randomly using a fragmentation buffer. The first strand of cDNA was synthesized from the fragmented RNA, followed by synthesis of the complementary cDNA strand. After purification with VAHTS DNA Clean Beads (Vazyme, Nanjing, China), double-stranded cDNA was used for end repair, A-tailing, and sequencing adaptor ligation, resulting in the generation of cDNA library by PCR amplification. After confirmation of purity and quality, sequencing was performed using Illumina NovaSeq X Plus by Gene Denovo Biotechnology Co. (Guangzhou, China).
2.4. Sequencing Quality Control and Analysis
Raw sequencing data containing reads with adapter sequences, low-quality bases (q-value ≤ 20), or more than 50% unknown nucleotides (N) were filtered to produce clean data. These clean datasets were then aligned to the golden pompano genome (10.6084/m9.figshare.7570727.v3) using HISAT2 software version 2.2.0 [38] to obtain the mapped data. The mapped reads of each sample were assembled using StringTie (v1.3.0) [39]. Quality analysis and subsequent evaluation of the sequencing library were performed based on the mapped data, which included tests for insert length and randomness (Figure 1).
2.5. lncRNA Identification and Prediction
Candidate lncRNAs were identified using CNCI (version 2)
2.6. Identification of DE lncRNAs and mRNAs
Differentially expressed genes coding for lncRNAs and mRNA were analyzed using the DEseq2 package version 1.46.0 [40] to identify significant differences between the two groups. Genes with a parameter fold change (FC) ≥ 1.5 and p-value < 0.05 were considered differentially expressed genes.
2.7. Functional Enrichment Analysis
Functional enrichment analysis of target genes of the DE lncRNAs and DE mRNAs, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses, were performed by comparing the gene ontology database (
2.8. PPI Network Construction and Hub Genes Analysis
Differentially expressed genes (DEGs) were used to construct the PPI network using the STRING software version 12.0 [41]. Key clusters within the PPI network were identified using Molecular Complex Detection (MCODE) with a cut-off score threshold of >2 [42]. Hub genes within the network were selected using CytoHubba version 0.1 [43], based on a connection degree threshold of >2. The PPI network was visualized using the Cytoscape software version 3.0 [44].
2.9. lncRNA–mRNA Network Construction
To construct a preliminary network of lncRNAs and mRNAs, we focused on DE lncRNAs and mRNAs involved in reproduction and growth. Using the candidate lncRNAs and their target genes, a lncRNA–mRNA co-expression network was constructed and visualized using the Cytoscape software.
2.10. Validation by Real-Time Quantitative PCR
Total RNA was reverse-transcribed into cDNA using the PrimeScript™ RT Reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Kusatsu, Japan), followed by RT-qPCR using PerfectStart® Green qPCR SuperMix (TransGen Biotech, Beijing, China). PCR conditions were as follows: initial denaturation at 95 °C for 2 min, followed by 35 cycles of denaturation at 95 °C for 20 s, annealing at 60 °C for 20 s, and extension at 72 °C for 20 s. Gene expression levels were calculated using the 2−∆∆Ct method with β-actin as the housekeeping gene. All primer sequences were designed using Primer Premier 6.0 software, and are listed in Table 1.
2.11. Tissue Distribution of Candidate lncRNAs by RT-qPCR
The expression levels of the four candidate lncRNAs (MSTRG.26614.1, MSTRG.98390.1, MSTRG.77400.2, and MSTRG.84457.1) after IGF1 treatment and two candidate lncRNAs (MSTRG.20896.1, and MSTRG.58123.2) after IGF2 treatment were evaluated in different tissues (brain, pituitary gland, heart, gill, kidney, liver, stomach, intestine, spleen, muscle, ovary, and testis) using RT-qPCR. Details of RNA isolation, reverse transcription, and RT-qPCR protocols are described in Section 2.10. The primer sequences used for the lncRNAs are listed in Table 1.
2.12. Data Analysis
Statistical analysis was performed using SPSS 20.0 (SPSS, Chicago, IL, USA). One-way ANOVA followed by Tukey’s post-hoc test were used to analyze the significant difference, using a confidence level of p < 0.05. Data are expressed as the means ± SEM (n = 3).
3. Results
3.1. Overview of the RNA-Seq Results
Nine cDNA libraries were constructed and sequenced, resulting in 117,589,081,862 clean reads with an average Q30 above 94.91% after quality control. The clean reads were aligned to the golden pompano reference genome with alignment percentages ranging from 90.13% to 93.27% (Table 2). The mapped reads were used for transcript construction, and 3894 lncRNAs and 23,288 mRNAs were identified by CPC, CNCI, and Feelnc in response to IGF1 and IGF2 stimulation, as shown in Figure 2A,B.
3.2. Identification of the DE lncRNAs and mRNAs
A total of 1494 lncRNAs and 8728 mRNAs were differentially expressed following IGF1 stimulation compared to the control group, including 1328 upregulated and 166 downregulated lncRNAs (Figure 3A) and 8311 upregulated and 417 downregulated mRNAs (p < 0.05, FC ≥ 1.5) (Figure 3B). Following IGF2 treatment, 101 lncRNAs and 377 mRNAs were differentially expressed relative to the control group, comprising 41 upregulated and 60 downregulated lncRNAs (Figure 3F) and 185 upregulated mRNAs and 188 downregulated mRNAs (Figure 3D) (p < 0.05, FC ≥ 1.5). Volcano plots illustrate the distribution of upregulated and downregulated lncRNAs and mRNAs: IGF1-treated samples are shown in Figure 3C and Figure 3G for lncRNAs and mRNAs, respectively. IGF2-treated samples are displayed in Figure 3E,H for lncRNAs and mRNAs, respectively.
3.3. GO and KEGG Pathway Enrichment Analysis
To investigate the potential interactions between the DE lncRNAs and DE mRNAs, the target genes of all of the DE lncRNAs were predicted (Table S2). Subsequently, GO enrichment analysis was performed to identify the most significantly enriched GO terms associated with the DE lncRNAs and DE mRNAs in response to the control and IGF1 and IGF2 comparison groups. The results highlighted several enriched terms for biological processes, cellular components, and molecular functions. Similarly, GO enrichment analysis was performed specifically for the DE mRNAs, and the enrichment terms are presented in Figure 4A,B for the IGF1 group and Figure 4C,D for the IGF2 group.
There was a high degree of overlap between the enriched GO terms for the DE lncRNAs and DE mRNAs. Key shared terms in biological processes include cellular process, metabolic process, reproductive process, and biological adhesion. In terms of molecular functions, shared terms include binding, catalytic activity, molecular function regulator, and transporter activities. For cellular components, key overlapping terms included cell junction, extracellular matrix component, and membrane (more details are provided in Table S3). These results indicate that both lncRNA and mRNAs participate in closely related functional pathways, suggesting their potential regulatory roles in reproduction, growth, and hormonal signaling in T. ovatus under IGF treatments
KEGG pathway enrichment analysis was conducted to identify the functional pathways associated with the target genes of the DE lncRNAs and DE mRNAs (Table S4). The results revealed that the KEGG pathways enriched by target genes of the DE lncRNAs following IGF1 stimulation (Figure 5A,B) overlapped significantly with those enriched by the DE mRNAs, similar to IGF2 stimulation (Figure 5C,D). The key overlapping pathways included ECM receptor interaction, gap junction, Hedgehog signaling pathway, Ras signaling pathway, Rap1 signaling pathway, TGF beta signaling pathway, Wnt signaling pathway, GnRH signaling pathway, progesterone-mediated oocyte maturation, oocyte meiosis, cell cycle, and MAPK signaling pathway. These enriched pathways and overlapping characteristics highlight the crucial roles of both lncRNAs and mRNAs in regulating ovarian development and maturation, thereby providing valuable insights into the complex molecular mechanisms underlying IGF treatment in T. ovatus.
3.4. Construction of the PPI Network and the Identification of Hub Genes
3.4.1. The PPI Network Following IGF1 Stimulation
Based on the STRING analysis results, the PPI network for the control versus IGF1 comparison group comprised 41 nodes and 119 edges (Figure 6A). In addition, a specific PPI network of key genes related to ovarian growth, development, and maturation was constructed, comprising 16 hub genes and 38 edges. This specialized network includes key genes, such as cyp19a1, hsd17b7, hsd17b3, egr2b, soc3, dcm1, sox1a, fbxo5, star, egr1, sox4, axin2, cyp17a1, cdk15, foxl2, and wnt8 (Figure 6B).
