Introduction
Congenital aniridia is a rare panocular disease that affects the cornea, iris, anterior chamber, lens, retina, and optic nerve head. It has been well accepted that in most cases congenital aniridia is caused by a dominantly inherited heterozygous mutation in paired box 6 (PAX6) gene [1–4]. The transcription factor PAX6 is essential for normal eye development and function, and it is expressed in healthy mature corneal and conjunctival epithelial cells as well as in regions of the olfactory epithelium, pancreas and central nervous system [5–9]. The majority of the PAX6 gene mutations are nonsense mutations that lead to premature stop codon in exons and non-coding regions of the PAX6 gene. These mutations affect most of the time one copy of the gene, leading to PAX6 gene haploinsufficiency [1,3].
PAX6 haploinsufficiency causes abnormal eye development, limbal epithelial stem cell insufficiency and corneal opacification, which is known as aniridia associated keratopathy (AAK) [10–13]. In most aniridia cases, the AAK-related corneal neovascularization and pannus formation is the main reason of the progressive visual loss of the patients. AAK mostly begins early in infancy and may progressively lead to untransparent corneal opacity with severe visual impairment and potential blindness for adulthood [10–15]. Therefore, AAK is considered as a prime target of therapies in congenital aniridia subjects.
Due to the PAX6 mutation, AAK is characterized by loss of the limbal epithelial stem cell niche in a time dependent manner. Therefore, identification and testing of drugs that can rescue phenotypes due to PAX6 haploinsufficiency can be crucial. In AAK, the insufficient PAX6 protein amount is also responsible for the severity of the congenital aniridia phenotype, and the severity could be directly correlated with the PAX6 mutational status [3]. Thus, increasing the expression of PAX6 can potentially alleviate the progression of AAK.
Although various potential treatment options have already been suggested to treat AAK in humans, such as for example MiniPromoters for ocular gene therapy [16], all had either too high risks for the patients or possessed low success rate. In an approach to manipulate PAX6 mutational status, it has been reported that adenine base editor (ABE8e), a CRISPR enzyme encapsulated as lipid nanoparticles of ribonucleoprotein (LNP-RNP), mediated the genetic sequence editing of PAX6 variants for aniridia in humanized mouse embryonic stem cells. This CRISPR based strategy corrected the PAX6 variant and thereby rescued PAX6 protein expression [17]. However, through this strategy, only the most common congenital aniridia variant was corrected, which is present in about 20% of the cases. Additionally, the direct translation of this approach to humans is disadvantageous as CRISPR enzymes could have off targets in humans [17].
Likewise, another molecule, ataluren can be used as therapeutic nonsense suppression agent that increases PAX6 protein levels in Pax6Sey/+ mice by delivering postnatally the ataluren in a dose and time dependent manner [18]. Nevertheless, the aniridia mouse models do not completely recapitulate the aniridia phenotypes that are observed in human patients, thereby decreasing the chance of these therapeutic agents to be considered as treatment options. In addition, the possible toxic effects of these therapeutic agents are also a concern to translate into clinical use. Nonetheless, all these approaches require demonstration of safety for clinical translation [18,19].
Cornea is a densely innervated tissue and contains nerves derived from the peripheral nervous system and produces serotonin in addition to the classical neurotransmitters [20,21]. Interestingly, serotonin levels were significantly higher in aqueous tear deficiency and dry eye symptomatic patients, than in controls [22]. However, the link between PAX6 and the anti-psychotic drugs is still not clearly understood. Nevertheless, that PAX6 is not only responsible for eye development but is also expressed in neural stem cells and progenitor cells, suggests a relationship between PAX6 and the anti-psychotic drugs (duloxetine and ritanserin) [23,24]. Roux et al. in 2018 demonstrated that the FDA approved antipsychotic drugs duloxetine and ritanserin increased PAX6 mRNA and protein expression in aniridia-like CRISPR/Cas9 genome edited corneal epithelial cells [25]. Duloxetine is a norepinephrine and serotonin reuptake inhibitor, which is an approved antidepressant drug, used for patients with generalized anxiety disorder and major depressive disorder [26]. Duloxetine increases dopamine levels within the prefrontal cortex by inhibiting norepinephrine transporters [27]. Duloxetine administration for relieving neuropathic pain or modulating brain derived neurotrophic factors suggested duloxetine’s potent effect on serotonin levels or on serotonin transporter, in several animal models [28,29]. Duloxetine use has been also suggested for chemotherapy-induced neuropathies (non-FDA approved) [30,31]. Ritanserin is a serotonin reuptake inhibitor (5-HT2 antagonist), a potential drug for schizophrenia treatment, as well as sleeping disorder [25,32]. Although the exact mechanism how ritanserin works is largely unknown, Olmez et.al. have demonstrated that ritanserin inhibits diacylglycerol kinase alpha (DGKα) and thereby affecting NF-κB in mesenchymal cells [33].
