1. Introduction
As favorite fruits among consumers, cherry tomatoes are rich in carotenoids, vitamins, minerals, and other nutrients [1]. Cherry tomatoes are grown all over the world and have become one of the most important crops because of their sweet taste and nutritional value [2]. However, in the process of storage and transportation, it is often attacked by pathogenic fungi, which makes the fruit deteriorate and rot, bringing great economic losses [3]. Among the several pathogenic fungi, Alternaria alternata (Fries) Keissler is a common postharvest pathogen of cherry tomatoes, and it causes black spot disease. Fruit tissue affected by A. alternata will appear as black spots with black mold on the surface [4]. Chemical fungicides are used to control postharvest diseases in cherry tomatoes. Nevertheless, certain chemicals might induce resistance in pathogen populations. Furthermore, these chemical fungicides can endure in the soil and disrupt the ecological balance [5]. There is, therefore, a need for the development of greener and safer prevention methods.
Biological control is safer and friendlier than chemical control [6]. Antagonistic microorganisms have attracted considerable interest as a promising approach for managing postharvest diseases. Common biocontrol agents include bacteria, fungi, yeasts, etc. Antagonistic yeasts have been widely used and studied in plant disease control, and several bacteria also showed promising antagonistic characteristics to control postharvest diseases of fruits and vegetables [7,8,9]. Among them, Bacillus species are broad-spectrum antifungal, resistant, and can survive for a longer period, and some strains have been commercially applied as biocontrol agents [10]. Bacillus spp. can inhibit fungal growth by competing with them for nutrients and space, and it can also produce various antifungal compounds and induce plant resistance [11,12]. A previous study found that Bacillus amyloliquefaciens 9001 significantly reduces the occurrence of apple ring rot [13]. He et al. proved that Bacillus methylotrophicus BCN2 and Bacillus thuringiensis BCN10 have inhibitory effects on a number of diseases, which is beneficial for the storage and preservation of loquats [14]. Research has shown the ability of Bacillus to produce an array of antifungal secondary metabolites, including bacteriocins, antifungal proteins, and lipopeptides [11,12]. Heo et al. demonstrated that both volatile organic compounds (VOCs) and cell-free culture filtrates from Bacillus subtilis GYUN-2311 exhibited broad-spectrum antimicrobial activity against various pathogens [5]. Li demonstrated that the effect on the growth of several pathogenic fungi was significant in the cell-free filtrate of B. subtilis LY-1 [15]. Therefore, Bacillus species control of postharvest diseases instead of chemical fungicides is a more promising biological control strategy.
Enhancing fruit resistance enzymes and antioxidant enzymes with Bacillus species boosts disease resistance. It has been reported that Bacillus species can increase the activity of reactive oxygen species (ROS)-related enzymes and activate the ROS system, which is beneficial for plant disease resistance [16,17,18]. Wang et al. found that treatment with Bacillus licheniformis HG03 increased the activity of enzymes associated with resistance to peach fruit disease, reduced the accumulation of products of membrane lipid peroxidation and favored an extension of the storage period of the fruit [19]. B. subtilis JK-14 induced activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) in peach fruits. The induction of these three antioxidant enzymes enhanced the peach’s antioxidative defense system, which contributed to improved resistance to fungal pathogens [20]. Ji et al. found Bacillus. licheniformis W10 could increase defense enzyme activities and related gene expression levels in nectarine [21].
Our previous study identified a strain of Bacillus velezensis T3 that effectively controlled eggplant soft rot, reducing its incidence. The main antifungal substances were in cell-free filtrates [22]. However, its effectiveness against postharvest diseases in cherry tomatoes remains unknown. The present study assessed the disease-preventive potential of B. velezensis T3 in cherry tomatoes. The findings revealed that B. velezensis T3 application conferred significant protection against pathogen infection. This study further elucidated the underlying physiological mechanisms, focusing on both the direct inhibitory effects of bacterial cell-free filtrate and the induction of host defense responses. This comprehensive investigation provides valuable insights into the mechanisms by which B. velezensis T3 effectively controls postharvest black spot disease in cherry tomatoes.
2. Materials and Methods
2.1. Fruits
The cherry tomatoes, which were just starting to ripen, were purchased from Hanya Organic Farm in Zhenjiang, Jiangsu Province, China. Only undamaged, disease-free fruits with consistent size and coloration were used in the study. After washing the cherry tomatoes with water to get rid of any surface impurities, they were then subjected to sterilization for a duration of two minutes using a solution containing 0.1% sodium hypochlorite. The cherry tomatoes were then rinsed and left to dry.
2.2. Pathogen
Our research group previously isolated A. alternata from diseased cherry tomatoes and kept it at −80 °C. A 1 mL aliquot of fungal inoculum was aseptically transferred to sterile potato dextrose broth (PDB) and incubated for 24 h at 25 °C with continuous shaking (180 rpm). For spore production, fungal strains were grown on potato dextrose agar (PDA) at 25° C over a 7-day period. The developed cultures were subsequently processed by saline solution (0.9% sodium chloride) elution and filtration using multilayered sterile gauze to obtain spore suspensions. Spores were counted using a hemocytometer, with sterile saline adjusted to 1 × 105 spores/mL.
2.3. Bacterial Antagonist
The B. velezensis T3 strain utilized in the present investigation was obtained from the Chinese General Microbiological Culture Collection Center (CGMCC) and maintained under the assigned culture collection number M2022571. Bacterial cultures grown in LB broth (16 h, 28 °C, 180 rpm) were centrifuged (8000× g, 5 min, 4 °C). After sequential saline (0.9% NaCl) washes, the cells were reconstituted in distilled water and normalized to the specified concentration.
2.4. Efficacy of B. velezensis T3 in the Control of Black Spot Disease in Cherry Tomatoes
Sterilized cherry tomatoes were punctured using a sterile perforator, creating wounds with a diameter and depth of 3 mm at the equatorial position. 10 μL of different concentrations of B. velezensis T3 (1 × 106, 1 × 107, 1 × 108, 1 × 109 CFU/mL) were injected into the cherry tomato wounds, while sterile saline was utilized as a control. After 2 h of inoculation with B. velezensis T3, 10 μL of A. alternata spore suspension (1 × 105 spores/mL) was injected into the wound. After treatment, the fruit was stored under controlled conditions (20 °C, 95% RH). The decay incidence and lesion diameter of the pathogen across the cherry tomato wounds were measured and recorded after 3 days. Each treatment consisted of 20 cherry tomatoes, and there were three replicates for each treatment. To obtain a confirmatory result, the test was replicated twice. The following formula was used to determine the decay incidence:
Decay incidence (%) = (Number of decayed fruit)/(Total number of fruits assessed) × 100
2.5. Inhibition of Black Spot Disease in Cherry Tomatoes by Cell-Free Filtrate of B. velezensis T3
B. velezensis T3 was inoculated into 50 mL of LB medium and incubated for 24 h, 48 h, and 72 h, respectively, then the liquid was collected and centrifuged at 8000 rpm for 20 min at 4 °C. Centrifugation was followed by sterile filtration of the clarified liquid fraction through a 0.22 µm membrane. The supernatant obtained after three rounds of filtration was used as the cell-free filtrate.