3.4.2. The PPI Network Following IGF2 Stimulation
Based on the STRING analysis results for the control versus IGF2 comparison group candidate genes, a PPI network was constructed comprising 11 nodes and 13 edges, such as ccnk, h2ax, kank1, cdk5, cd209, myo15a, igfbp6, krt18, cdk6, foxn5, and htra1a (Figure 7). The analysis identified 11 hub genes associated with direct and indirect ovarian growth and development.
3.5. Construction of the lncRNA–mRNA Regulatory Network
3.5.1. The IGF1 lncRNA–mRNA Regulatory Network
To investigate the potential regulatory roles of lncRNAs and mRNAs in the ovary following IGF1 treatment, DE mRNAs associated with ovarian growth and maturation, along with the associated DE lncRNAs were randomly selected to construct a lncRNA–mRNA co-expression regulatory network. This network comprised 74 lncRNAs and 16 mRNAs (Figure 8A). Within this network, four lncRNAs (MSTRG.66521.1, MSTRG.49969.1, MSTRG.59923.1, and MSTRG.13767.1) were identified as target DE mRNAs related to ovarian growth and maturation (Figure 8B). These findings suggest that these lncRNAs may play significant roles in regulating ovarian development and maturation by modulating the expression of important genes in response to IGF1 treatment.
3.5.2. The IGF2 lncRNA-mRNA Regulatory Network
To explore the potential regulatory roles of lncRNAs and mRNAs in the ovary under IGF2 treatment, DE mRNAs associated with ovarian growth and maturation, along with the targeted DE lncRNAs, were selected to construct a lncRNA–mRNA co-expression network (Figure 9). This network included nine lncRNAs and nine mRNAs. Among these, two lncRNAs (MSTRG.20896.2 and MSTRG.58123.2) were identified as key regulators, targeting key DEGs related to ovarian growth and reproductive processes. These findings suggest that these specific lncRNAs may play critical roles in regulating the expression of reproductive and growth-related genes in the ovary, potentially influencing ovarian development and maturation.
3.6. Validation by RT-qPCR
To validate the RNA-Seq results, DE lncRNAs and DE mRNAs in response to IGF1 and IGF2 treatment were randomly selected for RT-qPCR analysis. The validation results showed that the expression trends for all nine DE mRNAs and four DE lncRNAs in the IGF1 comparison group were consistent with the RNA-Seq results (Figure 10A). Similarly, in the IGF2 comparison group, the expression trends for all 10 DE mRNAs and three DE lncRNAs matched the RNA-Seq results (Figure 10B). These consistent results from both RNA-Seq and RT-qPCR analyses confirmed the accuracy and readability of the RNA-seq data, providing further support for the identified gene expression changes in response to the IGF treatments.
3.7. Tissue Distribution of the Candidate lncRNAs
The expression distribution of the four candidate lncRNAs (MSTRG.26614.1, MSTRG.98390.1, MSTRG.77400.2, and MSTRG.84457.1), which target DEGs related to ovarian growth and development, was analyzed across 12 tissue types of golden pompano in the control versus IGF1 comparison groups using RT-qPCR. The results revealed that these four lncRNAs exhibited high expression levels in the brain, pituitary gland, liver, and gonads (Figure 11A–D). Furthermore, the expression distribution of the two lncRNAs (MSTRG.20896.2 and MSTRG.58123.2), which also target DEGs related to ovarian growth and development, was investigated across the same 12 tissue types in the control versus IGF2 comparison group. The results indicate that these lncRNAs were highly expressed in the brain, pituitary gland, and gonads (Figure 11E,F). These findings suggest the potential involvement of these lncRNAs in regulation of ovarian development and maturation in golden pompano through the action of IGFs.
4. Discussion
Ovarian development and maturation are governed by complex interactions between gene expression and environmental factors underpinned by intricate molecular regulatory networks [13,45,46]. IGFs play a vital role in various physiological processes, including embryonic development, sex differentiation, metabolism, immune responses, circadian rhythms, and stress adaptation in teleosts [47,48,49]. The IGF system reveals the complex mechanisms involved in ovarian growth, development, and maturation, which are initiated by the production of Müllerian Inhibiting Hormone (MIH) by the post-vitellogenic follicle complex [50,51]. Research has shown that IGFs can induce GVBD in vitro during the earlier stages of follicle development in many fish species [13]. In striped bass [48] and zebrafish [52], IGF1 has been shown to induce GVBD, even in maturation-inducing steroid (MIS) incompetent follicles [13,48]. However, in rainbow trout, in vitro treatment with either IGF1 or IGF2 did not induce GVBD, which is typically used as a marker for oocyte resumption [13]. Furthermore, when IGF1 peptide was co-incubated with MIS, it did not induce GVBD, suggesting that IGFs alone cannot induce oocyte maturational competence (OMC) as the ability of oocytes to respond to MIS [13]. Findings from previous studies suggest that the involvement of IGFs in regulating OMC has received less attention than their role in inducing oocyte meiosis resumption [20,22,53].
Understanding the complex regulatory mechanisms governing reproduction and growth in teleosts, particularly those governing ovarian growth, development, maturation, and ovulation, is crucial for the development of the aquaculture industry [54]. RNA-Seq analysis was performed to assess the lncRNA regulatory mechanisms involved in reproductive processes and identify key genes and transcriptomic changes at stage III of T. ovatus ovarian development in response to IGF1 and IGF2 protein treatment in vitro. In this study, we identified 1328 upregulated and 166 downregulated DE lncRNAs, while 8311 upregulated and 417 downregulated DE mRNAs were identified in the IGF1 group compared to the control group. In response to IGF2 stimulation, we identified 41 upregulated and 60 downregulated DE lncRNAs and 185 upregulated and 188 downregulated DE mRNAs. These findings provide insights into the transcriptomic landscape and molecular mechanisms regulated by IGFs, which may contribute to a deeper understanding of ovarian development and reproduction in teleosts, with implications for promoting genetic breeding for aquaculture development [23,26,55].
4.1. Differentially Expressed Genes and Their Regulatory Pathways
In this study, multiple differentially expressed genes encoding key enzymes involved in progesterone-mediated oocyte maturation and oocyte meiosis pathways, including cyp17a1, cyp19a1, star, hsd17b3, and hsd17b7, were identified. These genes are predominantly expressed in response to IGF1 stimulation during stage III of ovarian development, a phase marked by significant ovarian growth and maturation, as in most teleost species [37,56]. For instance, in Cynoglossus semilaevis, steroid hormones cyp17a1, cyp19a1, and hsd17b1 are highly expressed during stage V of ovarian development when oocytes reach full maturation [24,57]. However, their expression significantly decreased as oocytes transitioned from stages V to VI, suggesting that these genes play a pivotal role in stage III ovarian development and oocyte maturation [58,59]. In female rainbow trout, treatment with IGF2 upregulates star mRNAs, which encode ovarian steroidogenic enzymes [13,32]. These findings suggest that IGFs play a regulatory role in ovarian development and maturation by influencing steroid hormones production.
In both mammals and teleosts, oocyte meiotic division is essential for oocyte maturation. In fish, Foxn5 and foxl2 have been reported to be associated with the oocyte meiosis pathway along with the FoxO and TGF- β signaling pathways at different stages of ovarian development [52]. Studies have indicated that foxn5 and foxl2 play a critical role in regulating ovarian differentiation and development in vertebrates [36,49,53]. Foxl2 is primarily found in the granulosa cells and early ovarian stroma of vertebrates, and its knockdown leads to disorganized ovarian follicular development and, in some cases, partial ovary-to-testis sex reversal [50,60,61]. In Crassostrea gigas, foxl2 expression is significantly higher in mature females than in mature males, suggesting its involvement in vitellogenesis or female sex determination [62,63]. Previous studies in species such as spotted scats [61], rainbow trout [50], zebrafish [60], and Japanese flounder [50] have consistently demonstrated that foxl2 exhibits significant sex dimorphic expression patterns and plays an important role in gonadal differentiation and development in fish. In common carp, RNA interference targeting foxl2 leads to upregulation of cyp19b, emphasizing its regulatory role in ovarian development [64]. In the present study, in vitro treatment of T. ovatus ovaries with IGF1 and IGF2 upregulated foxl2 and foxn5, respectively.