In this study, we aimed to evaluate the efficacy of duloxetine and ritanserin on primary limbal epithelial cells. However, due to the low number of aniridia patients, the availability of primary aniridia limbal epithelial cells to develop therapeutic options is limited. To address this, we first established a small interfering RNA (siRNA)-based primary aniridia cell model, utilizing PAX6 gene knockdown to mimic PAX6 deficiency in primary limbal epithelial cells, in vitro [34]. The strength of this approach lies in its potential to identify target genes influenced by PAX6 that may contribute to AAK pathogenesis therefore, making it a suitable model to test potential AAK drugs capable of alleviating PAX6 protein expression. While all the cell models have their limitations, the use of primary cell cultures, though with limited availability, provides valuable insights that complement results from other experiments. In this study, we analyzed the PAX6 gene and its target gene expressions in control siRNA and PAX6 siRNA (PAX6 knockdown) transfected primary limbal epithelial cells, as well as in primary aniridia limbal epithelial cells following treatment with duloxetine and ritanserin.
Materials and methods
Ethical considerations
Our study followed the regulations of the Declaration of Helsinki and was approved by the Ethics Committee of Saarland/Germany (No 21/21). Limbal biopsies from aniridia patients, limbal biopsies and corneoscleral rims from healthy donors were obtained from 15th February 2021–19th March 2024 from the Klaus Faber Center for Corneal Diseases including Lions Eye Bank (Tables 1–2) for this study. Informed written consent was obtained from patients with aniridia. In case of one minor aniridia patient, informed written consent was obtained from the patient’s parents or guardians.
[Figure omitted. See PDF.]
[Figure omitted. See PDF.]
Cell culture
Primary healthy and aniridia limbal epithelial cells.
For cell culture, primary limbal epithelial cells (pLECs) were isolated from corneoscleral rims of healthy donors or limbal biopsies from aniridia patients as described previously [36,37].
First, 1.5 mm diameter limbal pieces were punched out from the limbal region of corneoscleral rims. These limbal pieces and biopsies were incubated in 100 µl collagenase A (4 mg/ml) (Roche Pharma AG, Basel, Switzerland) in 700µl Keratinocyte serum free medium (KSFM, Cat. Nr. 17005042, Thermo Fisher, Gibco, Life Technologies, Paisley, UK), supplemented by 50 µg/ml Bovine Pituitary Extract (BPE), 5 µg/ml Epidermal Growth Factor (EGF) (Gibco, Life Technologies, Paisley, UK) and 100 U/ml Penicillin/Streptomycin (P/S) (Sigma Aldrich, Germany) overnight at 37 °C. Then, the limbal pieces were pipetted up and down and were loaded onto a 20 µm Cell Tricks filter to retain the epithelial cell clusters and remove the fibroblasts. After washing the filter with 10 ml phosphate buffer saline (PBS), the retained cell clusters, attached to the filter were dissolved using 1.5 ml trypsin-EDTA-solution (Sigma-Aldrich GmbH, Deisenheim, Germany). Dulbecco’s Modified Eagle Medium (DMEM) with 5% FCS and 100 U/ml P/S was used to stop the trypsin reaction. Cell suspension was centrifuged, cell pellet was resuspended in 3 ml KSFM and the cells were seeded into a single well of a 24-well plate. Medium was exchanged every 3 days and after reaching 90% confluence, LECs were passaged into one well of a 6-well plate using 500 µl trypsin-EDTA-solution. The cells were further passaged to three wells of a 6-well plate. These cells were either used fresh after being passaged to 6 wells of a 6-well plate or were cryopreserved in cryo-serum free medium (Cryo-SFM) (Gibco, Life Technologies, Paisley, UK,) and stored at −80 °C until further use.