2.5.1. In Vitro
The PDA plate was punctured to create a 5 mm hole. 50 μL of cell-free filtrate was added, along with LB medium as a control. After 2 h, 50 μL of A. alternata spore suspension was added. After the suspension was dried, the sample was immediately transferred to 25 °C. Colony diameters were measured after 3 days.
2.5.2. In Vivo
Cherry tomatoes were punched at the midpoint, dried, and injected with 10 μL of cell-free filtrate. Controls were injected with an equal amount of LB medium. After 2 h, tomatoes were inoculated with A. alternata (10 μL, 1 × 105 spores/mL), stored at 20 °C/95% RH. Disease progression was quantified by daily measurements of decay incidence and lesion diameter during days 3–5 of storage. Each treatment consisted of 20 cherry tomatoes with 3 replications, and whole experiments were repeated twice.
2.6. Effect of B. velezensis T3 on Resistance-Related Enzyme Activities of Cherry Tomatoes
From the experiment conducted in Section 2.4, we found that the concentration of the antagonistic bacteria at 1 × 108 CFU/mL showed the best results. Therefore, we used this concentration for the consecutive experiments. To determine the effect of B. velezensis T3 on resistance-related enzyme activities of cherry tomatoes, treatments of the fruits were conducted as described above: 10 μL (1 × 108 CFU/mL) of B. velezensis T3 was injected into the wounds. Control received equivalent sterile saline volume, maintained under identical incubation conditions (20 °C, 95% RH). Tissue samples were collected every 24 h (days 0–6). After aseptic removal of necrotic tissue, a 2 mm circumference of wound-adjacent tissue was excised for enzymatic assays.
2.6.1. Determination of Polyphenol Oxidase (PPO) Activity
The PPO activity assay followed Raynaldo et al. with modifications [23]. Samples (0.5 g) were processed with 1 mL of 50 mM phosphate buffer at pH 7.8, containing 1% PVP and 1.33 mM EDTA. The enzyme solution was combined with the catechol solution in a ratio of 0.2 mL to 2.8 mL, with the catechol solution having a concentration of 50 mM. One unit (U) of PPO was defined as a 0.1 absorbance rise at 390 nm per minute per gram of cherry tomato tissue.
2.6.2. Determination of Phenylalanine Ammonia-Lyase (PAL) Activity
With a minor modification, the Sun et al. approach was used to determine the PAL activity [24]. A total of 1 mL of 0.1 M borax-borate buffer (pH 8.8) was mixed with 0.5 g of cherry tomato tissue. After grinding in an ice bath, 400 µL of borax-borate buffer, 50 µL of L-phenylalanine, and 50 µL of enzyme solution were added to the tubes. The reaction was halted with 100 µL of HCl after 60 min at 37 °C. A 0.1 absorbance rise at 290 nm per minute per gram of cherry tomato tissue was used to compute one unit (U) of PAL.
2.6.3. Determination of β-1,3-glucanase (GLU) Activity
The determination of GLU activity was performed according to the published procedure of Lai et al. [25]. A total of 0.5 g of cherry tomato tissue was subjected to treatment with 1 mL of phosphate buffer solution (0.1 mol/L, pH 5.7), which contained 1 mM EDTA and 5 mM β-mercaptoethanol. The tissue was then ground and subsequently centrifuged in an ice bath. A total of 880 µL of phosphate buffer solution was combined with 20 µL of enzyme solution. 100 µL of 4% kombucha polysaccharide was added to the mixture. The mixture was incubated at 40 °C, boiled, and then cooled. A total of 1.5 mL of 3,5-dinitrosalicylic acid reagent was added, heated at 100 °C, then cooled on ice. The enzyme activity unit (U) of one GLU was taken as 1 mg of glucose produced per minute of substrate degradation.
2.6.4. Determination of Chitinase (CHI) Activity
Using the method described by Da Costa et al., the CHI activity was ascertained [26]. The extraction solution was identical to the one used for GLU extraction. The enzymatic assay was performed by incubating 20 μL of enzyme with 580 μL of phosphate buffer and 400 μL of 1% colloidal chitin (37 °C, 60 min). After boiling (10 min) to stop the reaction, 1.5 mL DNS was added and heated (100 °C, 10 min) for color development, followed by ice-cooling (15 min). Ultimately, the measurement of the reaction solution’s absorbance was conducted at a specific wavelength of 540 nm. The production of 1 μmol N-acetylglucosamine per minute of substrate degradation was considered as one unit (U) of CHI activity.
2.7. Effect of B. velezensis T3 on O2− Production Rate, H2O2 Content, and MDA Content of Cherry Tomatoes
The cherry tomatoes were treated in the same way as described in Section 2.5. The O2− generation rate and H2O2 content were measured using the methodology described by Zhu et al., and the results were expressed as µmol/min/g fresh weight and mg/g fresh weight, respectively [9]. Following the homogenization of 0.5 g tissue in 1 mL 10% TCA, the mixture was centrifuged (12,000 rpm, 10 min, 4 °C). The supernatant (200 μL) was then mixed with 300 μL enzyme extract and 500 μL TBA (6.7 g/L), and heated at 100 °C for 20 min. Absorbance measurements were taken at 450, 532, and 600 nm for MDA content determination.
2.8. Effect of B. velezensis T3 on the Activity of Antioxidant-Related Enzymes (Superoxide Dismutase (SOD), Peroxidase (POD), Catalase (CAT), and Ascorbate Peroxidase (APX)) in Cherry Tomatoes
Cherry tomatoes were treated as described in Section 2.5. The SOD enzymatic activity was determined according to the method described by Lin et al., and 50% inhibition of NBT reduction was defined as one unit (U) of SOD activity [27]. POD activity was measured following the technique of Feng et al., where an increase of 1 absorbance at 470 nm per minute per gram of cherry tomato tissue is considered as one unit (U) of POD [28]. CAT activity was determined by the method of Raynaldo et al., and one unit (U) of CAT was defined as 0.1 absorbance reduction at 240 nm per minute per gram of cherry tomato tissue [23]. APX activity was determined with reference to the method of Li et al. [29]. One unit of APX was defined as a reduction of 0.01 absorbance at 290 nm per gram of cherry tomato tissue per minute.
