Molecular Identification of Toxoplasma gondii in Domesticate and Industrial Chickens in Isfahan Region, Iran, 2022

Abstract

Toxoplasma gondii (T. gondii) is a pathogenic and zoonotic parasite, with warm blooded animals being considered as its hosts. Humans, especially immune defective subjects, may show serious symptoms of toxoplasmosis, while in poultry it can lead to an asymptomatic infection. Consumption of raw or undercooked meat of chickens can cause infection in human and other animals. So in this study, we identified and genotyped toxoplasmosis in chickens of Isfahan, Iran. After assessing blood samples from 60 domestic chickens and roosters, 60 industrial broiler chickens and roosters, and 60 laying hens and identifying the seropositive specimens by MAT test, the brain and tongue tissues of positive cases by serological tests were examined to identify the genotypes of T. gondii by nested PCR-RFLP. Molecular tests showed that toxoplasmosis was recorded in the brain tissue more than the tongue tissue, which can be attributed to the neurophilic nature of the parasite. The parasite strain in our samples was Genotype I. A significant percentage of domestic and industrial chickens and roosters were infected with T. gondii. Therefore, safe and hygienic methods of keeping and caring for chickens in domestic and industrial farms should be taken into consideration to prevent chickens from becoming infected. According to previous studies in human, environment, and livestock meat in Isfahan, Genotype I was predominant, which indicates the establishment of this genotype in the region.

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

1. Introduction

Toxoplasma infection is prevalent worldwide in herbivores, carnivores, and omnivores, encompassing all mammals and birds. This protozoan’s life cycle usually involves cats, small mammals, and birds [1, 2]. Nevertheless, humans and other warm-blooded vertebrates can become infected by ingesting food tainted with mature oocysts or tissue cysts of the parasite [3, 4]. This infection can lead to various clinical conditions such as encephalitis [3–5], myocarditis, chorioretinitis, abnormal fetal brain development [4, 6], and neonatal death [2, 3]. While toxoplasmosis is often asymptomatic in individuals with healthy immune systems, certain patient groups, such as fetuses and newborns with congenital infections and individuals with defective immune systems, are at high risk for severe infection caused by this parasite [7]. Human infections are usually caused by contaminated water or vegetables exposed to cat feces containing oocysts, as well as by consuming tissue cysts in undercooked and raw meat from other intermediate hosts [8–10]. However, the transmission of Toxoplasma gondii and the continuation of its life cycle in humans mostly occur through the ingestion of infected tissues of intermediate hosts such as birds, and these hosts have been infected following the consumption of oocysts [11–13].

There are numerous reports of toxoplasmosis in humans due to the consumption of contaminated meat [13, 14]. Some serological studies indicate that improper handling of meat is a much more significant source of human infection than contact with cats [13, 15, 16]. Animals such as goats, sheep, and poultry, including chickens and roosters, can be contaminated with Toxoplasma oocysts, and these animals can also infect humans through their meat [17, 18].

T. gondii was first identified in 1908 by Nicolle and Manceaux at the Pasteur Institute in Tunisia in a species of rodent from North Africa called Ctenodactylus gundi [14]. Human toxoplasmosis was first reported by Pinkerton and Weinman in 1940 after isolating the parasite from necrotic tissue lesions of a patient from Peru, who had died from a systemic infection accompanied by lymphadenopathy [1, 14]. In 1941, Sabin reported toxoplasmic encephalitis in children from the United States [1].

In some European countries, preventive policies and also screening the pregnant women consider against congenital toxoplasmosis, and these rules are followed by other countries [19].

The recent decade has seen a great development in genetics methods, and phylogenetic discoveries of T. gondii and also particular virulence of some genotypes have been discussed during the past years [20, 21]. Toxoplasma infection has been described in over 350 species of hosts, including mammals and wild birds [19] with environmental contamination being generally caused by wild intermediate hosts, through the shedding of oocysts by felids, both domestic and feral cats living near farms, and evidence indicates that Toxoplasmosis infection has been confirmed in 31 out of 39 felid species worldwide [20].

In this study, we aim to assess the presence of Toxoplasma infection in domestic and industrial chickens in the city of Isfahan using the PCR method [20–22]. The infection rate depends on the different factors that influence each population and expose them to infectious agents. Age, gender, and nationality, being in close touch with cats and dust as well as incorrect work and behavioral patterns are the most important key factors affecting infectious rates [23].