Extracellular matrix (ECM) receptor interactions have been shown to play a significant role in cell cycle processes during ovarian remodeling, including follicular formation and ovulation [24,65]. The matrix metalloproteinase (MMP) family serves as the primary enzyme responsible for ECM remodeling [24]. In the present study, we identified several DEGs related to the reproductive cycle. Specifically, cdk15 and cdk14 were differentially expressed after IGF1 stimulation, whereas cdk5, cdk6, cd209, and ccnk were differentially expressed after IGF2 stimulation during stage III ovarian development. These genes are associated with the cell cycle pathway, which is essential for ovarian maturation. The cyclin-dependent kinase (cdk) model has become a cornerstone for understanding and studying cell cycle regulation [24,31,32,66].
In tongue sole, many DEGs related to cell adhesion have been identified at various stages of ovarian development, including krt18 [24,67]. Consistent with these findings, our study revealed a significant expression of cell adhesion-related genes, such as krt8 and krt18, in the ovary in response to IGF1 stimulation. This highlights the critical role of endocrine hormones in T. ovatus reproduction. Furthermore, the ECM-receptor interaction and focal adhesion pathways were enriched in both IGF1 and IGF2 treatment groups. These findings suggest that endocrine hormones are essential for reproductive processes.
Studies have explored the regulation of the Wnt signaling pathway in follicle development and corpus luteum (CL) formation [68,69]. Wnt signaling has been shown to promote follicular growth and mature oocyte production by influencing cell proliferation, differentiation, stem cell renewal, mortality, and apoptosis, as well as maintaining tissue homeostasis during embryogenesis [69,70,71]. β-catenin activation is strongly associated with the transition of primordial follicles to growing follicles, highlighting its role in follicular activation [69]. In rainbow trout, wnt11 and wnt9b are highly expressed in granulosa cells and oocytes during the later stages of ovarian development, highlighting their roles in folliculogenesis and oogenesis [46]. Similarly, in catfish, wnt4 and wnt5 are implicated in ovarian follicle development and play a key role in gonadal differentiation and maturation [46]. In the present study, wnt6 and wnt8 were significantly enriched in the ovary, which is consistent with findings from previous research. These results suggest that Wnt signaling pathways play an important role in regulating ovarian growth, development, and maturation, particularly in response to IGF treatment. This highlights the intricate interplay between the Wnt signaling pathway and IGF in supporting ovarian development and reproductive success.
The PI3K-Akt signaling pathway plays a pivotal role in regulating oocyte growth by controlling cell survival, metabolism, and nutrient uptake, thereby facilitating oocyte differentiation [19,72,73]. These integrated circuits ensure that ovarian maturation occurs at the right time and progresses correctly, which is critical for successful reproduction. The role of Akt in phosphorylating substrates involved in cell cycle progression helps ensure the proper maturation of oocytes [73]. Akt regulates metabolic processes by regulating mammalian target of rapamycin complex 1 (mTORC1), which is essential for protein synthesis and energy metabolism in oocytes [74,75]. In zebrafish, IGF1 enhances mitochondrial bioenergetics, boosting the ATP production required for oocyte maturation [12]. Dysregulation of the PI3K-Akt signaling pathway can impair reproductive potential, emphasizing its potential in maintaining oocyte health. In the present study, IGF treatment enriched the PI3K-AKT signaling pathway with genes, such as Tubulin Tyrosin Ligase-like 3 (ttll3), Kelch-like protein 11 (klhl11), KN Motif and Ankyrin Repeat Domain-Containing Protein 1 (kank1), and Insulin-like Growth Factor Binding Protein 6 (igfbp6), that are involved in regulating reproductive success and ensuring oocyte maturation.
4.2. Co-Expression and Tissue Distribution Analysis
Similar to the DE mRNAs, we identified several lncRNAs and target genes enriched in the same biological processes and pathways, including the cell cycle, oocyte meiosis, focal adhesion, and signaling pathways such as the MAPK, PI3K-Akt, GnRH, Wnt, FoxO, and Estrogen signaling pathways, as discussed previously in this study. These pathways regulate a wide range of physiological processes. Among the identified lncRNAs, four lncRNAs (MSTRG.66521.1, MSTRG.49969.1, MSTRG.59923.1, and MSTRG.13767.1) in response to IGF1 stimulation and two lncRNAs (MSTRG.20896.2, and MSTRG.58123.2) in response to IGF2 stimulation, are directly co-regulated with several DE mRNAs associated with ovarian development and maturation, including adam23, cyp19a1, cyp17a, slc26a6, htr2b, h2ax, nanos3, krt18, pgr, and inhbb, as shown in Figure 8 and Figure 9.
Specifically, inhbb and pgr were targeted by MSTRG.58123.3, while nanos3 and h2ax were regulated by MSTRG.20896.2 in response to IGF2 treatment. Interestingly, in zebrafish, the expression of inhbb remained relatively unchanged during follicle development but increased sharply in the ovary before spawning [76,77]. Moreover, we observed that these trans-target genes were enriched in the cell cycle and TGF-β signaling pathways. Members of the TGF-β family, including inhibin and activin, are essential for follicular development and steroidogenesis [77]. Disruption of PGR in zebrafish has been shown to result in female infertility due to unsuccessful ovulation, raising intriguing questions about whether the absence of PGR might also affect early follicle growth [24]. Furthermore, in common carp, the TGF-β signaling pathway plays a pivotal role in regulating lipids and vitellogenesis during ovarian growth [24,78]. These findings underscore the importance of these molecular mechanisms in regulating ovarian development and provide valuable insights for further exploration of the reproductive processes in fish.
Interestingly, treatment with IGF1 upregulated several lncRNAs, including MSTRG.66521.1, MSTRG.49969.1, MSTRG.59923.1, and MSTRG.13767.1, which target key genes, such as cyp19a1, cypq7a1, dmc1, eno1, htr2b, and csmd3. These genes are enriched in ECM receptor interaction and the Estrogen, MAPK, and PI3K-Akt signaling pathways [24]. Dysregulation of these pathways can lead to conditions such as polycystic ovary syndrome, which negatively affects fish fertility and oocyte maturation. Gonadotropin-releasing hormone (GnRH) plays a vital role in stimulating the release of gonadotropins, which are critical for initiating oocyte maturation [79]. In tilapia, GnRH signaling is linked to the timing of ovulation and the reproductive cycle. Similarly, in Cynoglossus semilaevis, specific lncRNAs (XR_522498.1 and XR_522499.1) and their target genes were enriched in the TGF-β and Wnt signaling pathways [24]. These findings are consistent with our results and further support the importance of these pathways in ovarian development and oocyte maturation.
Real-time quantitative PCR analysis of tissue distribution revealed that all candidate lncRNAs were highly expressed in the brain, pituitary gland, liver, and gonads of golden pompano. These findings, similar to those of previous studies [23,32,63], suggest that selected lncRNAs may play critical roles in regulating the growth and reproductive axis by regulating their target genes. Further studies involving functional validation, such as knockdown or overexpression of these lncRNAs, are necessary to elucidate their roles and effects on ovarian development and maturation.
5. Conclusions
In this study, we utilized RNA-seq technology to investigate lncRNA–mRNA regulatory mechanisms associated with the ovarian development of Trachinotus ovatus under IGF1 and IGF2 stimulation during stage III of ovarian development. According to the lncRNA–mRNA network, we found six lncRNAs, such as MSTRG.66521.1, MSTRG.49969.1, MSTRG.59923.1, MSTRG.13767.1, MSTRG.20896.2, and MSTRG.58123.2, that associated with the most of DEGs involved in ovarian development and oocyte maturation including cyp17a1, cyp19a1, star, hsd17b3, hsd17b7, dmc1, eno1, htr2b, csmd3, slc26a6, htr2b, h2ax, nanos3, krt18, pgr, and inhbb. These genes were associated with key pathways, such as oocyte meiosis, ECM receptor interaction, Estrogen, Wnt, FoxO, MAPK, TGF-β, GnRH signaling pathways, and focal adhesion. Tissue distribution analysis revealed that these candidate lncRNAs were dominantly expressed in the gonads, suggesting they may play critical roles in T. ovatus reproduction by regulating gene expression. The findings of this study provide insights into potential molecular mechanisms by which lncRNAs regulate mRNA expression in response to IGF stimulation that may regulate ovarian development and oocyte maturation. This study establishes a foundational framework for advancing targeted breeding strategies in golden pompano aquaculture and offers a model for understanding reproductive regulation in teleosts.