2.9. RT-qPCR for Detection of Expression Levels of Disease Resistance-Related Genes
The Bioengineering Plant RNA Extraction Kit’s instructions were followed to extract the cherry tomato RNA. HiScript II QRT SuperMix for qPCR (+gDNA wiper) was used to synthesize first-strand cDNA in accordance with the instructions, and SYBR Green SupermixTaq (Vazyme Biotech, Nanjing, China) was used for real-time fluorescence quantitative PCR (RT-qPCR). Primers used in this experiment are listed in Table 1.
2.10. Statistical Analysis
The statistical program SPSS version 26 (Chicago, IL, USA) was utilized to analyze the data. The Duncan’s multiple range comparison strategy was utilized for comparing means among more than two groups, while the t-test was implemented for comparing means between two groups. A statistical difference was deemed significant if the p-value was below 0.05. For every treatment, there were three independent replications.
3. Results
3.1. Efficacy of B. velezensis T3 in the Control of Black Spot Disease in Cherry Tomatoes
Figure 1A–C show the inhibition of blackspot disease in cherry tomatoes at different concentrations. All concentrations reduced the decay incidence and lesion diameter of cherry tomatoes. The decay incidence and lesion diameter of cherry tomatoes gradually decreased with increasing concentrations of B. velezensis T3. The decay incidence of the B. velezensis T3 treatment group with a concentration of 1 × 109 CFU/mL was much lower compared to other concentrations, at just 10%. The lesion diameter in the 1 × 109 CFU/mL B. velezensis T3 treatment group was 4.84 mm, which was less than in the other treatment groups and the control group. However, there was no noticeable distinction observed between the treatment groups that were administered 1 × 109 and 1 × 108 CFU/mL of B. velezensis T3. Thus, for the upcoming studies, a concentration of 1×108 CFU/mL of B. velezensis T3 was used.
3.2. Inhibition of Black Spot Disease in Cherry Tomatoes by Cell-Free Filtrate of B. velezensis T3
3.2.1. In Vitro
The inhibition of A. alternata by B. velezensis T3 cell-free filtrate is shown in Figure 2A,B. After 3 days of incubation, a significant reduction in A. alternata colony diameter was observed in the cell-free fermentation filtrate treatments compared to the control. The 72 h growth cell-free filtrate exhibited the strongest inhibitory effect on A. alternata colony growth among all tested samples.
3.2.2. In Vivo
The inhibition effect of B. velezensis T3 cell-free filtrate on black spot in cherry tomatoes is shown in Figure 3A–C. The cell-free filtrates with different growth times produced significant control effects on black spot disease in cherry tomatoes. Throughout the storage period, cherry tomatoes treated with cell-free filtrates collected at different growth periods consistently showed a lower decay incidence and lesion diameter than the control group. The filtrate treatment group obtained by antagonizing bacterial growth for 72 h showed the strongest inhibition of cherry tomato black spot. This treatment group’s decay rate and lesion diameter differed considerably from those of the control group and the other treatment groups.
3.3. Effect of B. velezensis T3 on Resistance-Related Enzyme (PPO, PAL, GLU, and CHI) in Cherry Tomatoes
The effects of B. velezensis T3 on the PPO and PAL activities of cherry tomatoes are shown in Figure 4A,B. Similar patterns of PPO activity variation were observed in treated and untreated fruit throughout the storage period. In both groups, PPO activity peaked on day 1. Moreover, PPO activity in the control group continuously exhibited lower levels compared to the group treated with B. velezensis T3. Furthermore, there was a substantial disparity between the two groups at days 1, 2, and 4. The PAL activity of control and B. velezensis T3-treated cherry tomatoes also showed similar trends, fluctuating up and down throughout the storage period. PAL activity differed significantly between groups on storage days 1, 4, and 6. The control group showed lower levels of PAL activity compared to B. velezensis T3. GLU activity changes were similar between treated and control samples over storage time. Significant differences between both groups at days 3, 5, and 6 (Figure 4C). The control group had lower GLU activity. With the exception of days 0 and 4, CHI activity showed a marked increase in B. velezensis T3-treated samples compared to controls (Figure 4D). Over a period of 0–4 days, the control group exhibited a reduction followed by an increase, whereas the B. velezensis T3-treated group showed an increase followed by a decline. The most significant disparity between the two groups occurred on day 2. In 4–6 days, both groups showed an increase and a subsequent decrease.
3.4. Effect of B. velezensis T3 on O2− Production Rate, H2O2 Content, and MDA Content of Cherry Tomatoes
According to Figure 5A, the rate of O2− generation in cherry tomatoes increased and then dropped in both the groups treated with B. velezensis T3 and the control group. B. velezensis T3 treatment maintained significantly lower O2− generation rates relative to untreated fruit across the entire storage period. The two groups differed significantly, except at days 0 and 4. On days 1, 2, 3, 5, and 6, the cherry tomatoes treated with B. velezensis T3 had a lower level of H2O2. (Figure 5B). The H2O2 content of the B. velezensis T3-treated group was relatively stable from 0–4 days, then decreased, and then increased on 4–6 days. The control group exhibited an initial rise followed by a decline during the first 4 days, subsequently demonstrating a progressive increase thereafter. MDA levels followed analogous trends in treated and control samples during storage (Figure 5C). The control group saw a peak in MDA content on day 1, followed by a decline. On the contrary, the B. velezensis T3-treated group maintained a low MDA level. Significant differences were seen between the two groups on days 1, 2, 3, and 6.