XTT assay
Cell viability was evaluated using the XTT assay and was performed along the manufacturer`s instructions. pLECs were seeded into 96-well cell culture plates in KSFM. At 70–80% confluence, the culture medium was changed to a culture medium containing drugs (duloxetine/ritanserin) for 24 h and then XTT solution was prepared fresh and added to each well. As a negative control, XTT solution was added to a well with cells but without duloxetine and ritanserin. Culture well plates were incubated for about 30–60 min and absorbance were measured at 550 nm on a 96-well microplate reader (TECAN Infinite F50).
siRNA transfection of pLECs
Either the cryopreserved pLECs were thawed at 37°C for a few seconds and were seeded into 6-well plates or freshly isolated and cultured cells without cryopreservation were used in the 6-well plates. After the cells reached 70–80% confluence, transfection was performed, as previously described [34]. For cells in each well of a 6-well plate, 5 nM of both canonical PAX6 and PAX6 5a isoforms (5′CCUGGCUAGCGAAAAGCAAUU and 5′UGGGCGGAGUUAUGAUACCUU) was used in combination (si-PAX6 pLECs) for PAX6 knockdown. As a control, 5 nM of non-specific control siRNA (5′AGGUAGUGUAAUCGCCUUGUU) (si-CTRL pLECs) was used. Cells were transfected using 5 μL of Lipofectamine 2000 reagent (1 mg/mL; Invitrogen, CA, USA) diluted in 150 μL of Opti-MEM + GlutaMAX-I (Gibco, Carlsbad, CA, USA) per well. Transfection was carried out for 48 hours at 37 °C.
In addition, in order to reduce PAX6 knockdown level, 2.5 nM of both canonical PAX6 and PAX6 5a isoforms in combination (si-PAX6) were also used, in separate experiments. For these experiments, 2.5 nM of non-specific control siRNA (si-CTRL) served as the transfection control. The incubation time for these transfections was 48 hours at 37 °C.
The typical cobblestone morphology of untransfected, si-CTRL and si-PAX6 pLECs is shown in S1 Fig. Cell morphology remained unchanged across the different transfection conditions.
Duloxetine and Ritanserin treatment
Duloxetine (SML0474, Sigma-Aldrich, Massachusetts, USA) and Ritanserin (R-103 Sigma-Aldrich, Massachusetts, USA) were dissolved in Dimethyl sulphoxide solution (DMSO) to prepare 1 mM stock solution. First, the transfection reagent was removed from the cell cultures (after 48 hours), and the cells were washed with PBS. The transfected cells were then incubated in KSFM without epidermal growth factor (EGF) (starvation medium) for 24 hours. For drug treatment, the transfected cells were first incubated with 5 ng/ml EGF-containing KSFM and kept in the incubator for 30 minutes before adding the drugs. PAX6 siRNA-transfected cells were divided into three groups. One group was incubated with 5 µM DMSO in KSFM with EGF, a second group was incubated with 5 µM duloxetine in KSFM with EGF, and a third group was incubated with 5 µM ritanserin in KSFM with EGF for 24 hours at 37 °C. Additionally, control siRNA-transfected cells were also incubated with 5 µM DMSO.
Additionally, both primary control and primary aniridia cell cultures were divided into three groups, and each group was either treated with DMSO, 5 µM duloxetine or 5 µM ritanserin, for 24 h at 37 °C, respectively.
RNA isolation and quality control
RNA/protein was extracted using RNA/DNA/Protein Purification Plus Kit (Norgen, Thorold, ON, Canada, cat no. 47700), according to the manufacturer’s instruction manual. After the drug treatment, cells were washed with PBS and lysed by adding 300 µl guanidinium salts containing SKP-lysis buffer (3 µl-betamercaptoethanol was added) (RNA/DNA/Protein Purification Plus Kit, Norgen Biotek, Canada) for 5 min at room temperature. To remove genomic DNA, the cell lysates were loaded onto a gDNA purification column and were centrifuged at 5200g for 2 min. The flowthrough from the column was retained for RNA purification, as it contains RNAs, and proteins. RNA was precipitated by adding 60 µl 96–100% ethanol to every 100 µl flowthrough and was loaded onto the RNA/Protein Purification Column and was centrifuged at 3500g for 2 min. Protein purification was also performed from the RNA flowthrough therefore retained for later and the column was washed three times with wash solution for RNA elution. Thereafter, total RNAs were eluted in 30 µl RNA Elution Buffer by centrifugation at 200g for 2 min. RNA concentration was quantified using Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) for the quality control. The pH of the RNA flowthrough was adjusted by adding 100 µl molecular biology grade water and 8 µl binding buffer to every 100 µl flowthrough. This pH adjusted sample was loaded onto the protein column and was centrifuged at 5200g for 1 min. The column was washed twice with protein wash solution. Finally, protein was eluted with 50 µl protein elution buffer and 9.3 µl protein neutralizer by centrifugation at 5200g for 2 min. Bradford assay using Bradford reagent (Sigma-Aldrich GmbH, Deisenheim, Germany) was used to determine protein concentration of the eluted protein samples.