It is the first time a study like this has been conducted on Isfahan’s poultries with both domestic and industrial poultries being examined. We examined the samples by applying the PCR technique [24] to the GRA6 gene fragment and used the Mes1 enzyme to determine the genotype of T. gondii and identify the frequency of infection in different regions and study groups. Moreover, by identifying the seroprevalence, genotype, and its distribution pattern, the officials of health, medical, and veterinary services will be able to adapt more precise methods to prevent and control the spread of disease.

2. Materials and Methods

The current study is a part of a descriptive, cross-sectional general study based on the serological and molecular examination on the free-range and industrially raised chickens and roosters in Isfahan, 2022. The whole study consisted of two parts that for the first level, 180 samples were selected randomly, with 120 samples from industrial farming, divided into two groups of 60: broiler chickens and laying hens. The number of samples from domestic farming was 60. At this level, a modified agglutination test (MAT) was performed based on our previous article [17] to identify seropositive samples, and complementary molecular testing was done subsequently on seropositive samples. All tested specimens were obtained from industrial and domestic slaughterhouses were head tissues. The blood clot of these tissues was used for serological assessing, and the brain and tongue samples of seropositive cases were then used for molecular tests to investigate the genotypes of T. gondii in these dead animals by slaughtering.

The sample size in this study was calculated using the following formula [25]:$$\begin{array}{}\text{(1)}& N=\frac{{z_{1+}{z}_2}^{2}2p1-p}{d^2}.\end{array}$$

2.1. Performing of Nested PCR Reaction

2.1.1. Tissue Manipulation

To extract DNA from tissues, we used the phenol–chloroform method. After collecting and labeling the head samples, they were all stored in a freezer at −20°C until testing. Before beginning the test, all samples were removed from the freezer and placed in the laboratory environment for 1-2 h [26].

2.1.2. DNA Extraction

We utilized the Qiagen DNeas Blood and Tissue Kit for the extraction of DNA from tissue samples, and all DNA samples were placed in −20°C freezer until the next step.

2.1.3. Determining the DNA Concentration

Using a nanodrop spectrophotometer, we were able to ascertain if the extracted DNA was pure or contaminated with RNA or protein by measuring the absorbance ratio of a pure DNA sample at 260–280 nm. The 260 to 230 ratio was also used to look for chloroform, phenol, and detergents.

2.1.4. Nested PCR Method

We applied nested PCR to increase the sensitivity and specificity of detection of T. gondii. This method includes two steps of PCR and two pairs of each primary and secondary primers, so we applied GRA6 gene specific primers to identify T. gondii (Table 1) [26].

Table 1

Primers’ information.

Toxo1	Forward1	5′-ATT​TGT​GTT​TCC​GAG​CAG​GT-3′ (20 nucleotides)
	Reverse1	5′-GCA​CCT​TCG​CTT​GTG​GTT-3′ (18 nucleotides)
Toxo2	Forward2	5′-TTTCCGAGCAGGTGACCT -3′ (18 nucleotides)
	Reverse2	5′-TCG​CCG​AAG​AGT​TGA​CAT​AG-3′ (20 nucleotides)

The total volume of PCR solution is 15 μL, and for preparing the solutions, we used 0.2 cc microtubes placed on ice and also prepared stock solutions of forward and reverse primers (from Bioneer company, Korea) and work solutions based on the protocol described by the CinnaGen company. The solutions were prepared based on the information mentioned in Table 2.

Table 2

PCR solutions.

PCR1			PCR2
Solution	Final density	Volume (μL)	Solution	Final density	Volume (μL)
Master mix	2x	7.5	Master mix	2X	7.5
Distilled water	—	4.5	Distilled water	—	5.5
Primers (Work Solution 1)	20 pmol	1	Primers (Work Solution 2)	20 pmol	1
DNA	10–100 ng/μL	2	Product PCR1	—	1

After mixing and preparing the solutions, we spun the micrtubes and put them in the thermocycler device respecting the thermal protocol mentioned in Table 3.

Table 3

Nested PCR thermal condition.

Step	Temperature of PCR1	Temperature of PCR2	Time	Cycle
Initial denaturation	95°C	95°C	5 min	1
Denaturation	95°C	95°C	30 s	35
Annealing	58°C	57.5°C	30 s
Extension	72°C	72°C	30 s
Final extension	72°C	72°C	7 min	1
Soaking	4°C	4°C	∞	—

2.1.5. Preparation of the Electrophoresis of Products

The product of PCR in the first step with a length of 546 bp and second step with a length of 344 bp was loaded with positive control and negative control into the wells and electrophoresis was performed. The result evaluated by a gel doc device.