3.5. Effect of B. velezensis T3 on the Activity of Antioxidant-Related Enzymes (SOD, POD, CAT, and APX) in Cherry Tomatoes
Effect of B. velezensis T3 on SOD activity of cherry tomatoes is shown in Figure 6A. While both groups exhibited parallel SOD activity trends during storage, the B. velezensis T3-treated fruits consistently demonstrated elevated activity relative to controls at all time points. On days 2, 3, 4, and 6, the two groups showed significant differences. Throughout storage, both the group treated with B. velezensis T3 and the control group showed a gradual rise in the POD activity of cherry tomatoes (Figure 6B). B. velezensis T3-treated cherry tomatoes reached their highest POD on day 6, 1.53 times higher than the control. POD activity was significantly elevated in the treatment group relative to controls on days 3, 5, and 6 of storage. As shown in Figure 6C, CAT activity in treated fruit remained significantly higher than in controls at all measured time points. In particular, both groups differed significantly at days 1, 3, and 6. APX activity peaked at day 2 in all samples before decreasing, with treated fruit maintaining higher activity than controls throughout storage (Figure 6D).
3.6. Expression Levels of Related Genes
Figure 7 displays the gene expression levels for the enzymes PAL, APX, POD, CAT, and CHI, which are linked to defensive mechanisms in cherry tomatoes. B. velezensis T3 increased PAL expression in stored cherry tomatoes. On day 5, APX expression in the B. velezensis T3 group was 1.79 times higher than in the control. The POD expression in the treatment group peaked on day 4, which was 1.53 times greater than in the control group. The treatment groups’ CAT expression peaked at day 5, 1.7 times the control group’s level. The treatment group’s CHI expression peaked at day 5, 2.85 times the control group’s level.
4. Discussion
Black spot, also known as target spot or early blight, is a serious fungal disease mainly caused by A. alternata. Warm and wet growing conditions can favor the outbreak of this disease, and it causes significant losses in the cherry tomato industry in China and around the world. Various approaches have been proposed to control this disease, with chemical fungicides such as azoxystrobin considered the best method. With an increased interest in the use of organic treatments and environmental concern, other alternative approaches have been proposed to replace chemicals. The antifungal properties of Laurus nobilis oil are evident in its ability to restrict A. alternata growth, the pathogen causing black rot in cherry tomatoes [30]. The use of the antagonistic bacteria Rahnella aquatilis has been shown to have a promising result in reducing the susceptibility of tomato seedlings to bacterial spot disease caused by Xanthomonas campestris pv. vesicatoria [31].
Recently, Bacillus species have shown promise as bioantagonists to treat postharvest fruit and vegetable diseases. Therefore, this paper investigated the use of B. velezensis T3 in cherry tomato black spot to see if it could be controlled. Our results show that it is effective in controlling black spots on cherry tomatoes. As the concentration of B. velezensis T3 increased, the control of the decay incidence and lesion diameter of cherry tomatoes was more significant (Figure 1). Similar to observations by Bu et al., tomato treatments with higher B. subtilis doses showed markedly diminished disease incidence and more effective pathogen control [7]. Since lesion diameter did not differ significantly between the 1 × 108 and 1 × 109 CFU/mL B. velezensis T3 treatment groups, we concluded that 1 × 108 CFU/mL was the optimum concentration for control of black spot in cherry tomatoes. Researchers have identified other antagonistic Bacillus species that effectively control postharvest diseases. For example, B. amyloliquefaciens DH4 showed potent antagonistic activity against both Penicillium digitatum and P. italicum, which are among the most destructive postharvest pathogens in citrus [32]. B. subtilis Y17B, a safe alternative to fungicides, has shown significant inhibitory activity against A. alternata [11].
It is reported that antifungal compounds produced by Bacillus control postharvest diseases in fruit and vegetables [33]. Lipopeptides (surfactin, bacillomycin-D, fengycin, and bacillibactin), polyketide-type antimicrobial molecules (macrolactin, bacillaene, and difficidin), and other beneficial metabolites (siderophores, bacteriocins, and volatile organic compounds (VOCs) are just a few of the many bioactive metabolites that B. velezensis can produce [34]. Our research demonstrated that B. velezensis T3 cell-free filtrate controlled black spot disease in cherry tomatoes (Figure 2 and Figure 3), confirming that antagonistic bacteria’s secondary metabolites are key to combating pathogenic fungi. From Figure 3A,B, it seems to be evident that disease was just retarded by cell-free filtrate as both parameters (decay incidence and lesion diameter) increased with time on treated samples while no significant effect of time was found in control fruits. This may be due to the fact that cell-free filtrate did not kill all pathogenic fungi but only inhibited their growth. This inhibitory effect may prolong the freshness of the fruit, reduce postharvest losses, and provide some economic benefits, which is potentially valuable for application. However, the inhibitory effect of cell-free filtrate diminished over time, suggesting that further optimization is needed for commercial application, such as increasing the concentration of antifungal substances. Several studies have documented that various Bacillus strains are capable of producing lipopeptides, which contribute to their biocontrol potential. Ahmad et al. demonstrated that B. subtilis strain Y17B effectively suppresses A. alternata in cherry fruit, primarily through the abundant production of secondary metabolites, including lipopeptides [11]. Guo et al. identified B. amyloliquefaciens M73 as an effective antagonist of postharvest pathogens in Tarocco blood oranges, with lipopeptides serving as key bioactive compounds mediating this protective effect [35]. Evidence from other studies indicates that B. amyloliquefaciens LZN01 produces extracellular metabolites in its cell-free supernatant capable of antagonizing Fusarium oxysporum [36].
Fruit resistance induced by B. velezensis T3 is also an important defense mechanism. PPO is an important plant defence enzyme involved in secondary metabolism, converting phenolics into quinones, which have a strong toxic effect on pathogens [37]. Through its catalytic activity in the phenylpropanoid pathway, PAL directly mediates the synthesis of important biologically active metabolites. These include plant phenols and lignins, which are important antifungal compounds that inhibit the growth of pathogens [38]. The current investigation found that the activity of PPO and PAL in cherry tomatoes dramatically enhanced following treatment with B. velezensis T3. (Figure 4A,B), indicating the activation of the fruit defense system. GLU and CHI function synergistically as major fungal cell wall-degrading enzymes in plant defense systems.GLU hydrolyzes β-1,3-glucan, whereas CHI hydrolyzes chitin. Such lysis of structural components compromises fungal viability and restricts pathogenic growth [39]. Treatment with B. velezensis T3 increased GLU and CHI activities in cherry tomatoes, improving disease resistance. (Figure 4C,D). Therefore, B. velezensis T3 may protect the fruit from disease by enhancing defense-related enzymes.