Reverse transcription quantitative real time PCR (RT-qPCR) to determine gene expression
cDNA synthesis was carried out using 500 ng-1 µg RNA with oligo dt primers, M-Mul V reaction buffer and Enzyme Mix (One Taq RT-PCR kit, NEB) using PCR Thermocycler (Applied bioscience), according to the manufacture`s instruction manual in a 20 µl of total reaction. For qPCR, in 10 µl total reaction, 1 µl of diluted cDNA (30 µl water added to 20 µl cDNA) was used to run the reaction. The qPCR was performed in a 96 well plate using ACEq DNA SYBR Green master Mix (Vazyme, Biotech, Nanjing). The reaction was performed in duplicate, using a PCR Thermocycler (Quant studio 5, Applied Biosystems, Waltham, Massachusetts, USA). Glucuronidase beta (GUSB), TATA-box binding protein (TBP), Beta-Actin (ACTB) and Glycerinaldehyd-3-phosphat-Dehydrogenase (GAPDH) were used as reference genes and were run under the same conditions as the target genes. The amplification conditions for the reaction mix were 95 °C for 2 min PCR initial denaturation, 95°C for 10s denaturation, and 60°C for 30s combined annealing/extension. These PCR conditions were repeated for 40 cycles. The splice variants PCR reactions for PAX6 isoforms were carried out using 2µl of cDNA, 500nM of each primer, 200nM probe and TaqMan Fast Advanced MasterMix (applied biosystems). The thermal cycling conditions were initial denaturation for 95°C for 10 min, 95°C for 15 s and 60°C for 1 min and repeated for 40 cycles. GUSB and TBP was used as a reference gene The gene expression level was analysed with QuantStudio™ (Applied Biosystems, Waltham, Massachusetts, USA) design and analysis software. Primers used for target genes and splice variants are displayed in Tables 3 and 4 respectively. The relative expression of each target gene was normalized to the reference gene and ΔΔCt values and expression fold-changes (2 ΔΔCt values) were calculated.
[Figure omitted. See PDF.]
[Figure omitted. See PDF.]
Western blot
Nu Page™ Bis-Tris SDS Gel (4–12%) (Invitrogen, Waltham, MA, USA) was used to perform the western blot. 10 μg of each control siRNA and PAX6 siRNA protein sample (with or without previous drug treatment) was boiled in Laemmli sample buffer for 5 min at 95 °C. Denatured samples and Dual colour marker (Bio-Rad Laboratories, Munich, Germany) were loaded and run at 100 V for 2 h. Semi dry blot system was used to transfer the separated high molecular weight proteins to nitrocellulose membrane, using Trans-blot turbo transfer pack (Bio-Rad, Herculus CA, USA) with the Trans-Blot Turbo Transfer System (Bio-Rad, Herculus CA, USA) for 10 min. The membrane was washed with water and subjected to No-stain protein labelling reagent (Invitrogen CA, USA) for total protein staining. Primary antibodies were diluted according to the concentrations listed in Table 5, using the Western Foxx Kit solution (Bio Froxx GmbH, Einhausen, Germany), which contains both the blocking buffer and secondary antibody solution. Western lightning chemiluminescence reagent plus ECL (Perkin Elmer Life Science) was used for the band detection. Images were acquired with an iBright 1500 system (Invitrogen CA, USA). The quantification analysis of band signal intensity of each antibody was done by normalization with total protein staining (TPN) of western blots [38] (S2 Fig.). The antibodies used for the western blot analysis are listed in Table 5. Densitometric analysis of western blots was performed using iBright analysis software (Invitrogen CA, USA).
[Figure omitted. See PDF.]