2.1.6. Nested PCR-RFLP Test

To determine the T. gondii, the following method was performed with the following requirements: gene GRA6 primers (Pishgaman Company, Iran), master mix: (Amplicon brand), sterile distilled water, molecular marker or ladder (100 or 50 bp), enzyme Mse1 (Table 4) (Thermo Scientific company), enzyme buffer, and sterile 2.0 mL microtubes.

Table 4

The characteristics of Mse1 enzyme.

Recognition sequence	5′…TTAA…3′3′…AATT…5′
After cut	5′…T↓TAA…3′3′…AAT↑T…5′
Heat denaturation	65°C for 5 min

To carry out the RFLP test, we mixed 5 μL of PCR products from the previous test with 0.5 μL of Mes1 enzyme and 1 μL buffer and then adjusted the solution volume to 15 μL by adding distilled water. This mixture was set in the thermos blocker at 65°C for 5 min. At the end of this procedure, we loaded 5 μL of this mixture onto a 3% agarose gel in an electrophoresis tank.

2.1.7. DNA Sequencing

For DNA sequencing, we used 25 μL of the PCR product, and this evaluation was performed at the research laboratory of the Isfahan Medical Science University. The obtained results were then analyzed with SnapGene software.

2.1.8. Statistical Analysis

The data analysis was performed by Chi-square test using SPSS 23.0. The statistically significant differences were considered $p<0.05$.

3. Results and Discussion

In this study, we utilized tongue samples from seropositive poultry as representatives of muscular tissue, along with brain samples, to conduct a molecular test. The average age for domestic samples was 12 ± 6 months; for broiler samples, it was 1.7 ± 0.2 months; and for laying hens, it was 22 ± 2 months. Results are shown in Tables 5 and 6.

Table 5

The results of the T. gondii contamination test with the molecular method in the brain in three groups.

$p$ value	Chi-square test	Percentage	Relative abundance	Positive samples			Groups
				Male	Female	Total
0.042	6.318	28.3	0.283	7	10	17	Domestic
		11.7	0.117	3	4	7	Broiler	Industrial
		23	0.33	—	20	20	Laying

Table 6

The results of the T. gondii contamination test with the molecular method in the tongue in three groups.

$p$ value	Chi-square test	Percentage	Relative abundance	Positive samples			Groups
				Male	Female	Total
0.05	3.571	10	0.100	3	3	6	Domestic
		1.7	0.017	0	1	1	Broiler	Industrial
		0	0	0	0	0	Laying

T. gondii infections have been reported in different studies around the world, and its prevalence in poultry farms has been noticed in several reports. These studies emphasize that consumption of raw, undercooked chicken meat can lead to human infection [27]. Serum tests are usually used to detect anti-Toxoplasma antibodies or parasite antigens in body fluids, and the MAT test is one of the most efficient serum tests in the detection of IgG-specific immunoglobulins against Toxoplasma [28–30]. Because it is possible to have false positive results in serum evaluation due to the cross-reactions, the specificity of this method is 92.29% and its sensitivity is 82.9% (39). Most of the previous studies have focused on serum evaluation, and the number of molecular tests was less than serum assessments. T. gondii antibodies (MAT titer: ≥ 1:40) were found in 33.3% of domestic chickens, 25% of broiler, and 50% of industrial laying chickens, which using the Chi-square test, a significant level of 0.039 was obtained. We found that there is a significant difference in the relative frequency with the serological method between the three groups [17]. A study performed in Khoramabad, Iran, showed that T. gondii was isolated from both tongue and brain tissue of poultries, and the infection rate was higher in the brain samples [31].

3.1. Identification and Genotyping of T. gondii

The results showed that the p value is equal to 0.042 and is between 0.01 and 0.05, so there is a meaningful difference between the three groups of the molecular test on the brain tissue samples.

The results showed that the $p$ value is equal to 0.05, so our data have a significant difference in the three groups of the molecular method performed on the tongue samples.

The T. gondii identification was performed by the molecular method (Figure 1).

[figure(s) omitted; refer to PDF]

The T. gondii isolates were genotyped by the nested PCR-RFLP (Figure 2). Enzymatic digestion of PCR reaction products of brain DNA samples is shown in Table 4 which reveals the region of 100 bp and 250 bp, related to Genotype I of T. gondii.