Conceptualization, C.B.N. and H.C.; methodology, H.C. and C.B.N.; software, Y.G., Z.J., M.F. and H.M.M.; validation, C.B.N. and H.C.; formal analysis, C.B.N. and Y.G; investigation, H.C.; resources, H.C.; data curation, C.B.N. and H.C.; writing—original draft preparation, C.B.N. and H.C.; writing—review and editing, C.B.N., Y.G., Z.J., M.F., H.M.M. and H.C.; visualization, C.B.N. and H.C.; supervision, H.C.; project administration, H.C.; and funding acquisition, H.C. All authors have read and agreed to the published version of the manuscript.
The Animal Research and Ethics Committees of the Fisheries College of Guangdong Ocean University, Zhanjiang, Guangdong, China, approved all experiments in this study (Ethical batch number: GDOU-IACUC-2021-A1229). All efforts were made to minimize pain.
Not applicable.
The data supporting this study’s findings are available upon reasonable request. The raw reads in this article have been deposited into the Sequence Read Archive (SRA) of the NCBI database under BioProject accession number: PRJNA1224432.
We acknowledge all funders of this work.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Figure 1 Schematic representation of the in vitro experimental design, including sample treatment and the RNA sequencing workflow.
Figure 2 Overview of RNA sequencing. (A) Number of lncRNAs and mRNAs. (B) Venn diagram according to annotation by CNCI, CPC2, and Feelnc.
Figure 3 Bar charts and volcano plot figures of the DE lncRNAs and DE mRNAs of the different comparison groups. (A): The number of upregulated and downregulated DE lncRNAs between the control and IGF1-treated groups. (B): The number of upregulated and downregulated DE lncRNAs between the control and IGF2-treated groups. (C): Volcano plot of the DE lncRNAs distribution between the control and IGF1-treated groups. (D): Volcano plot of the DE lncRNAs distribution between the control and IGF2-treated groups. (E): The number of upregulated and downregulated DE mRNAs between the control and IGF1-treated groups. (F): The number of DE mRNAs between the control and IGF2-treated groups. (G): Volcano plot of the DE mRNAs levels between the control and IGF1-treated groups. (H): Volcano plot of the DE mRNAs levels between the control and IGF2-treated groups. Green, blue, and pink colors represent lncRNAs, red, light blue, and golden colors represent mRNAs.
Figure 4 The top 10 GO enrichment analysis terms of the target genes of the DE lncRNAs and DE mRNAs between control and treatment groups. (A): DE lncRNAs between the control and IGF1 groups. (B): DE lncRNAs between the control and IGF2 groups. (C): Upregulated GO terms of the DE mRNAs between the control and IGF1 groups. (D): Downregulated GO terms of the DE mRNAs between the control and IGF1 groups. (E): Upregulated GO terms of the DE mRNAs between the control and IGF2 groups. (F): Downregulated GO terms of the DE mRNAs between the control and IGF2 groups. The terms related to biological process, cellular component, and molecular function for lncRNAs are presented by green, blue, and pink, respectively, while for the mRNAs, they are presented by yellow, light blue, and red, respectively.
Figure 5 KEGG pathway enrichment analysis of the target genes of the DE lncRNAs and DE mRNAs between different groups. (A) DE lncRNAs between control and IGF1, (B) DE lncRNAs between control and IGF2, (C) DE mRNAs between control and IGF1, (D) DE mRNAs between control and IGF2. The spot color represents the q-value of the enriched pathway. Spot size represents the number of genes enriched in each pathway.
Figure 6 The PPI network of the DEGs between the control and IGF1-treated groups. (A) The whole PPI network. (B) A specific PPI network focused on the genes related to reproduction.
Figure 7 The PPI network of the target DEGs related to ovarian development and oocyte maturation between the control and IGF2-treated groups.
Figure 8 Co-expression network of the DE lncRNAs and mRNAs. (A) Network map comprising 74 lncRNAs and 16 mRNAs. (B) Sub-network of the lncRNAs (MSTRG.66521.1, MSTRG.49969.1, MSTRG.59923.1, and MSTRG.13767.1). Blue arrow-shaped nodes represent lncRNAs, green arrow-shaped nodes represent target lncRNAs, and orange circular-shaped nodes represent mRNAs.
Figure 9 Co-expression network of the DE lncRNAs and mRNAs in response to IGF2 stimulation. The network map includes nine lncRNAs and nine mRNAs. Blue arrow-shaped nodes represent lncRNAs, green arrow-shaped nodes represent target lncRNAs (MSTRG.20896.2 and MSTRG.58123.2), and orange circular-shaped nodes represent mRNAs.
Figure 10 Validation of RNA-Seq results by RT-qPCR. Relative expression levels were measured using the 2−∆∆Ct method, normalized to the reference gene β-actin. Data are presented as mean ± standard error (SEM) (n = 3). One-way analysis of variance (ANOVA) followed by Tukey’s post hoc test was used to test the significance difference between control and treated groups at p < 0.05. * indicates p < 0.05 and ** indicates p < 0.01. (A) Validation of the nine DE mRNAs and four DE lncRNAs in control versus IGF1-treated groups. (B) Validation of 10 DE mRNAs and three DE lncRNAs in the control versus IGF2-treated group. Green and blue colors represent lncRNAs, while red and light blue colors represent mRNAs. The black color represents qPCR.
Figure 11 Tissue distribution of the lncRNAs. (A) MSTRG.26614.1, (B) MSTRG.98390.1, (C) MSTRG.77400.2, (D) MSTRG.84457.1, (E) MSTRG.20896.2, and (F) MSTRG.58123.2. Br, brain; Pi, pituitary; He, heart; Gi, gill; Ki, kidney; Li, liver: St, stomach; In, intestine; Sp, spleen; Mu, muscle; Ov, ovary; and Te, testis. Data are expressed as mean ± SEM (n = 3).
IGF1 and IGF2 primer sequences of the lncRNAs and mRNAs for the RT-qPCR analysis.