Plants produce large amounts of reactive oxygen species (ROS) to defend themselves against various biotic or abiotic stresses as one of the early plant defense responses. However, excessive accumulation of ROS can lead to tissue damage in fruit cells. Oxidative stress from ROS overproduction promotes membrane lipid peroxidation, which structurally and functionally destabilizes the biofilm matrix, thereby eroding cellular integrity [40]. H2O2 and O2− are the major components of reactive oxygen species. The H2O2 and O2− levels of treated tomatoes were significantly lower (Figure 5A,B), suggesting that B. velezensis T3 enhances the scavenging ability of cherry tomatoes against ROS, reduces the accumulation of ROS, and has a good biocontrol effect. MDA assesses membrane lipid peroxidation [41]. B. velezensis T3 application effectively maintained MDA concentrations at reduced levels compared to untreated fruit (Figure 5C). Our findings reveal the antioxidant potential of B. velezensis T3, as evidenced by its ability to inhibit membrane lipid peroxidation and prevent oxidative injury in cherry tomatoes.
Numerous studies have shown that antioxidant-related enzymes such as SOD, POD, CAT, and APX play an important role in scavenging ROS [42,43,44]. SOD, the key enzyme for O2− elimination, converts mitochondrial-derived O2− to H2O2 and O2, while CAT and APX constitute the principal enzymatic systems for H2O2 removal, catalytically degrading it to H2O and O2. POD is a crucial resistance-catalyzing synthase involved in plant lignin synthesis, which can help to balance H2O2 levels in the plant cell wall, thus preventing pathogen invasion. These enzymes work in cooperation to efficiently halt the buildup of reactive oxygen species and inhibit membrane lipid peroxidation [45]. In the present work, we found that B. velezensis T3 significantly increased the activities of SOD, POD, CAT, and APX in cherry tomatoes (Figure 6), which suggests that B. velezensis T3 enhances ROS scavenging capacity, activating disease resistance in cherry tomatoes. The results align with those of prior research. As demonstrated by Bacillus licheniformis W10 treatment, the upregulation of both antioxidant and defense-related enzymatic activities in fruit correlates with significant inhibition of M. fructicola infection and brown rot development [21]. B. velezensis JZ51 increased antioxidant and defense enzyme activity, inducing disease resistance in apple fruit [38]. In addition, we randomly examined the effect of B. velezensis T3 on the expression of several representative resistance and antioxidant enzyme genes. B. velezensis T3 upregulates genes encoding the enzymes PAL, APX, POD, CAT, and CHI (Figure 7). These results provide more evidence for the theory that B. velezensis T3 increases the efficacy of defense-related enzymes and their expression, hence increasing disease resistance in cherry tomatoes.
5. Conclusions
In conclusion, this study showed that B. velezensis T3 had a promising efficiency to control black spot disease in cherry tomatoes. B. velezensis T3 can control disease through the production of antifungal substances. The cell-free filtrate of B. velezensis T3 had a significant inhibitory effect on the growth of A. alternata both in vivo and in vitro. In addition, B. velezensis T3 could induce host resistance and increase the activity of major disease-defense-related enzymes in cherry tomatoes. Furthermore, it can enhance the antioxidant potential of the fruit by stimulating the activity of key antioxidant enzymes. Concurrently, the activity of genes responsible for producing enzymes involved in the defense mechanism of cherry tomatoes was increased. While this study primarily evaluated the short-term biocontrol efficacy of B. velezensis T3 against cherry tomato black spot, our findings demonstrate its potential as an early-intervention strategy. However, further field studies are required to assess its long-term performance under natural conditions. Future research should explore optimized formulation strategies and integration with complementary approaches to enhance persistence in integrated postharvest disease management systems.
Conceptualization, Q.Y. and H.Z.; methodology, X.W.; validation, X.W.; formal analysis, X.W. and Q.Y.; data curation, X.W. and Q.Y.; writing—original draft preparation, X.W. and D.S.; writing—review and editing, X.Z., D.S., E.A.G., Y.L. and X.L.; project administration, H.Z.; funding acquisition, Q.Y. and H.Z. All authors have read and agreed to the published version of the manuscript.
Not applicable.
Not applicable.
The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.
The authors declare that they have no conflicts of financial interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Figure 1 Efficacy of B. velezensis T3 in the control of black spot on cherry tomatoes. (A) control of black spot disease in cherry tomato by B. velezensis T3; (B) decay incidence; (C) lesion diameter. CK: the control; 106–109: cherry tomatoes treated with a concentration of 1 × 106, 1 × 107, 1 × 108, and 1 × 109 CFU/mL. Groups marked with dissimilar letters differ significantly (p < 0.05).
Figure 2 Inhibitory effect of cell-free filtrate of B. velezensis T3 on A. alternata in vitro. (A) photographs of colonie. (B) colony diameter. CK: sterile saline-treated group; 24 h growth filtrate: 24 h growth filtrate treatment group; 48 h growth filtrate: 48 h growth filtrate treatment group; 72 h growth filtrate: 72 h growth filtrate treatment group; different letters above bars indicate statistically significant differences (p < 0.05).
Figure 3 Inhibitory effect of cell-free filtrate of B. velezensis T3 on A. alternata in vivo. (A) the control efficacy of cell-free filtrates obtained from B. velezensis T3 at different growth times against black spot disease in cherry tomatoes. (B) decay incidence. (C) lesion diameter. CK: Sterile saline-treated group; 24 h growth filtrate: 24 h growth filtrate treatment group; 48 h growth filtrate: 48 h growth filtrate treatment group; 72 h growth filtrate: 72 h growth filtrate treatment group; groups marked with dissimilar letters differ significantly (p < 0.05).
Figure 4 Effect of B. velezensis T3 on resistance-related enzyme activities in cherry tomatoes. (A) PPO activity. (B) PAL activity. (C) GLU activity. (D) CHI activity. CK: the control, sterile saline-treated cherry tomatoes; T3: Cherry tomatoes treated with B. velezensis T3. The asterisks indicate the statistically significant differences among treatments according to t-test (p < 0.05).
Figure 5 Effect of B. velezensis T3 on O2− production rate, H2O2 content, and MDA content of cherry tomatoes. (A) O2− production rate; (B) H2O2 content; (C) MDA content. CK: The control, sterile saline-treated cherry tomatoes;T3: Cherry tomatoes treated with B. velezensis T3. The asterisks indicate the statistically significant differences among treatments according to t-test (p < 0.05).
Figure 6 Effect of B. velezensis T3 on the activity of antioxidant-related enzymes in cherry tomatoes. (A) SOD activity; (B) POD activity; (C) CAT activity; (D) APX activity. CK: the control, sterile saline-treated cherry tomatoes; T3: cherry tomatoes treated with B. velezensis T3. The asterisks indicate the statistically significant differences among treatments according to t-test (p < 0.05).