[figure(s) omitted; refer to PDF]

3.2. DNA Sequencing Results

After evaluating all samples, we found out that the 344 bp band which was more frequently observed in the brain tissue samples,refers to Genotype I:

“GYGYSTTCTWGAMGCAGGAAACAGCTTCGTGGTGCCACGTAGCGTGYTTGTTGGCGACTACCTTTTTTTCTTGGGAGTGTCGGCGAAATGGCACACGGTGGCATCCATCTGAGGCAGAAGCGTAACTTCTGTCCTGTAACTGTCTCCACAGTTGCTGTGGTCTTTGTAGTCTTCATGGGTGTACTCGTCAATTCGTTGGGTGGAGTCGCTGTCGCAGCAGACAGCGGTGGTGT↑TAAGCAGACCCCTTCGGAAACCGGTTCGAGCGGTGGACAGCAAGAAGCAGTGGGGACCACTGAAGACTATGTCAACTCTTTCGGCRAA”

Also, DNA sequencing results related to our research after alignment on the site https://www.ncbi.nlm.nih.gov revealed an identity of 99.02% and an overlapping 98%, with 344 bp nucleotide sequences obtained. Also, data of the current study complied with other researchers’ data (Table 7).

Table 7

Blast of sequence of the current study with similar investigation in NCBI.

Description	Query cover (%)	Per. ident	Accession	Tissue	References
Toxoplasma gondii isolate 84_Gra6_W__I_granule antigen protein 6 (GRA6) gene	96	98.71	MH429064.1	Raw meat	[32]
Toxoplasma gondii isolate TX-1-T granule antigen protein 6 gene	96	98.71	OL825741.1	Aborted sheep fetus	[33]
Toxoplasma gondii isolate 324/11_fox_E3_E4_gra6 granule antigen protein 6 gene	95	99.02	MG587986.1	Skeletal muscles of cattle, pig, fox, mountain deer, and wild boar	[34]
Toxoplasma gondii isolate 2 dense granule antigen protein GRA6 (GRA6) gene	95	99.02	MK705890.1	Paraffin blocks from aborted fetuses	[35]
Toxoplasma gondii isolate 49_Gra6__A_I_II granule antigen protein 6 (GRA6) gene	95	99.02	MH429063.1	Raw meat	[32]
Toxoplasma gondii GRA6 gene for dense granular antigen 6	95	99.02	LC414527.1	Samples of rodents and stray cats	[36]
Toxoplasma gondii isolate TgT2 granule antigen protein 6 (GRA6) gene	95	98.04	MK055339.1	Local slaughter cows	[37]
Toxoplasma gondii voucher ID_18-15_2 dense granule antigen GRA6 (GRA6) gene	95	98.04	MT370491.1	Sheep flock	[38]

Then, the RFLP (nested-PCR) test was performed on the brain and tongue of the positive serology sample. T. gondii DNA was detected in 44 brain tissue samples (55%) and seven tongue tissue samples (8.75%), and the brain had the highest rate which is aligned with the most other related studies. However, the amount of detected parasite in the tongue tissue was low, this amount also can indicate that muscles is also a tissue might be infected in chickens.

Using molecular methods, it has been demonstrated that Toxoplasma has three main genotypes: I, II, and III. There is very little difference between the strains isolated from humans and animals [12, 13]. Following these discoveries, numerous studies were conducted on toxoplasmosis in both humans and animals, some of which were performed to diagnose, manage, and screen the infection with T. gondii in pregnant women and newborn children, supported by three consecutive grants from the European Union [6].

Our study demonstrated that the examined samples from different regions of Isfahan were contaminated with Genotype I of T. gondii, and the results complied with previous studies carried out by other researchers. In agreement with all the abovementioned results, which are related to similar studies conducted in different parts of the world, it has been documented that the dominant strain of Toxoplasma which has infected the animals of our experiment is Type I. Although according to worldwide studies, Type II strains of T. gondii are the predominant among human samples in America and Europe, our study has demonstrated that Genotype I of T. gondii is the prevalent form in poultries of Isfahan, Iran [39–41].