| ID Description | Gene Name | Primers (5′–3′) |
|---|---|---|
| SCSFRI_TO_T_00091676 | cyp19a1 | F: TGGCTCATGTGGATGTCCTCAGT |
| R: TGCTGTCCTGTGCTGCTGGTTA | ||
| SCSFRI_TO_T_00132967 | cyp17a1 | F: ACGCTCTGCTTCAACTCCTCCT |
| R: AAGATGTCCACCAGGCTGTCCTT | ||
| SCSFRI_TO_T_00065781 | adam23 | F: GTGGTGCTCGTTGCTGTGGA |
| R: GGCGTGGTGCTTGATGCTCT | ||
| SCSFRI_TO_T_00083864 | hsd17b7 | F: AGCCAGCTTCGCCTGTGTCT |
| R: ACCTCCTGAGCAGCAGTGAACA | ||
| SCSFRI_TO_T_00068502 | hsd17b3 | F: TGGTGACTGGTGCTTCAGAAGG |
| R: TGGCTACCTGGTCCAATGTTACTT | ||
| SCSFRI_TO_T_00052923 | sox3 | F: GAGCCAACGCCGTGAACAACT |
| R: GTAGGTCTGAGCCGAGGACATCA | ||
| SCSFRI_TO_T_00073261 | foxn5 | F: ACGCTGGGAGCCTCAAAGTC |
| R: CAGGTTGTGTCGGATGGTGTTC | ||
| SCSFRI_TO_T_00072390 | inhbb | F: GCAACGAGGTTCTAGCGGAGAC |
| R: ACACGGAAGTAGAGCCACAGGTT | ||
| SCSFRI_TO_T_00126075 | krt18 | F: ACCGCATCAGCATCTCCTCCA |
| R: CTCCAGGTTCCTCACTGTCTCCA | ||
| SCSFRI_TO_T_00025866 | h2ax | F: GTCGGTCGTGTTCACAGGCT |
| R: CCAGGATCTCAGCGGTCAGGTA | ||
| SCSFRI_TO_T_00061632 | nanos3 | F: ACCGCAAGAAGACGCCCAAG |
| R: CACAACACATCTCCTGCCTGGT | ||
| SCSFRI_TO_T_00003998 | kank1 | F: TGGCTCCAACAAGGCAACGAA |
| R: GGCTGGACACAGAGAACCACTC | ||
| SCSFRI_TO_T_00026350 | slc6a18 | F: CCCTGTGCTTTCCATCCCTCTG |
| R: CGGTTCCTCTGTTCCTGTGCTT | ||
| SCSFRI_TO_T_00012814 | pgr | F: GTTCAGAGGACGAATGTGGCTACG |
| R: TGCTGCTTCCTGTCGGTGTCA | ||
| SCSFRI_TO_T_00113132 | cdk15 | F: GCTGGTGGCTCTGAAGGTGATC |
| R: AGTCTCTGGCGTGGATGATGTCA | ||
| MSTRG.57329 | star | F: GAGGATGGATACAGCGAGGAGGAG |
| R: CCAATGTCAGGCAACACCTTACTCA | ||
| SCSFRI_TO_T_00138572 | axin2 | F: CGCAGAGAGTCGCCAAAGCAAT |
| R: TCCAGGTAGATGTCAGAGGTCAGAA | ||
| SCSFRI_TO_T_00073261 | β-actin | F: GAGAGGTTCCGTTGCCCAGAG |
| R: CAGACAGCACAGTGTTGGCGT | ||
| MSTRG.26614.1 | F: AACATCACGGCTCTTGGCTCTC | |
| R: GCTTGTGCTGGAGGCTGAAGT | ||
| MSTRG.98390.1 | F: CGCTGGCATTGGTCACATTCAC | |
| R: GAGAACGGTGTCCACTCCATCG | ||
| MSTRG.77400.2 | F: GACATGCCTGCTCTGTGATTGA | |
| R: CCACTCTGTCAGTACCGAGGAA | ||
| MSTRG.84457.1 | F: ATCGCCTTCCGTCCCTTCCA | |
| R: CCTCGCCTGCTGTTTGGTCAT | ||
| MSTRG.20896.2 | F: TGTCTGCCTGCTCCACATCCT | |
| R: TGTCCTCCCAGCCCTGTCATT | ||
| MSTRG.58123.2 | F: AGATAAGGAGTGCAGCCTGTGT | |
| R: CGCAAGGAGAACGGACAGAGA |
Summary of the reads after quality control.
| Sample | Clean Read Bases | Q20 (%) | Q30 (%) | Total Clean Reads | Mapped Reads | Mapping Ratio (%) |
|---|---|---|---|---|---|---|
| C1 | 15,630,440,161 | 98.17 | 94.96 | 1.11 × 108 | 1,332,878 | 91.75 |
| C2 | 13,264,457,783 | 98.37 | 95.34 | 94,414,990 | 1,897,056 | 90.71 |
| C3 | 12,982,764,898 | 98.16 | 94.91 | 91,848,966 | 1,367,594 | 91.24 |
| IGF1T1 | 13,110,122,504 | 98.31 | 95.26 | 93,054,020 | 1,202,186 | 92.21 |
| IGF1T2 | 13,516,459,173 | 98.25 | 95.13 | 98,391,424 | 3,977,422 | 90.13 |
| IGF1T3 | 12,471,670,121 | 98.38 | 95.44 | 91,910,782 | 3,211,596 | 91.53 |
| IGF2T1 | 13,269,497,776 | 98.33 | 95.28 | 97,543,940 | 1,117,334 | 92.94 |
| IGF2T2 | 14,829,071,350 | 98.29 | 95.14 | 1.09 × 108 | 971,076 | 93.06 |
| IGF2T3 | 14,431,477,858 | 98.42 | 95.47 | 1.05 × 108 | 1,243,074 | 93.27 |
Note: C refers to the control group, and T refers to the treated group.
Supplementary Materials
The following supporting information can be downloaded at:
1. Jia, Y.; Nan, P.; Zhang, W.; Wang, F.; Zhang, R.; Liang, T.; Ji, X.; Du, Q.; Chang, Z. Transcriptome Analysis of Three Critical Periods of Ovarian Development in Yellow River Carp (Cyprinus carpio). Theriogenology; 2018; 105, pp. 15-26. [DOI: https://dx.doi.org/10.1016/j.theriogenology.2017.08.027]
2. Li, Z.; Ren, X.; Guo, Y.; Ru, X.; Tian, C.; Shi, H.; Jiang, M.; Zhu, C.; Li, G.; Chen, H. Identification and Ovarian Developmental Regulation of Insulin-like Growth Factor 3 in Spotted Scat (Scatophagus argus). Aquac. Rep.; 2021; 21, 100866. [DOI: https://dx.doi.org/10.1016/j.aqrep.2021.100866]
3. Meijide, F.J.; Rey Vázquez, G.; Grier, H.J.; Lo Nostro, F.L.; Guerrero, G.A. Development of the Germinal Epithelium and Early Folliculogenesis during Ovarian Morphogenesis in the Cichlid Fish Cichlasoma dimerus (Teleostei, Perciformes). Acta Zool.; 2016; 97, pp. 18-33. [DOI: https://dx.doi.org/10.1111/azo.12101]
4. Yousefian, M.; Mousavi, S.E. The Mechanism of Reproduction and Hormonal Function in Finfish Species: A Review. Sci. Res. Essays; 2011; 6, pp. 3561-3570. [DOI: https://dx.doi.org/10.5897/sre10.015]
5. Gac, F.L.; Blaise, O.; Fostier, A.; Bail, P.L.; Maurice, L.; Mourot, B.; Weil, C. Growth Hormone (GH) and Reproduction: A Review. Fish Physiol. Biochem.; 1993; 11, pp. 219-232. [DOI: https://dx.doi.org/10.1007/BF00004569]
6. Reinecke, M. Insulin-like Growth Factors and Fish Reproduction. Biol. Reprod.; 2010; 82, pp. 656-661. [DOI: https://dx.doi.org/10.1095/biolreprod.109.080093] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19864315]
7. Zhong, H.; Hu, Y.; Yu, F. A Review on Ghrelin and Fish Reproduction. Reprod. Breed.; 2021; 1, pp. 128-135. [DOI: https://dx.doi.org/10.1016/j.repbre.2021.07.004]
8. Ndandala, C.B.; Dai, M.; Mustapha, U.F.; Li, X.; Liu, J.; Huang, H.; Li, G.; Chen, H. Current Research and Future Perspectives of GH and IGFs Family Genes in Somatic Growth and Reproduction of Teleost Fish. Aquac. Rep.; 2022; 26, 101289. [DOI: https://dx.doi.org/10.1016/j.aqrep.2022.101289]
9. Perrot, V.; Funkenstein, B. Cellular Distribution of Insulin-like Growth Factor II (IGF-II) MRNA and Hormonal Regulation of IGF-I and IGF-II MRNA Expression in Rainbow Trout Testis (Oncorhynchus mykiss). Fish Physiol. Biochem.; 1999; 20, pp. 219-229. [DOI: https://dx.doi.org/10.1023/A:1007735314871]
10. Yuan, Y.; Hong, Y. Medaka Insulin-like Growth Factor-2 Supports Self-Renewal of the Embryonic Stem Cell Line and Blastomeres in Vitro. Sci. Rep.; 2017; 7, 78. [DOI: https://dx.doi.org/10.1038/s41598-017-00094-y]
11. Higuchi, K.; Kazeto, Y.; Ozaki, Y.; Izumida, D.; Hotta, T.; Soyano, K.; Gen, K. Insulin-like Growth Factors 1 and 2 Regulate Gene Expression and Enzymatic Activity of Cyp17a1 in Ovarian Follicles of the Yellowtail, Seriola quinqueradiata. Heliyon; 2020; 6, e04181. [DOI: https://dx.doi.org/10.1016/j.heliyon.2020.e04181] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32566787]
12. Kwintkiewicz, J.; Giudice, L.C. The Interplay of Insulin-like Growth Factors, Gonadotropins, and Endocrine Disruptors in Ovarian Follicular Development and Function. Semin. Reprod. Med.; 2009; 27, pp. 43-51. [DOI: https://dx.doi.org/10.1055/s-0028-1108009] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19197804]
13. Weber, G.M. Effects of IGF1 and IGF2 on In Vitro Ovarian Follicle Maturation in Rainbow Trout, Oncorhynchus mykiss. Fishes; 2023; 8, 367. [DOI: https://dx.doi.org/10.3390/fishes8070367]
14. Moriyama, S.; Duguay, S.J.; Conlon, J.M.; Duan, C.; Dickhoff, W.W.; Plisetskaya, E.M. Recombinant Coho Salmon Insulin-like Growth Factor I: Expression in Escherichia coli, Purification and Characterization. Eur. J. Biochem.; 1993; 218, pp. 205-211. [DOI: https://dx.doi.org/10.1111/j.1432-1033.1993.tb18366.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/8243465]