Figure 7 Effect of B. velezensis T3 treatment on the expression of disease defence-related genes in cherry tomatoes. (A) PAL. (B) APX. (C) POD. (D) CAT. (E) CHI. Treatments: control (CK) and B. velezensis T3). The asterisks indicate the statistically significant differences among treatments according to t-test (p < 0.05).
Primer sequences used for RT-qPCR.
| Gene | GeneBank Number | Forward Primer (5′→3′) | Reverse Primer (3′→5′) |
|---|---|---|---|
| Actin | AB199316.1 | acaccctgttctcctgactg | agagaaagcacagcctggat |
| PAL | Solycl0g086180.2 | gcatccggtgatcttgttcc | cgaagccaaaccagaaccaa |
| APX | LC203076.1 | gaggcccgaaaattcccatg | caaatgagcagcaggggaag |
| POD | NM_001247041.2 | acagctcctccgaattccaa | ggaatcacgagcagcaagag |
| CAT | M37151 | tgttgagggggttgtcactc | cgtgaagtccaggagcaagt |
| CHI | FJ849060.1 | tggtggtagtgcaggaacat | tgtccagctcgttcgtagtt |
1. Qi, C.; Zhang, H.; Chen, W.; Liu, W. Curcumin: An innovative approach for postharvest control of Alternaria alternata induced black rot in cherry tomatoes. Fungal Biol.; 2024; 128, pp. 1691-1697. [DOI: https://dx.doi.org/10.1016/j.funbio.2024.02.005] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/38575242]
2. Liang, S.-Y.; Yang, S.; Ding, K.-X.; Xu, Y.; Zhao, Z.-Y.; Yu, Y.-Z.; Huang, Y.-X.; Qin, S.; Xing, K. 2-Methylbutyric acid functions as a potential antifungal fumigant by inhibiting Botrytis cinerea and inducing resistance to gray mold in cherry tomatoes. Postharvest Biol. Technol.; 2025; 222, 113343. [DOI: https://dx.doi.org/10.1016/j.postharvbio.2024.113343]
3. Zheng, L.; Gu, X.; Xiao, Y.; Wang, S.; Liu, L.; Pan, H.; Zhang, H. Antifungal activity of Bacillus mojavensis D50 against Botrytis cinerea causing postharvest gray mold of tomato. Sci. Hortic.; 2023; 312, 111841. [DOI: https://dx.doi.org/10.1016/j.scienta.2023.111841]
4. Rizwana, H.; Bokahri, N.A.; Alsahli, S.A.; Al Showiman, A.S.; Alzahrani, R.M.; Aldehaish, H.A. Postharvest disease management of Alternaria spots on tomato fruit by Annona muricata fruit extracts. Saudi J. Biol. Sci.; 2021; 28, pp. 2236-2244. [DOI: https://dx.doi.org/10.1016/j.sjbs.2021.01.014] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33935566]
5. Heo, Y.; Lee, Y.; Balaraju, K.; Jeon, Y. Characterization and evaluation of Bacillus subtilis GYUN-2311 as a biocontrol agent against Colletotrichum spp. on apple and hot pepper in Korea. Front. Microbiol.; 2024; 14, 1322641. [DOI: https://dx.doi.org/10.3389/fmicb.2023.1322641]
6. Duan, Z.; Song, H.; Shi, H.; Gao, Z.; Mao, J.; Cao, Y.; Huo, H.; Li, J.; Wang, X.; Lin, M. Postharvest treatment with Bacillus velezensis LX mitigates disease incidence and alters the microbiome on kiwifruit surface. Postharvest Biol. Technol.; 2024; 211, 112843. [DOI: https://dx.doi.org/10.1016/j.postharvbio.2024.112843]
7. Bu, S.; Munir, S.; He, P.; Li, Y.; Wu, Y.; Li, X.; Kong, B.; He, P.; He, Y. Bacillus subtilis L1-21 as a biocontrol agent for postharvest gray mold of tomato caused by Botrytis cinerea. Biol. Control.; 2021; 157, 104568. [DOI: https://dx.doi.org/10.1016/j.biocontrol.2021.104568]
8. Chen, K.; Tian, Z.; He, H.; Long, C.-A.; Jiang, F. Bacillus species as potential biocontrol agents against citrus diseases. Biol. Control.; 2020; 151, 104419. [DOI: https://dx.doi.org/10.1016/j.biocontrol.2020.104419]
9. Zhu, M.; Yang, Q.; Godana, E.A.; Huo, Y.; Hu, S.; Zhang, H. Efficacy of Wickerhamomyces anomalus in the biocontrol of black spot decay in tomatoes and investigation of the mechanisms involved. Biol. Control.; 2023; 186, 105356. [DOI: https://dx.doi.org/10.1016/j.biocontrol.2023.105356]
10. Da Silva, A.L.; Borges, Á.V.; da Silva, H.A.O.; Leite, I.C.H.L.; Alves, K.S.; de Medeiros, L.S.; Abreu, L.M.d. Lipopeptide-enriched extracts of Bacillus velezensis B157 for controlling tomato early blight. Crop Prot.; 2023; 172, 106317. [DOI: https://dx.doi.org/10.1016/j.cropro.2023.106317]
11. Ahmad, T.; Xing, F.; Nie, C.; Cao, C.; Xiao, Y.; Yu, X.; Moosa, A.; Liu, Y. Biocontrol potential of lipopeptides produced by the novel Bacillus subtilis strain Y17B against postharvest Alternaria fruit rot of cherry. Front. Microbiol.; 2023; 14, 1150217. [DOI: https://dx.doi.org/10.3389/fmicb.2023.1150217] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37032895]
12. Shafi, J.; Tian, H.; Ji, M. Bacillus species as versatile weapons for plant pathogens: A review. Biotechnol. Biotechnol. Equip.; 2017; 31, pp. 446-459. [DOI: https://dx.doi.org/10.1080/13102818.2017.1286950]
13. Li, Y.; Han, L.-R.; Zhang, Y.; Fu, X.; Chen, X.; Zhang, L.; Mei, R.; Wang, Q. Biological Control of Apple Ring Rot on Fruit by Bacillus amyloliquefaciens 9001. Plant Pathol. J.; 2013; 29, pp. 168-173. [DOI: https://dx.doi.org/10.5423/PPJ.SI.08.2012.0125]
14. He, C.-N.; Ye, W.-Q.; Zhu, Y.-Y.; Zhou, W.-W. Antifungal Activity of Volatile Organic Compounds Produced by Bacillus methylotrophicus and Bacillus thuringiensis against Five Common Spoilage Fungi on Loquats. Molecules; 2020; 25, 3360. [DOI: https://dx.doi.org/10.3390/molecules25153360]