For instance, a study conducted by Muhammad Bar Khan et al. in Pakistan, which demonstrated the prevalence of T. gondii in domesticated and broiler poultries, concluded that the high prevalence of T. gondii in humans may be associated with the parasite transmission through infected chicken’s meat in Pakistan [42]. Fallah et al.’s 2011 study demonstrated that meat products were contaminated by T. gondii. The PCR test was performed based on SAG2 gene, and samples were obtained from 15 different meat products companies, and the infection rates were 19.1, 15, and 56.6 in sausage, grilled meat, and hamburger. By performing RFLP on SAG2 gene, all samples were identified as Type I genotype. This study revealed that undercooked meat and its commercial products increase the risk of food-related toxoplasmosis [43]. Yu et al. conducted a study in Alabama, USA, by isolating T. gondii from various wild animals, including two short-tailed cats, the brain of a red-shouldered hawk, the heart and tongue of a white-tailed deer, and the brain of a bald eagle. They aimed to determine the parasite’s genotype using the PCR-RFLP method and genetic markers (Apico, PK1, L358, c29-2, c22-8, GRA6, BTUB, SAG3, SAG2, and SAG1), and the obtained data revealed two types of genotypes, including Types Ι and ΙΙ [44]. In 2017, Mahami Eskoi et al., in Tabriz, conducted the RFLP-nested PCR molecular test on 50 chickens using B1 and SAG2 genes in which about 8% of the chickens tested positive, and the genotype of the positive samples was Type I [45]. Another study performed by Fernando Emmanuel Gonçalves Vieira et al. in 2018 confirmed a high genetic diversity of T. gondii in southern Brazil [46]. The RFLP study of Khademvatan et al. on the tissues obtained from domestic chickens based on GRA6 gene showed that 80.4% of the genotypes were Type ΙΙΙ and 19.5% were Type ΙΙ [47].

4. Conclusion

Serological results of our previous study showed that relatively high levels of Toxoplasma infection were present in industrial laying chickens and in domestic chickens, more likely due to older age and exposure to parasite oocysts, respectively. In this study, brain tissue contamination was higher due to the age of the laying hens and the neurophilic nature of the parasite. Consequently, eating undercooked meat could be considered as a source of infection for humans. It is necessary to take preventive measures about the infection. By determining the genotypes of the Toxoplasma parasite in Isfahan poultry farms, the status and distribution of the parasite in the region have been achieved, and veterinary professionals and health education officials can adhere to stricter regulations to control the disease and its propagation, specifically in vulnerable groups. It will be crucial to establish preventative strategies against Toxoplasma distribution in the metropolis of Isfahan.

Funding

This research was financially supported by the Research Ethics Committees of School of Medicine—Isfahan University of Medical Sciences, Approval ID: IR.MUI.MED.REC.1398.429. This study was supported by a grant from Isfahan University of Medical Sciences, Iran, with grant number 398532.

Acknowledgments

This study was supported by a grant from Isfahan University of Medical Sciences, Iran, with grant number 398532. The authors would like to thank all staff of the Isfahan Veterinary Organization. We would like to express our gratitude to Sanaz Tavakoli for cooperation in this project.

References

[1] A. B. Sabin, "Toxoplasmic Encephalitis in Children," Journal of the American Medical Association, vol. 116 no. 9, pp. 801-807, DOI: 10.1001/jama.1941.02820090001001, 1941.

[2] E. Petersen, G. Vesco, S. Villari, W. Buffolano, "What Do We Know about Risk Factors for Infection in Humans with Toxoplasma Gondii and How Can We Prevent Infections?," Zoonoses and Public Health, vol. 57 no. 1,DOI: 10.1111/j.1863-2378.2009.01278.x, 2010.

[3] C. R. Stensvold, L. Storgaard, L. L. Maroun, J. A. L. Kurtzhals, H. V. Nielsen, "Toxoplasma Gondii-Associated Placentitis in the Absence of Maternal Seroconversion," Parasite Epidemiology and Control, vol. 19,DOI: 10.1016/j.parepi.2022.e00279, 2022.

[4] R. Dos Anjos Pinheiro Bogoevich Morais, E. Lima do Carmo, C. N. Carneiro Bichara, B. Ramos Dos Santos, K. W. Silva da Silveira, M. Marins Povoa, "Seroprevalence and Risk Factors Associated with T. Gondii Infection in Pregnant Individuals from a Brazilian Amazon Municipality," Parasite Epidemiology and Control, vol. 9,DOI: 10.1016/j.parepi.2020.e00133, 2020.

[5] A. Olsen, R. Berg, M. Tagel, "Seroprevalence of Toxoplasma Gondii in Domestic Pigs, Sheep, Cattle, Wild Boars, and Moose in the Nordic-Baltic Region: A Systematic Review and Meta-Analysis," Parasite Epidemiology and Control, vol. 5,DOI: 10.1016/j.parepi.2019.e00100, 2019.

[6] E. Petersen, V. Meroni, D. V. Vasconcelos-Santos, L. Mandelbrot, F. Peyron, "Congenital Toxoplasmosis: Should We Still Care about Screening?," Food and Waterborne Parasitology, vol. 27,DOI: 10.1016/j.fawpar.2022.e00162, 2022.