15. Shimizu, M.; Swanson, P.; Dickhoff, W.W. Free and Protein-Bound Insulin-like Growth Factor-I (IGF-I) and IGF- Binding Proteins in Plasma of Coho Salmon, Oncorhynchus kisutch. Gen. Comp. Endocrinol.; 1999; 115, pp. 398-405. [DOI: https://dx.doi.org/10.1006/gcen.1999.7328]
16. Moreira, D.P.; Melo, R.M.C.; Weber, A.A.; Rizzo, E. Insulin-like Growth Factors 1 and 2 Are Associated with Testicular Germ Cell Proliferation and Apoptosis during Fish Reproduction. Reprod. Fertil. Dev.; 2020; 32, pp. 988-998. [DOI: https://dx.doi.org/10.1071/RD20128]
17. Pierce, A.L.; Breves, J.P.; Moriyama, S.; Hirano, T.; Grau, E.G. Differential Regulation of Igf1 and Igf2 mRNA Levels in Tilapia Hepatocytes: Effects of Insulin and Cortisol on GH Sensitivity. J. Endocrinol.; 2011; 211, pp. 201-210. [DOI: https://dx.doi.org/10.1530/JOE-10-0456]
18. Ahmed, S.J.; Mohammed, B.T. Biological Relationship between Insulin-like Growth Factors (Igf1 And Igf2) Genes And Steroidogenesis in Ovine Ovarian Antral Follicles. J. Univ. Duhok; 2022; 25, pp. 247-256. [DOI: https://dx.doi.org/10.26682/ajuod.2022.25.2.22]
19. Caruso, M.A.; Sheridan, M.A. New Insights into the Signaling System and Function of Insulin in Fish. Gen. Comp. Endocrinol.; 2011; 173, pp. 227-247. [DOI: https://dx.doi.org/10.1016/j.ygcen.2011.06.014]
20. Mukherjee, D.; Majumder, S.; Roy Moulik, S.; Pal, P.; Gupta, S.; Guha, P.; Kumar, D. Membrane Receptor Cross Talk in Gonadotropin-, IGF-I-, and Insulin-Mediated Steroidogenesis in Fish Ovary: An Overview. Gen. Comp. Endocrinol.; 2017; 240, pp. 10-18. [DOI: https://dx.doi.org/10.1016/j.ygcen.2016.09.002]
21. Mahardini, A.; Yamauchi, C.; Takeuchi, Y.; Rizky, D.; Takekata, H.; Takemura, A. Changes in MRNA Abundance of Insulin-like Growth Factors in the Brain and Liver of a Tropical Damselfish, Chrysiptera cyanea, in Relation to Seasonal and Food-Manipulated Reproduction. Gen. Comp. Endocrinol.; 2018; 269, pp. 112-121. [DOI: https://dx.doi.org/10.1016/j.ygcen.2018.09.001] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30189192]
22. Li, J.; Chu, L.; Sun, X.; Liu, Y.; Cheng, C.H.K. IGFS Mediate the Action of LH on Oocyte Maturation in Zebrafish. Mol. Endocrinol.; 2015; 29, pp. 373-383. [DOI: https://dx.doi.org/10.1210/me.2014-1218] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25584412]
23. Wang, Y.; Li, Z.; Guo, Y.; Nong, C.; Ndandala, C.B.; Yang, H.; Huang, H.; Li, G.; Chen, H. Analysis on LncRNA and MRNA Expression Profiles of IGF3-Induced Ovarian Maturation in Spotted Scat (Scatophagus argus). Aquac. Rep.; 2022; 27, 101367. [DOI: https://dx.doi.org/10.1016/j.aqrep.2022.101367]
24. Dong, Y.; Lyu, L.; Zhang, D.; Li, J.; Wen, H.; Shi, B. Integrated LncRNA and MRNA Transcriptome Analyses in the Ovary of Cynoglossus semilaevis Reveal Genes and Pathways Potentially Involved in Reproduction. Front. Genet.; 2021; 12, 671729. [DOI: https://dx.doi.org/10.3389/fgene.2021.671729]
25. García-Pérez, I.; Molsosa-Solanas, A.; Perelló-Amorós, M.; Sarropoulou, E.; Blasco, J.; Gutiérrez, J.; de la Serrana, D.G. The Emerging Role of Long Non-Coding RNAs in Development and Function of Gilthead Sea Bream (Sparus aurata) Fast Skeletal Muscle. Cells; 2022; 11, 428. [DOI: https://dx.doi.org/10.3390/cells11030428]
26. Deng, Q.; Zhao, N.; Zhu, C.; Zhang, B. Long Non-Coding RNAs in the Physiology of Aquaculture Animals: A Perspective Update. Rev. Fish Biol. Fish.; 2022; 32, pp. 1103-1122. [DOI: https://dx.doi.org/10.1007/s11160-022-09734-7]
27. Yang, Y.; Yujiao, W.; Fang, W.; Linhui, Y.; Ziqi, G.; Zhichen, W.; Zirui, W.; Shengwang, W. The Roles of MiRNA, LncRNA and CircRNA in the Development of Osteoporosis. Biol. Res.; 2020; 53, pp. 1-16. [DOI: https://dx.doi.org/10.1186/s40659-020-00309-z]
28. Zhou, Z.; Leng, C.; Wang, Z.; Long, L.; Lv, Y.; Gao, Z.; Wang, Y.; Wang, S.; Li, P. The Potential Regulatory Role of the LncRNA-MiRNA-MRNA Axis in Teleost Fish. Front. Immunol.; 2023; 14, 1065357. [DOI: https://dx.doi.org/10.3389/fimmu.2023.1065357]
29. Yang, C.; Zhao, Y.; Zhao, W.; Huang, H.; Zhang, Q.; Liu, J. CeRNA Profiling and the Role in Regulating Gonadal Development in Gold Pompano. BMC Genom.; 2025; 26, 43. [DOI: https://dx.doi.org/10.1186/s12864-025-11220-w]
30. Hao, R.; Zhu, X.; Tian, C.; Jiang, M.; Huang, Y.; Li, G.; Zhu, C. LncRNA–MiRNA–MRNA CeRNA Network of Different Body Colors in Plectropomus leopardus. Front. Mar. Sci.; 2023; 10, 1170762. [DOI: https://dx.doi.org/10.3389/fmars.2023.1170762]
31. Liu, B.; San, L.; Guo, H.; Zhu, K.; Zhang, N.; Yang, J.; Liu, B.; Hou, J.; Zhang, D. Transcriptomic Analysis Reveals Functional Interaction of MRNA-LncRNA-MiRNA in Trachinotus ovatus Infected by Cryptocaryon Irritans. Int. J. Mol. Sci.; 2023; 24, 5886. [DOI: https://dx.doi.org/10.3390/ijms242115886] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37958869]
32. Huang, T.; Gu, W.; Liu, E.; Shi, X.; Wang, B.; Wu, W.; Dong, F.; Xu, G. Comprehensive Analysis of MiRNA-MRNA/LncRNA during Gonadal Development of Triploid Female Rainbow Trout (Oncorhynchus mykiss). Genomics; 2021; 113, pp. 3533-3543. [DOI: https://dx.doi.org/10.1016/j.ygeno.2021.08.018] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34450291]
33. Meng, X.; Peng, H.; Ding, Y.; Zhang, L.; Yang, J.; Han, X. A Transcriptomic Regulatory Network among MiRNAs, PiRNAs, CircRNAs, LncRNAs and MRNAs Regulates Microcystin-Leucine Arginine (MC-LR)-Induced Male Reproductive Toxicity. Sci. Total Environ.; 2019; 667, pp. 563-577. [DOI: https://dx.doi.org/10.1016/j.scitotenv.2019.02.393]
34. Ndandala, C.B.; Zhou, Q.; Li, Z.; Guo, Y.; Li, G. Identification of Insulin-like Growth Factor ( IGF ) Family Genes in the Golden Pompano, Trachinotus ovatus: Molecular Cloning, Characterization and Gene Expression. Int. J. Mol. Sci.; 2024; 25, 2499. [DOI: https://dx.doi.org/10.3390/ijms25052499] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/38473747]
35. Luo, H.; Zhang, Y.; Ji, C.; Zhao, Y.; Peng, J.; Xu, Y. Golden Pompano Genome Resource Enables Discovery of Valuable Gene Determining Growth Traits. bioRxiv; 2021; 2021-05. [DOI: https://dx.doi.org/10.1101/2021.05.20.445047]
36. Liu, B.; Guo, H.Y.; Zhu, K.C.; Guo, L.; Liu, B.S.; Zhang, N.; Yang, J.W.; Jiang, S.G.; Zhang, D.C. Growth, Physiological, and Molecular Responses of Golden Pompano Trachinotus ovatus (Linnaeus, 1758) Reared at Different Salinities. Fish Physiol. Biochem.; 2019; 45, pp. 1879-1893. [DOI: https://dx.doi.org/10.1007/s10695-019-00684-9]
37. Li, J.; Liu, Z.; Wang, D.; Cheng, C.H.K. Insulin-like Growth Factor 3 Is Involved in Oocyte Maturation in Zebrafish. Biol. Reprod.; 2011; 84, pp. 476-486. [DOI: https://dx.doi.org/10.1095/biolreprod.110.086363]
38. Kim, D.; Langmead, B.; Salzberg1, S.L. HISAT: A Fast Spliced Aligner with Low Memory Requirements Daehwan HHS Public Access. Nat. Methods; 2015; 12, pp. 357-360. [DOI: https://dx.doi.org/10.1038/nmeth.3317]
39. Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie Enables Improved Reconstruction of a Transcriptome from RNA-Seq Reads. Physiol. Behav.; 2017; 176, pp. 139-148. [DOI: https://dx.doi.org/10.1038/nbt.3122]
40. Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol.; 2014; 15, 550. [DOI: https://dx.doi.org/10.1186/s13059-014-0550-8]
41. Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K.P.