15. Li, Y.; Zhang, X.; He, K.; Song, X.; Yu, J.; Guo, Z.; Xu, M. Isolation and Identification of Bacillus subtilis LY-1 and Its Antifungal and Growth-Promoting Effects. Plants; 2023; 12, 4158. [DOI: https://dx.doi.org/10.3390/plants12244158] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/38140485]
16. Seethapathy, P.; Gurudevan, T.; Subramanian, K.S.; Kuppusamy, P. Bacterial antagonists and hexanal-induced systemic resistance of mango fruits against Lasiodiplodia theobromae causing stem-end rot. J. Plant Interact.; 2016; 11, pp. 158-166. [DOI: https://dx.doi.org/10.1080/17429145.2016.1252068]
17. Bautista-Rosales, P.U.; Ochoa-Jiménez, V.A.; Casas-Junco, P.P.; Balois-Morales, R.; Rubio-Melgarejo, A.; Díaz-Jasso, Á.E.; Berumen-Varela, G. Bacillus mojavensis enhances the antioxidant defense mechanism of soursop (Annona muricata L.) fruits during postharvest storage. Arch. Microbiol.; 2022; 204, 578. [DOI: https://dx.doi.org/10.1007/s00203-022-03199-9]
18. Feng, P.; Zhang, X.; Godana, E.A.; Ngolong Ngea, G.L.; Dhanasekaran, S.; Gao, L.; Li, J.; Zhao, L.; Zhang, H. Control of postharvest soft rot of green peppers by Bacillus subtilis through regulating ROS metabolism. Physiol. Mol. Plant Pathol.; 2024; 131, 102280. [DOI: https://dx.doi.org/10.1016/j.pmpp.2024.102280]
19. Wang, X.; Zhu, J.; Wei, H.; Ding, Z.; Li, X.; Liu, Z.; Wang, H.; Wang, Y. Biological control efficacy of Bacillus licheniformis HG03 against soft rot disease of postharvest peach. Food Control.; 2022; 145, 109402. [DOI: https://dx.doi.org/10.1016/j.foodcont.2022.109402]
20. Zhang, S.; Zheng, Q.; Xu, B.; Liu, J. Identification of the Fungal Pathogens of Postharvest Disease on Peach Fruits and the Control Mechanisms of Bacillus subtilis JK-14. Toxins; 2019; 11, 322. [DOI: https://dx.doi.org/10.3390/toxins11060322]
21. Ji, Z.-L.; Peng, S.; Zhu, W.; Dong, J.-P.; Zhu, F. Induced resistance in nectarine fruit by Bacillus licheniformis W10 for the control of brown rot caused by Monilinia fructicola. Food Microbiol.; 2020; 92, 103558. [DOI: https://dx.doi.org/10.1016/j.fm.2020.103558] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32950152]
22. Zhang, X.Y.; Xin, Y.; Wang, J.Y.; Dhanasekaran, S.; Yue, Q.R.; Feng, F.P.; Gu, X.Y.; Li, B.; Zhao, L.N.; Zhang, H.Y. Characterization of a Bacillus velezensis strain as a potential biocontrol agent against soft rot of eggplant fruits. Int. J. Food Microbiol.; 2023; 410, 110480. [DOI: https://dx.doi.org/10.1016/j.ijfoodmicro.2023.110480] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37977077]
23. Raynaldo, F.A.; Dhanasekaran, S.; Ngea, G.L.N.; Yang, Q.; Zhang, X.; Zhang, H. Investigating the biocontrol potentiality of Wickerhamomyces anomalus against postharvest gray mold decay in cherry tomatoes. Sci. Hortic.; 2021; 285, 110137. [DOI: https://dx.doi.org/10.1016/j.scienta.2021.110137]
24. Sun, J.; Fan, Z.; Chen, Y.; Jiang, Y.; Lin, M.; Wang, H.; Lin, Y.; Chen, Y.; Lin, H. The effect of ε-poly-l-lysine treatment on molecular, physiological and biochemical indicators related to resistance in longan fruit infected by Phomopsis longanae Chi. Food Chem.; 2023; 416, 135784. [DOI: https://dx.doi.org/10.1016/j.foodchem.2023.135784]
25. Lai, J.; Cao, X.; Yu, T.; Wang, Q.; Zhang, Y.; Zheng, X.; Lu, H. Effect of Cryptococcus laurentii on inducing disease resistance in cherry tomato fruit with focus on the expression of defense-related genes. Food Chem.; 2018; 254, pp. 208-216. [DOI: https://dx.doi.org/10.1016/j.foodchem.2018.01.100]
26. Da Costa, A.C.; de Miranda, R.F.; Costa, F.A.; Ulhoa, C.J. Potential of Trichoderma piluliferum as a biocontrol agent of Colletotrichum musae in banana fruits. Biocatal. Agric. Biotechnol.; 2021; 34, 102028. [DOI: https://dx.doi.org/10.1016/j.bcab.2021.102028]
27. Lin, Y.; Lin, H.; Fan, Z.; Wang, H.; Lin, M.; Chen, Y.; Hung, Y.-C.; Lin, Y. Inhibitory effect of propyl gallate on pulp breakdown of longan fruit and its relationship with ROS metabolism. Postharvest Biol. Technol.; 2020; 168, 111272. [DOI: https://dx.doi.org/10.1016/j.postharvbio.2020.111272]
28. Feng, B.; Ding, C.; Li, P.; Fu, L. Combined application of the endophyte Bacillus K1 and sodium dehydroacetate alleviates postharvest gray mold in grapes. Food Microbiol.; 2024; 125, 104637. [DOI: https://dx.doi.org/10.1016/j.fm.2024.104637]
29. Li, Y.; Zhang, J.; Wang, Y.; Wang, J.; Yang, L.; Sun, B.; Zhang, Y.; Xu, Y.; Yan, X. Inhibition of potassium cinnamate to blueberry Alternaria fruit rot. J. Stored Prod. Res.; 2024; 106, 102293. [DOI: https://dx.doi.org/10.1016/j.jspr.2024.102293]
30. Xu, S.; Yan, F.; Ni, Z.; Chen, Q.; Zhang, H.; Zheng, X. In vitro and in vivo control of Alternaria alternata in cherry tomato by essential oil from Laurus nobilis of Chinese origin. J. Sci. Food Agric.; 2013; 94, pp. 1403-1408. [DOI: https://dx.doi.org/10.1002/jsfa.6428]
31. Osdaghi, E.; Jones, J.B.; Sharma, A.; Goss, E.M.; Abrahamian, P.; Newberry, E.A.; Potnis, N.; Carvalho, R.; Choudhary, M.; Paret, M.L.