Statistical analysis
Graph Pad Prism 7.04 software (CA, USA) was used for analysis and for drawing the graphs. mRNA and protein expression values were exported as excel files. Fold change and TPN normalized western blot signal intensity were analysed using Shapiro wilk normality test. Data values were normally distributed therefore, one-way ANOVA, followed by Dunnet’s test was used. A p-value below 0.05 was considered statistically significant.
Results
Effect of duloxetine and ritanserin on the primary siRNA based aniridia cell model
Duloxetine and ritanserin drugs were selected from FDA approved and bioactive drug library (Microsource Spectrum Collection). The screening was done for both drugs using TRE-tomato-HEK293 cells that have a PAX6-responsive sequence upstream to tomato reporter [39,40]. Thus, the purpose of the study was to test the effect of these drugs on PAX6.
Duloxetine and ritanserin were tested on primary limbal epithelial cells (pLECs) in which PAX6 gene was knocked down using a siRNA against PAX6 in pLECs. Since aniridia is primarily associated with PAX6 haploinsufficiency, therefore, siRNA PAX6 knockdown can mimic aniridia PAX6 deficiency in pLECs. To estimate the appropriate drug concentration, which was to be used for the subsequent treatments, the cell viability assay was performed. Cell viability assay (XTT) determined the pLECs survival following duloxetine and ritanserin treatment for 24 h. Nevertheless, no significant cell viability change was observed after treatment of pLECs with increasing concentrations (1 µM to 5 µM) of duloxetine (p ≥ 0.01, n = 3) (Fig 1A) and ritanserin (p ≥ 0.08, n = 3) (Fig 1B).
[Figure omitted. See PDF.]
The survival of primary limbal epithelial cells (pLECs) was assessed following 24-hour treatment with duloxetine (1–5 µM, A) and ritanserin (1–5 µM, B) using the XTT assay. Neither duloxetine nor ritanserin significantly affected pLEC viability (p ≥ 0.08). Data are presented as mean ± SD (one-way ANOVA, n = 3). Abbreviation: CTR, healthy control pLECs.
Initially, we tested 1 µM concentrations of both compounds, as this dose had minimal impact on cell viability. However, at this lower concentration, no significant change in PAX6 mRNA expression was observed following treatment (S3 Fig.). 5 µM duloxetine and ritanserin were well tolerated through pLECs, therefore, these concentrations were used for the subsequent treatment of pLECs.
Treatment with 5 µM duloxetine for 24 h had no significant effect on PAX6 mRNA expression in pLECs transfected with 5 nM siRNA against PAX6, compared to untreated transfected controls (si-PAX6 CTR), as determined by qRT-PCR (p = 0.9, n = 8; Fig 2B). Similarly, treatment with 5 µM ritanserin for 24 h did not significantly influence PAX6 mRNA expression (p = 0.7, n = 8; Fig 2B).
[Figure omitted. See PDF.]
(A) Quantitative RT-PCR analysis of PAX6 expression in pLECs transfected with 5 nM PAX6 siRNA and 5 nM non-specific control siRNA (si-CTR) for 48 h. The fold change (FC) in expression relative to the control (si-CTR) confirms successful knockdown of PAX6 (p < 0.0001). (B) Fold changes in PAX6 expression in PAX6 siRNA-transfected pLECs treated with 5 µM duloxetine (si-PAX6 DUL) or 5 µM ritanserin (si-PAX6 RIT) for 24 h, compared to PAX6 siRNA-transfected cells without drug treatment (si-PAX6 CTR). Drug treatment had no significant impact on PAX6 mRNA expression (p ≥ 0.8). Data are represented as geometric mean ± geometric SD (one-way ANOVA, n = 8).
In contrast, a significant reduction in PAX6 mRNA levels was observed in siRNA-PAX6-transfected pLECs compared to cells transfected with non-specific control siRNA (si-CTRL), confirming successful knockdown (p < 0.0001, n = 8; Fig 2A). Light microscopic evaluation showed no noticeable changes in pLEC morphology after transfection, indicating that the transfection reagents did not affect cell viability (S1 Fig.). At the protein level, neither duloxetine nor ritanserin treatment enhanced PAX6 expression (p ≥ 0.8), following the significant reduction observed after PAX6 knockdown (p ≤ 0.01, n = 8; Fig 3A–3C).
[Figure omitted. See PDF.]