42. Hogue, C.W.; Groll, M. An Automated Method for Finding Molecular Complexes in Large Protein Interaction Networks. BMC Bioinform.; 2001; 29, pp. 137-140.
43. Chin, C.H.; Chen, S.H.; Wu, H.H.; Ho, C.W.; Ko, M.T.; Lin, C.Y. CytoHubba: Identifying Hub Objects and Sub-Networks from Complex Interactome. BMC Syst. Biol.; 2014; 8, S11. [DOI: https://dx.doi.org/10.1186/1752-0509-8-S4-S11]
44. Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, T.J.; Daniel, R.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A Software Environment for Integrated Models. Genome Res.; 1971; 13, 426. [DOI: https://dx.doi.org/10.1101/gr.1239303]
45. Xu, R.; Li, Q.; Yu, H.; Kong, L. Oocyte Maturation and Origin of the Germline as Revealed by the Expression of Nanos-like in the Pacific Oyster Crassostrea gigas. Gene; 2018; 663, pp. 41-50. [DOI: https://dx.doi.org/10.1016/j.gene.2018.04.021]
46. Ma, H.; Gao, G.; Palti, Y.; Tripathi, V.; Birkett, J.E.; Weber, G.M. Transcriptomic Response of the Ovarian Follicle Complex in Post-Vitellogenic Rainbow Trout to 17α,20β-Dihdroxy-4-Pregnen-3-One In Vitro. Int. J. Mol. Sci.; 2024; 25, 12683. [DOI: https://dx.doi.org/10.3390/ijms252312683] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/39684392]
47. Sreenivasulu, G.; Sridevi, P.; Sahoo, P.K.; Swapna, I.; Ge, W.; Kirubagaran, R.; Dutta-Gupta, A.; Senthilkumaran, B. Cloning and Expression of StAR during Gonadal Cycle and HCG-Induced Oocyte Maturation of Air-Breathing Catfish, Clarias gariepinus. Comp. Biochem. Physiol. B Biochem. Mol. Biol.; 2009; 154, pp. 6-11. [DOI: https://dx.doi.org/10.1016/j.cbpb.2009.04.010]
48. Weber, G.M.; Sullivan, C.V. Effects of Insulin-like Growth Factor-I on in Vitro Final Oocyte Maturation and Ovarian Steroidogenesis in Striped Bass, Morone saxatilis. Biol. Reprod.; 2000; 63, pp. 1049-1057. [DOI: https://dx.doi.org/10.1095/biolreprod63.4.1049]
49. Zhu, B.; Pardeshi, L.; Chen, Y.; Ge, W. Transcriptomic Analysis for Differentially Expressed Genes in Ovarian Follicle Activation in the Zebrafish. Front. Endocrinol.; 2018; 9, 593. [DOI: https://dx.doi.org/10.3389/fendo.2018.00593]
50. Fan, Z.; Zou, Y.; Liang, D.; Tan, X.; Jiao, S.; Wu, Z.; Li, J.; Zhang, P.; You, F. Roles of Forkhead Box Protein L2 (Foxl2) during Gonad Differentiation and Maintenance in a Fish, the Olive Flounder (Paralichthys olivaceus). Reprod. Fertil. Dev.; 2019; 31, pp. 1742-1752. [DOI: https://dx.doi.org/10.1071/RD18233]
51. Nóbrega, R.H.; De Souza Morais, R.D.V.; Crespo, D.; De Waal, P.P.; De França, L.R.; Schulz, R.W.; Bogerd, J. Fsh Stimulates Spermatogonial Proliferation and Differentiation in Zebrafish via Igf3. Endocrinology; 2015; 156, pp. 3804-3817. [DOI: https://dx.doi.org/10.1210/en.2015-1157] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26207345]
52. Nelson, S.N.; Van Der Kraak, G. The Role of the Insulin-like Growth Factor (IGF) System in Zebrafish (Danio rerio) Ovarian Development. Gen. Comp. Endocrinol.; 2010; 168, pp. 103-110. [DOI: https://dx.doi.org/10.1016/j.ygcen.2010.04.021]
53. Hatef, A.; Unniappan, S. Metabolic Hormones and the Regulation of Spermatogenesis in Fishes; Elsevier Inc.: Amsterdam, The Netherlands, 2019; Volume 134, ISBN 3069667414
54. Rottmann, R.W.; Shireman, J.V.; Chapman, F.A. Hormonal Control of Reproduction in Fish for Induced Spawning; Southern Regional Aquaculture Center: Stoneville, MS, USA, 1991; Volume 424, pp. 1-4.
55. Guo, S.; Zhong, Y.; Zhang, Y.; Zhu, Y.; Guo, J.; Fu, Y.; Li, M. Transcriptome Analysis Provides Insights into Long Noncoding RNAs in Medaka Gonads. Comp. Biochem. Physiol. Part D Genom. Proteom.; 2021; 39, 100842. [DOI: https://dx.doi.org/10.1016/j.cbd.2021.100842]
56. Zhao, Z.; Zhao, Q.; Wang, H.; Wei, L.; Wang, S.; Li, S.; Yuan, D.; Wang, Z. Integrated Transcriptomic and Metabolomic Analyses Identify Key Factors in the Vitellogenesis of Juvenile Sichuan Bream (Sinibrama taeniatus). Front. Mar. Sci.; 2023; 10, 1243767. [DOI: https://dx.doi.org/10.3389/fmars.2023.1243767]
57. Xu, Y.; Wang, B.; Liu, X.; Shi, B.; Li, B. Recombinant Expression and Comparative Bioactivity of Tongue Sole Insulin-like Growth Factor (IGF)-1 and IGF-2 in Pichia Pastoris. Aquac. Res.; 2018; 49, pp. 2193-2200. [DOI: https://dx.doi.org/10.1111/are.13675]
58. Zhang, D.; Shi, B.; Shao, P.; Shao, C.; Wang, C.; Li, J.; Liu, X.; Ma, X.; Zhao, X. The Identification of MiRNAs That Regulate Ovarian Maturation in Cynoglossus semilaevis. Aquaculture; 2022; 555, 738250. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2022.738250]
59. Jia, Y.; Wang, F.; Zhang, R.; Liang, T.; Zhang, W.W.; Ji, X.; Du, Q.; Chang, Z. Identification of Suh Gene and Evidence for Involvement of Notch Signaling Pathway on Gonadal Differentiation of Yellow River Carp (Cyprinus carpio). Fish Physiol. Biochem.; 2018; 44, pp. 375-386. [DOI: https://dx.doi.org/10.1007/s10695-017-0441-5]
60. Lee, S.L.J.; Horsfield, J.A.; Black, M.A.; Rutherford, K.; Fisher, A.; Gemmell, N.J. Histological and Transcriptomic Effects of 17α-Methyltestosterone on Zebrafish Gonad Development. BMC Genom.; 2017; 18, 557. [DOI: https://dx.doi.org/10.1186/s12864-017-3915-z] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28738802]
61. He, F.X.; Jiang, D.N.; Huang, Y.Q.; Mustapha, U.F.; Yang, W.; Cui, X.F.; Tian, C.X.; Chen, H.P.; Shi, H.J.; Deng, S.P.