32. Chen, K.; Tian, Z.; Luo, Y.; Cheng, Y.; Long, C.-A. Antagonistic Activity and the Mechanism of Bacillus amyloliquefaciens DH-4 Against Citrus Green Mold. Phytopathology; 2018; 108, pp. 1253-1262. [DOI: https://dx.doi.org/10.1094/PHYTO-01-17-0032-R] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29799309]
33. Lastochkina, O.; Seifikalhor, M.; Aliniaeifard, S.; Baymiev, A.; Pusenkova, L.; Garipova, S.; Kulabuhova, D.; Maksimov, I. Bacillus Spp.: Efficient Biotic Strategy to Control Postharvest Diseases of Fruits and Vegetables. Plants; 2019; 8, 97. [DOI: https://dx.doi.org/10.3390/plants8040097] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31013814]
34. Rabbee, M.F.; Ali, M.S.; Choi, J.; Hwang, B.S.; Jeong, S.C.; Baek, K. Bacillus velezensis: A Valuable Member of Bioactive Molecules within Plant Microbiomes. Molecules; 2019; 24, 1046. [DOI: https://dx.doi.org/10.3390/molecules24061046]
35. Guo, X.; Qiao, M.; Yang, Y.; Luo, K.; Liu, Z.; Liu, J.; Kuznetsova, N.; Liu, Z.; Sun, Q. Bacillus amyloliquefaciens M73 reduces postharvest decay and promotes anthocyanin accumulation in Tarocco blood orange (Citrus sinensis (L.) Osbeck) during cold storage. Postharvest Biol. Technol.; 2021; 182, 111698. [DOI: https://dx.doi.org/10.1016/j.postharvbio.2021.111698]
36. Xu, W.H.; Wang, H.X.; Lv, Z.H.; Shi, Y.R.; Wang, Z.G. Antifungal activity and functional components of cell-free supernatant from Bacillus amyloliquefaciens LZN01 inhibit Fusarium oxysporum f. sp. niveum growth. Biotechnol. Biotechnol. Equip.; 2019; 33, pp. 1042-1052. [DOI: https://dx.doi.org/10.1080/13102818.2019.1637279]
37. Yan, F.; Cai, T.; Wu, Y.; Chen, S.; Chen, J. Physiological and transcriptomics analysis of the effect of recombinant serine protease on the preservation of loquat. Genomics; 2021; 113, pp. 3750-3761. [DOI: https://dx.doi.org/10.1016/j.ygeno.2021.08.017]
38. Dai, P.; Li, N.; Li, B.; Wang, S.; Wang, Y.; Meng, X.; Li, B.; Cao, K.; Hu, T. An endophytic strain Bacillus velezensis JZ51 controlled pink mold rot of postharvest apple fruit via antagonistic action and disease resistance induction. Postharvest Biol. Technol.; 2024; 210, 112793. [DOI: https://dx.doi.org/10.1016/j.postharvbio.2024.112793]
39. Pan, L.; Zhao, X.; Chen, M.; Fu, Y.; Xiang, M.; Chen, J. Effect of exogenous methyl jasmonate treatment on disease resistance of postharvest kiwifruit. Food Chem.; 2020; 305, 125483. [DOI: https://dx.doi.org/10.1016/j.foodchem.2019.125483]
40. Li, L.; Zhang, Y.; Fan, X.; Wang, J.; Liang, L.; Yan, S.; Xiao, L. Relationship between activated oxygen metabolism and browning of “Yali” pears during storage. J. Food Process. Preserv.; 2020; 44, 14392. [DOI: https://dx.doi.org/10.1111/jfpp.14392]
41. Xu, J.; Zheng, Y.; Peng, D.; Shao, Y.; Li, R.; Li, W. Bacillus siamensis N-1 improves fruit quality and disease resistance by regulating ROS homeostasis and defense enzyme activities in pitaya. Sci. Hortic.; 2024; 329, 112975. [DOI: https://dx.doi.org/10.1016/j.scienta.2024.112975]
42. Deng, J.; Kong, S.; Wang, F.; Liu, Y.; Jiao, J.; Lu, Y.; Zhang, F.; Wu, J.; Wang, L.; Li, X. Identification of a new Bacillus sonorensis strain KLBC GS-3 as a biocontrol agent for postharvest green mould in grapefruit. Biol. Control.; 2020; 151, 104393. [DOI: https://dx.doi.org/10.1016/j.biocontrol.2020.104393]
43. Lin, Y.; Lin, Y.; Lin, H.; Zhang, S.; Chen, Y.; Shi, J. Inhibitory effects of propyl gallate on browning and its relationship to active oxygen metabolism in pericarp of harvested longan fruit. LWT—Food Sci. Technol.; 2015; 60, pp. 1122-1128. [DOI: https://dx.doi.org/10.1016/j.lwt.2014.10.008]
44. Tang, Y.; Li, R.; Jiang, Z.; Cheng, Z.; Li, W.; Shao, Y. Combined effect of Debaryomyces hansenii and Bacillus atrophaeus on the physicochemical attributes, defense-related enzyme activity, and transcriptomic profile of stored litchi fruit. Biol. Control.; 2022; 172, 104975. [DOI: https://dx.doi.org/10.1016/j.biocontrol.2022.104975]
45. Jiang, M.; Pang, X.; Liu, H.; Lin, F.; Lu, F.; Bie, X.; Lu, Z.; Lu, Y. Iturin A Induces Resistance and Improves the Quality and Safety of Harvested Cherry Tomato. Molecules; 2021; 26, 6905. [DOI: https://dx.doi.org/10.3390/molecules26226905]
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
1 School of Life Sciences, Jiangsu University, Zhenjiang 212013, China; [email protected]
2 School of Food and Biological Engineering, Jiangsu University, Zhenjiang 212013, China; [email protected] (D.S.); [email protected] (E.A.G.); [email protected] (X.Z.)
3 College of Food Science and Technology, Henan Agricultural University, Zhengzhou 450002, China; [email protected] (Y.L.); [email protected] (X.L.)