(A) Western blot analysis showing PAX6 protein expression in primary limbal epithelial cells (pLECs) transfected with 5 nM PAX6 siRNA, compared to cells transfected with 5 nM non-targeting control siRNA (si-CTRL), after 48 h. A significant reduction in PAX6 protein levels was observed in the knockdown group (p ≤ 0.01). (B) PAX6 protein expression in PAX6-siRNA-transfected pLECs treated with 5 µM duloxetine (si-PAX6 DUL) or 5 µM ritanserin (si-PAX6 RIT) for 24 h, compared to untreated PAX6 siRNA-transfected cells (si-PAX6 CTR). Neither drug significantly enhanced PAX6 protein expression (p = 0.8). (C) Representative Western blot image showing PAX6 protein bands at the expected molecular weight of 46–47 kDa. Data are presented as mean ± SD (one-way ANOVA, n = 8).
To rule out the possibility that the lack of drug effect on PAX6 expression was due to a higher concentration of transient siRNA in pLEC cultures, transfections were also performed using a lower concentration (2.5 nM) of PAX6 siRNA and non-specific control siRNA (si-CTRL) (p ≥ 0.1). Nevertheless, treatment with 5 µM duloxetine or ritanserin did not significantly affect PAX6 mRNA expression compared to the control without drug treatment (si-PAX6 CTR) (p ≥ 0.8, n = 8) (Fig 4A, 4B).
[Figure omitted. See PDF.]
(A) Quantitative RT-PCR analysis of PAX6 mRNA expression in pLECs transfected with 2.5 nM PAX6 siRNA and 2.5 nM control siRNA for 48 h. Expression fold changes (FC) relative to a non-specific siRNA control (si-CTRL) are also shown. (B) Expression fold changes in transfected pLECs treated with 5 µM duloxetine (si-PAX6 DUL) or 5 µM ritanserin (si-PAX6 RIT) for 24 h, compared to PAX6 siRNA-transfected cells without drug treatment (si-PAX6 CTR). Treatment with duloxetine (p = 0.9) or ritanserin (p = 0.8) did not significantly affect PAX6 mRNA expression. Data are presented as geometric mean ± geometric SD (one-way ANOVA, n = 8).
These findings were surprising as duloxetine and ritanserin enhanced endogenous PAX6 expression in mut-limbal stem cells LSCs. The potential mechanism of action of duloxetine and ritanserin in LSCs is the activation of PAX6 by inhibiting the mitogen-activated protein kinase (ERK) pathway [39,40] Therefore, we investigated whether the duloxetine and ritanserin treatment influence phosphorylated ERK (pERK1/2) protein expression in untransfected pLECs. We observed that 5µM duloxetine treatment led to significant reduction of the pERK1/2 protein expression, compared to controls (using only DMSO) (p = 0.01, n = 5) (Fig 5A, 5E). Nevertheless, duloxetine treatment did not significantly increase the PAX6 protein expression (p = 0.9) (Fig. 5B, 5E). Ritanserin treatment had no significant effect on pERK expression (p = 0.6) and had no effect on PAX6 protein expression (p = 0.8) as well (Fig 5A-5E). The total ERK1\2 was unchanged between the groups (p ≥ 0.4) (Fig 5 C, 5E). The expression level of pERK relative to total ERK in duloxetine- and ritanserin-treated pLECs was also not significantly different from the control group (p ≥ 0.5; Fig 5D).
[Figure omitted. See PDF.]
Western blot analysis of pERK and PAX6 protein expression in untransfected pLECs, with and without DMSO treatment (CTRL+DMSO; CTRL-DMSO), and after treatment with duloxetine (DUL+DMSO) or ritanserin (RIT+DMSO) (A-E). Western blot images show pERK/ERK1/2 bands at 42–44 kDa and PAX6 bands at 46–47 kDa. (A) 5 µM duloxetine treatment led to a significant reduction in pERK1/2 protein expression compared to controls (p = 0.012). (B) Duloxetine treatment did not significantly increase PAX6 protein expression. (C) The pERK/total ERK ratio remained unchanged between the groups. Data are presented as mean ± SD (one-way ANOVA, n = 5).