62. Liu, M.; Ni, H.; Rong, Z.; Wang, Z.; Yan, S.; Liao, X.; Dong, Z. Gonad Transcriptome Analysis Reveals the Differences in Gene Expression Related to Sex-Biased and Reproduction of Clam Cyclina sinensis. Front. Mar. Sci.; 2023; 9, 1110587. [DOI: https://dx.doi.org/10.3389/fmars.2022.1110587]
63. Li, J.; Zhou, Y.; Zhou, Z.; Lin, C.; Wei, J.; Qin, Y.; Xiang, Z.; Ma, H.; Zhang, Y.; Zhang, Y.
64. Wang, F.; Jia, Y.; Wang, P.; Yang, Q.; Du, Q.Y.; Chang, Z.J. Identification and Profiling of Cyprinus carpio MicroRNAs during Ovary Differentiation by Deep Sequencing. BMC Genom.; 2017; 18, 333. [DOI: https://dx.doi.org/10.1186/s12864-017-3701-y] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28454515]
65. Li, Z.; Guo, Y.; Ndandala, C.B.; Chen, H.; Huang, C.; Zhao, G.; Huang, H.; Li, G.; Chen, H. Analysis of CircRNA and MiRNA Expression Profiles in IGF3-Induced Ovarian Maturation in Spotted Scat (Scatophagus argus). Front. Endocrinol.; 2022; 13, 998207. [DOI: https://dx.doi.org/10.3389/fendo.2022.998207]
66. Zayed, Y. Characterization of Microrna Expression Profiles and Role of Nodal-Related Genes in Zebrafish Ovarian Follicles. Ph.D. Thesis; York University: Toronto, ON, Canada, 2019; Available online: http://hdl.handle.net/10315/40946 (accessed on 10 March 2025).
67. Abdellaoui, N.; Sun, M. Transcriptome Profiling of Gene Expression in Atlantic Salmon ( Salmo salar ) at Early Stage of Development. Mar. Biotechnol.; 2024; 26, pp. 964-974. [DOI: https://dx.doi.org/10.1007/s10126-024-10354-4]
68. Tenugu, S.; Pranoty, A.; Mamta, S.K.; Senthilkumaran, B. Development and Organisation of Gonadal Steroidogenesis in Bony Fishes—A Review. Aquac. Fish.; 2021; 6, pp. 223-246. [DOI: https://dx.doi.org/10.1016/j.aaf.2020.09.004]
69. Li, L.; Shi, X.; Shi, Y.; Wang, Z. The Signaling Pathways Involved in Ovarian Follicle Development. Front. Physiol.; 2021; 12, 730196. [DOI: https://dx.doi.org/10.3389/fphys.2021.730196] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34646156]
70. Hou, M.; Wang, Q.; Zhang, J.; Zhao, R.; Cao, Y.; Yu, S.; Wang, K.; Chen, Y.; Ma, Z.; Sun, X.
71. Safian, D.; Bogerd, J.; Schulz, R.W. Regulation of Spermatogonial Development by Fsh: The Complementary Roles of Locally Produced Igf and Wnt Signaling Molecules in Adult Zebrafish Testis. Gen. Comp. Endocrinol.; 2019; 284, 113244. [DOI: https://dx.doi.org/10.1016/j.ygcen.2019.113244]
72. Sobinoff, A.P.; Sutherland, J.M.; Mclaughlin, E.A. Intracellular Signalling during Female Gametogenesis. Mol. Hum. Reprod.; 2013; 19, pp. 265-278. [DOI: https://dx.doi.org/10.1093/molehr/gas065]
73. Reindl, K.M.; Kittilson, J.D.; Bergan, H.E.; Sheridan, M.A. Growth Hormone-Stimulated Insulin-like Growth Factor-1 Expression in Rainbow Trout (Oncorhynchus mykiss) Hepatocytes Is Mediated by ERK, PI3K-AKT, and JAK-STAT. Am. J. Physiol. Regul. Integr. Comp. Physiol.; 2011; 301, pp. R236-R243. [DOI: https://dx.doi.org/10.1152/ajpregu.00414.2010]
74. Barclay, R.D.; Burd, N.A.; Tyler, C.; Tillin, N.A.; Mackenzie, R.W. The Role of the IGF-1 Signaling Cascade in Muscle Protein Synthesis and Anabolic Resistance in Aging Skeletal Muscle. Front. Nutr.; 2019; 6, 146. [DOI: https://dx.doi.org/10.3389/fnut.2019.00146] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31552262]
75. Das, D.; Arur, S. Conserved Insulin Signaling in the Regulation of Oocyte Growth, Development, and Maturation. Mol. Reprod. Dev.; 2017; 84, pp. 444-459. [DOI: https://dx.doi.org/10.1002/mrd.22806] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28379636]
76. Lu, H.; Zhao, C.; Zhu, B.; Zhang, Z.; Ge, W. Loss of Inhibin Advances Follicle Activation and Female Puberty Onset but Blocks Oocyte Maturation in Zebrafish. Endocrinology; 2020; 161, bqaa184. [DOI: https://dx.doi.org/10.1210/endocr/bqaa184] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33045050]
77. Zhao, C.; Zhai, Y.; Geng, R.; Wu, K.; Song, W.; Ai, N.; Ge, W. Genetic Analysis of Activin/Inhibin β Subunits in Zebrafish Development and Reproduction. PLosGenet.; 2022; 18, e1010523. [DOI: https://dx.doi.org/10.1371/journal.pgen.1010523]
78. Wang, Y.Y.; Duan, S.H.; Wang, G.L.; Li, J.L. Integrated MRNA and MiRNA Expression Profile Analysis of Female and Male Gonads in Hyriopsis cumingii. Sci. Rep.; 2021; 11, 665. [DOI: https://dx.doi.org/10.1038/s41598-020-80264-7]
79. Sukhan, Z.P.; Cho, Y.; Hossen, S.; Yang, S.W.; Hwang, N.Y.; Lee, W.K.; Kho, K.H. Functional Characterization of Three GnRH Isoforms in Small Yellow Croaker Larimichthys polyactis Maintained in Captivity: Special Emphasis on Reproductive Dysfunction. Biology; 2022; 11, 1200. [DOI: https://dx.doi.org/10.3390/biology11081200]
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Guo Yuwen 2
; Ju Zhimin 2 ; Fachri Muhammad 2 ; Moses, Mwemi Happiness 2 ; Chen Huapu 1 1 Guangdong Research Center on Reproductive Control and Breeding Technology of Indigenous Valuable Fish Species, Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy Culture, Fisheries College, Guangdong Ocean University, Zhanjiang 524088, China; [email protected] (C.B.N.); [email protected] (Y.G.); [email protected] (Z.J.); [email protected] (M.F.); [email protected] (H.M.M.), Southern Marine Science and Engineering Guangdong Laboratory (Zhanjiang), Zhanjiang 524025, China
2 Guangdong Research Center on Reproductive Control and Breeding Technology of Indigenous Valuable Fish Species, Guangdong Provincial Key Laboratory of Aquatic Animal Disease Control and Healthy Culture, Fisheries College, Guangdong Ocean University, Zhanjiang 524088, China; [email protected] (C.B.N.); [email protected] (Y.G.); [email protected] (Z.J.); [email protected] (M.F.); [email protected] (H.M.M.)