[7] M. Demar, D. Hommel, F. Djossou, "Acute Toxoplasmoses in Immunocompetent Patients Hospitalized in an Intensive Care Unit in French Guiana," Clinical Microbiology and Infection, vol. 18 no. 7, pp. E221-E231, DOI: 10.1111/j.1469-0691.2011.03648.x, 2012.

[8] M. Kaushik, S. C. Knowles, J. P. Webster, "What Makes a Feline Fatal in Toxoplasma Gondii’s Fatal Feline Attraction? Infected Rats Choose Wild Cats," Integrative and Comparative Biology, vol. 54 no. 2, pp. 118-128, DOI: 10.1093/icb/icu060, 2014.

[9] B. M. Mangiavacchi, F. P. Vieira, L. M. Bahia-Oliveira, D. Hill, "Salivary IgA against Sporozoite-specific Embryogenesis-Related Protein (TgERP) in the Study of Horizontally Transmitted Toxoplasmosis via T. Gondii Oocysts in Endemic Settings," Epidemiology and Infection, vol. 144 no. 12, pp. 2568-2577, DOI: 10.1017/S0950268816000960, 2016.

[10] K. Boyer, D. Hill, E. Mui, "Unrecognized Ingestion of Toxoplasma Gondii Oocysts Leads to Congenital Toxoplasmosis and Causes Epidemics in North America," Clinical Infectious Diseases, vol. 53 no. 11, pp. 1081-1089, DOI: 10.1093/cid/cir667, 2011.

[11] Z. D. Wang, S. C. Wang, H. H. Liu, "Prevalence and Burden of Toxoplasma Gondii Infection in HIV-Infected People: a Systematic Review and Meta-Analysis," The Lancet HIV, vol. 4 no. 4, pp. e177-e188, DOI: 10.1016/S2352-3018(17)30005-X, 2017.

[12] G. Milne, J. P. Webster, M. Walker, "Toxoplasma Gondii: AnUnderestimated Threat?," Trends in Parasitology, vol. 36 no. 12, pp. 959-969, DOI: 10.1016/j.pt.2020.08.005, 2020.

[13] M. Guo, J. P. Dubey, D. Hill, "Prevalence and Risk Factors for Toxoplasma Gondii Infection in Meat Animals and Meat Products Destined for Human Consumption," Journal of Food Protection, vol. 78 no. 2, pp. 457-476, DOI: 10.4315/0362-028X.JFP-14-328, 2015.

[14] D. J. Ferguson, "Toxoplasma Gondii: 1908-2008, Homage to Nicolle, Manceaux and Splendore," Memorias do Instituto Oswaldo Cruz, vol. 104 no. 2, pp. 133-148, DOI: 10.1590/s0074-02762009000200003, 2009.

[15] J. P. Dubey, E. G. Lago, S. M. Gennari, C. Su, J. L. Jones, "Toxoplasmosis in Humans and Animals in Brazil: High Prevalence, High Burden of Disease, and Epidemiology," Parasitology, vol. 139 no. 11, pp. 1375-1424, DOI: 10.1017/S0031182012000765, 2012.

[16] A. M. Tenter, A. R. Heckeroth, L. M. Weiss, "Erratum to “Toxoplasma Gondii: from Animals to Humans” [Int. J. Parasitol. 30 (2000) 1217–1258]," International Journal for Parasitology, vol. 31 no. 2, pp. 217-220, DOI: 10.1016/s0020-7519(01)00125-4, 2001.

[17] M. Sami, H. Yousofi-Darani, H. A. Yousofi, R. Kalantari, N. Pestehchian, "The Prevalence Rate of Infection to Toxoplasma Gondii in Domestic and Industrial Breeding Poultry in Isfahan City, Iran, 2020," Journal of Isfahan Medical School, vol. 39 no. 638, pp. 625-630, DOI: 10.22122/jims.v39i638.14259, 2021.

[18] T. Rahman, A. Rahman, S. Chakraborty, "Infection of Toxoplasma Gondii in Humans and Livestock Animals: An Emerging Silent Threat for Bangladesh," Open Journal of Medical Microbiology, vol. 08 no. 04, pp. 109-117, DOI: 10.4236/ojmm.2018.84010, 2018.

[19] B. Haghparast-Kenari, S. Sarvi, M. Sharif, E. Ahmadpour, S. A. Hosseini, A. Daryani, "Isolation and Genotypic Characterization of Toxoplasma Gondii Based on GRA6 Gene from Environmental Soil Samples in Mazandaran Province, North of Iran," Iranian Journal of Parasitology, vol. 15 no. 2, pp. 158-167, DOI: 10.18502/ijpa.v15i2.3297, 2020.