Effect of duloxetine and ritanserin treatment on PAX6 isoforms in primary cell cultures, in vitro
The PAX6 has two major isoforms, the canonical PAX6−5 and the PAX6-5a isoforms. PAX6-5a is an alternatively spliced form that results in a larger isoform than PAX6−5. Previous studies have shown that these two PAX6 isoforms regulate corneal epithelium specific genes differentially as well as cooperatively [41,42]. Therefore, the effect of duloxetine and ritanserin treatment was examined on these both isoforms, to evaluate whether these drugs have a different effect on both isoforms. The PAX6 isoform-5 mRNA levels were significantly reduced after siRNA PAX6 knockdown (p = 0.04). However, the change in mRNA levels of the PAX6-5a isoform was not statistically significant (p = 0.07) (Fig 6A, 6B). Unlike previous findings, although a relative increase in PAX6 mRNA levels was observed after duloxetine and ritanserin treatment, the expression levels of both PAX6 isoforms remained unchanged and were not statistically significant (p ≥ 0.1, n = 8) (Fig 6C, 6D).
[Figure omitted. See PDF.]
TaqMan qRT-PCR analysis of PAX6 isoform expression in primary limbal epithelial cells (pLECs) transfected with PAX6 siRNA (si-PAX6) or control siRNA (si-CTRL) for 48 h, followed by treatment with 5 µM duloxetine (si-PAX6 DUL) (C) or 5 µM ritanserin (si-PAX6 RIT) (D) for 24 h. Expression fold changes (FC) for PAX6 isoform 5 (A, C) and PAX6 isoform 5a (B, D) are shown. (A, B) PAX6−5 isoform mRNA levels were significantly reduced following siRNA-mediated knockdown (p = 0.043), whereas the reduction in PAX6-5a isoform mRNA levels did not reach statistical significance (p = 0.07). (C, D) Treatment with duloxetine and ritanserin did not significantly alter the expression of either isoform (p ≥ 0.8). Data are presented as geometric mean ± geometric SD (one-way ANOVA, n = 7).
Effect of duloxetine and ritanserin treatment on aniridia patient`s derived primary limbal epithelial cell cultures, in vitro
Since we did not observe significant influence of duloxetine and ritanserin on siRNA-PAX6 transfected pLECs, thus, we investigated the impact of duloxetine and ritanserin treatment on aniridia patient derived primary limbal epithelial cells (AN-pLECs). Unfortunately, cell viability could not be performed due to low availability of primary aniridia limbal epithelial cells. Therefore, the effect of 5 µM duloxetine and ritanserin treatment was tested on AN-pLECs for 24 h based on the cell viability assay performed on healthy donor pLECs. We could observe similar results, as using the siRNA PAX6 knockdown133 pt for pLEC previously, as 5µM duloxetine and 5µM ritanserin treatment had no significant effect on PAX6 mRNA expression in AN-pLECs, as judged by qPCR analysis (p = 0.9, n = 11) (Fig 7A). The aniridia samples included in this study exhibited varying AAK grades (Table 1). To account for this, the samples were divided into two groups: Group 1 included samples with AAK Grade 3, while Group 2 comprised samples with AAK Grades 4 and 5. Treatment with 5 µM duloxetine or 5 µM ritanserin had no significant effect on PAX6 mRNA expression in either the AAK Grade 3 group (p ≥ 0.7, n = 5) (Fig 7B) or the AAK Grade 4–5 group (p = 0.9, n = 6) (Fig 7C).
[Figure omitted. See PDF.]
(A) qRT-PCR analysis of PAX6 mRNA expression in AN-pLECs treated with 5 µM duloxetine or 5 µM ritanserin for 24 h. Expression fold changes (FC) are shown relative to untreated controls. (B) PAX6 expression in AN-pLECs derived from patients with AAK Grade 3, following 24 h treatment with duloxetine or ritanserin. (C) PAX6 expression in AN-pLECs from patients with AAK Grades 4–5 under the same treatment conditions. No significant changes in PAX6 mRNA expression were observed in any group following treatment with duloxetine or ritanserin. Data are presented as geometric mean ± geometric SD (one-way ANOVA, n = 11). Abbreviation: AN, aniridia.