[20] F. Robert-Gangneux, M. L. Darde, "Epidemiology of and Diagnostic Strategies for Toxoplasmosis," Clinical Microbiology Reviews, vol. 25 no. 2, pp. 264-296, DOI: 10.1128/CMR.05013-11, 2012.

[21] K. Shapiro, L. Bahia-Oliveira, B. Dixon, "Environmental Transmission of Toxoplasma Gondii: Oocysts in Water, Soil and Food," Food and Waterborne Parasitology, vol. 15,DOI: 10.1016/j.fawpar.2019.e00049, 2019.

[22] M. Nasiru Wana, M. A. Mohd Moklas, M. Watanabe, "Molecular Detection and Genetic Diversity of Toxoplasma Gondii Oocysts in Cat Faeces from Klang Valley, Malaysia, Using B1 and REP Genes in 2018," Pathogens, vol. 9 no. 7,DOI: 10.3390/pathogens9070576, 2020.

[23] T. R. D. Santos, C. M. Nunes, M. C. Luvizotto, "Detection of Toxoplasma Gondii Oocysts in Environmental Samples from Public Schools," Veterinary Parasitology, vol. 171 no. 1-2, pp. 53-57, DOI: 10.1016/j.vetpar.2010.02.045, 2010.

[24] N. Pestechian, H. A. Yousefi, R. Kalantari, "Molecular and Microscopic Investigation of Sarcocystis Species Isolated from Sheep Muscles in Iran," Journal of Food Quality, vol. 2021,DOI: 10.1155/2021/5562517, 2021.

[25] J. P. Webster, J. P. Dubey, "Toxoplasmosis of Animals and Humans," Parasites & Vectors, vol. 3 no. 1,DOI: 10.1186/1756-3305-3-112, 2010.

[26] B. Armand, K. Solhjoo, M. S. Kordshooli, M. H. Davami, M. Pourahmad, V. Orfaee, "Toxoplasma Gondii Type I, Predominant Genotype Isolated from Sheep in South of Iran," Veterinary World, vol. 10 no. 4, pp. 386-392, DOI: 10.14202/vetworld.2017.386-392, 2017.

[27] A. Mercier, D. Ajzenberg, S. Devillard, "Human Impact on Genetic Diversity of Toxoplasma Gondii: Example of the Anthropized Environment from French Guiana," Infection, Genetics and Evolution, vol. 11 no. 6, pp. 1378-1387, DOI: 10.1016/j.meegid.2011.05.003, 2011.

[28] J. P. Dubey, "A Review of Toxoplasmosis in Wild Birds," Veterinary Parasitology, vol. 106 no. 2, pp. 121-153, DOI: 10.1016/s0304-4017(02)00034-1, 2002.

[29] A. Calderaro, S. Peruzzi, G. Piccolo, "Laboratory Diagnosis of Toxoplasma Gondii Infection," International Journal of Medical Sciences, vol. 6 no. 3, pp. 135-136, DOI: 10.7150/ijms.6.135, 2009.

[30] A. H. Khan, R. Noordin, "Serological and Molecular Rapid Diagnostic Tests for Toxoplasma Infection in Humans and Animals," European Journal of Clinical Microbiology & Infectious Diseases, vol. 39 no. 1, pp. 19-30, DOI: 10.1007/s10096-019-03680-2, 2020.

[31] S. F. Ahmadi, O. Zarifi, H. Shokrani, H. Norouzian, "Seroprevalence and Molecular Study of Toxoplasma Infection in Domestic Chickens from Khorramabad, Iran," Journal of Veterinary Research, vol. 75 no. 2, pp. 130-135, DOI: 10.22059/jvr.2019.245868.2725, 2020.

[32] J. Sroka, E. Bilska-Zając, A. Wójcik-Fatla, "Detection and Molecular Characteristics of Toxoplasma Gondii DNA in Retail Raw Meat Products in Poland," Foodbourne Pathogens & Disease, vol. 16 no. 3, pp. 195-204, DOI: 10.1089/fpd.2018.2537, 2019.

[33] "Toxoplasma Gondii Isolate TX-1-T Granule Antigen Protein 6 Gene," . https://www.ncbi.nlm.nih.gov/nuccore/OL825741

[34] E. Battisti, S. Zanet, A. Trisciuoglio, S. Bruno, E. Ferroglio, "Circulating Genotypes of Toxoplasma Gondii in Northwestern Italy," Veterinary Parasitology, vol. 253, pp. 43-47, DOI: 10.1016/j.vetpar.2018.02.023, 2018.

[35] N. Arefkhah, B. Pourabbas, Q. Asgari, "Molecular Genotyping and Serological Evaluation of Toxoplasma Gondii in Mothers and Their Spontaneous Aborted Fetuses in Southwest of Iran," Comparative Immunology, Microbiology and Infectious Diseases, vol. 66,DOI: 10.1016/j.cimid.2019.101342, 2019.

[36] E. S. Bahadori, J. Sadraei, A. Dalimi, S. Namroodi, M. Pirestani, "First Isolation of Toxoplasma Gondii from Rodents and Stray Cats in Northeast of Iran," Indian Journal of Animal Sciences, vol. 89 no. 5,DOI: 10.56093/ijans.v89i5.90010, 2019.

[37] G. A. Dalir, A. Dalimi, "Molecular Identification of Toxoplasma Gondii in the Native Slaughtered Cattle of Tehran Province, Iran," Journal of Food Quality and Hazards Control, vol. 6 no. 4, pp. 153-161, DOI: 10.18502/jfqhc.6.4.1993, 2019.

[38] M. Fernandez-Escobar, R. Calero-Bernal, J. Benavides, "Isolation and Genetic Characterization of Toxoplasma Gondii in Spanish Sheep Flocks," Parasites & Vectors, vol. 13 no. 1,DOI: 10.1186/s13071-020-04275-z, 2020.

[39] D. Ajzenberg, N. Cogne, L. Paris, "Genotype of 86 Toxoplasma Gondii Isolates Associated with Human Congenital Toxoplasmosis, and Correlation with Clinical Findings," The Journal of Infectious Diseases, vol. 186 no. 5, pp. 684-689, DOI: 10.1086/342663, 2002.

[40] M. Sharif, A. Amouei, S. Sarvi, "Genetic Diversity of Toxoplasma Gondii Isolates from Ruminants: A Systematic Review," International Journal of Food Microbiology, vol. 258, pp. 38-49, DOI: 10.1016/j.ijfoodmicro.2017.07.007, 2017.

[41] S. M. Alavi, L. Alavi, "Toxoplasmosis in Iran: A Guide for General Physicians Working in the Iranian Health Network Setting: A Systematic Review," Caspian J Intern Med, vol. 7 no. 4, pp. 233-241, 2016.

[42] M. B. Khan, S. Khan, K. Rafiq, S. N. Khan, S. Attaullah, I. Ali, "Molecular Identification of Toxoplasma Gondii in Domesticated and Broiler Chickens ( Gallus domesticus ) that Possibly Augment the Pool of Human Toxoplasmosis," PLoS One, vol. 15 no. 4,DOI: 10.1371/journal.pone.0232026, 2020.

[43] E. Fallah, M. Hajizadeh, S. Farajnia, M. Khanmahammadi, "SAG2 Locus Genotyping of Toxoplasma Gondii in Meat Products of East Azerbaijan Province, North West of Iran during 2010-2011," African Journal of Biotechnology, vol. 10 no. 62, pp. 13631-13635, DOI: 10.5897/ajb11.1732, 2011.

[44] L. Yu, J. Shen, C. Su, C. A. Sundermann, "Genetic Characterization of Toxoplasma Gondii in Wildlife from Alabama, USA," Parasitology Research, vol. 112 no. 3, pp. 1333-1336, DOI: 10.1007/s00436-012-3187-0, 2013.

[45] M. Mahami-Oskouei, M. Moradi, E. Fallah, F. Hamidi, N. Asl Rahnamaye Akbari, "Molecular Detection and Genotyping of Toxoplasma Gondii in Chicken, Beef, and Lamb Meat Consumed in Northwestern Iran," Iranian Journal of Parasitology, vol. 12 no. 1, pp. 38-45, 2017.

[46] F. E. G. Vieira, J. P. Sasse, A. F. Minutti, "Toxoplasma Gondii: Prevalence and Characterization of New Genotypes in Free-Range Chickens from South Brazil," Parasitology Research, vol. 117 no. 3, pp. 681-688, DOI: 10.1007/s00436-017-5730-5, 2018.

[47] S. Khademvatan, J. Saki, E. Yousefi, R. Abdizadeh, "Detection and Genotyping of Toxoplasma Gondii Strains Isolated from Birds in the Southwest of Iran," British Poultry Science, vol. 54 no. 1, pp. 76-80, DOI: 10.1080/00071668.2013.763899, 2013.