Target gene expression after duloxetine and ritanserin treatment
The components of retinol and fatty acid metabolism (ADH7, ALDH1A1, FABP5), Junction protein DSG1, keratins (KRT3, KRT12) and the protease inhibitor SPINK7 were already known to be altered in aniridia patient epithelial cells and using the siRNA-based aniridia cell model [34,36,43]. Therefore, we analysed the expression changes of these genes in response to duloxetine and ritanserin treatment. 5µM duloxetine and ritanserin treatment for 24 h showed no significant impact on ADH7, ALDH1A1, FABP5 mRNA expression (p ≥ 0.2) (Fig 8A). In addition, KRT3 and KRT12 mRNA expression and DSG1 and SPINK7 mRNA expression also did not change significantly upon drug treatment (p ≥ 0.6) (Fig 8B). We also assessed gene expression of the stem cell marker ABCG2, which was upregulated in AN-pLECs and is negatively correlated with ADH7 expression [34]. Nevertheless, the ABCG2 transcript level also remained unchanged after duloxetine and ritanserin treatment (p = 0.8) (Fig 8A).
[Figure omitted. See PDF.]
qRT-PCR analysis of selected PAX6 target genes in transfected primary limbal epithelial cells (pLECs) treated with 5 µM duloxetine (si-PAX6 DUL) or 5 µM ritanserin (si-PAX6 RIT) for 24 h, using the siRNA-based PAX6 knockdown model (si-PAX6). Expression fold changes (FC) are shown relative to the PAX6 siRNA control without drug treatment (si-PAX6 CTR). None of the analyzed genes showed significant changes in expression following duloxetine or ritanserin treatment. Data are presented as geometric mean ± geometric SD (one-way ANOVA, n = 6).
Discussion
In this study, we evaluated the impact of duloxetine and ritanserin drugs on primary limbal epithelial cells in in vitro cultures, using the siRNA based aniridia PAX6 knockdown model and using primary cells derived from biopsies of healthy and aniridia patients. Aniridia is a rare disease and is particularly characterized by ocular surface disease known as aniridia associated keratopathy (AAK), which is progressive in nature. AAK is often associated with conjuctivalization and limbal stem cell deficiency, and thereby with loss of corneal limbal epithelial stem cell function [1–5]. In almost 90% of aniridia cases there is PAX6 haploinsufficiency and most of the patients with PAX6 mutation develop AAK. Thus, there is a current need to identify therapeutic options to prevent corneal opacification and visual loss in congenital aniridia subjects. Since AAK is progressive in nature, therefore, identifying new therapeutic options have great potential to arrest the progression of disease at early stages.
In a previous study, Roux et al., 2018 screened the FDA-approved drug library and identified two psychotropic drugs, duloxetine and ritanserin, which enhanced expression of PAX6 in mut LSCs. The mut LSCs were immortalized PAX6+/− limbal epithelial cells, generated by CRISPR-CAS technology [25,39,40]. The drug “repurposing” or drug “reprofiling” is a strategy to use approved or investigational drugs for a new purpose. This strategy is quite advantageous over developing an entirely new drug, as in case of a repurposed drug, the rate of failure is relatively low with a drug which was already found safe to be used in humans. AAK is highly related to deficiency in PAX6, however, due to the complexity of AAK pathogenesis, the observed changes might not reflect the direct influence of PAX6. Therefore, siRNA based PAX6 knockdown in primary LECs (aniridia cell model) could serve as a good model to investigate the influence of duloxetine and ritanserin on PAX6 expression [34]. The siRNA based PAX6 knockdown cell model mimics PAX6 deficiency in primary aniridia limbal epithelial cell cultures. This was already demonstrated by investigating AAK associated target genes such as SPINK7, ADH7 and ALDH1A1 that showed similar dysregulation in the cell model, as in primary aniridia LECs, providing evidence, that this model is useful to investigate the direct or indirect influence of PAX6 in AAK [34]. Therefore, the direct influence of duloxetine and ritanserin could be examined in the aniridia PAX6 knockdown cell model. Using siRNA, the 48h transfection time of primary limbal epithelial cells was effective in a strong reduction of PAX6 expression.
Surprisingly, although PAX6 expression was effectively reduced by siRNA-mediated knockdown, treatment with duloxetine or ritanserin did not alter endogenous PAX6 levels in the knockdown model, compared to the control knockdown. PAX6 is a key transcription factor that contains two DNA-binding domains: the paired domain (PD) and the homeodomain (HD) [41,44]. The N-terminal PAI subdomain of the paired domain includes an alternatively spliced exon, exon 5a, which results in two distinct isoforms of PAX6 [45,46]. This structural variation in the PAI domain imparts unique functional properties to each isoform [42,46]. Splice variant analysis showed a significant reduction in the expression of the PAX6−5 isoform following PAX6 knockdown, compared to control knockdown. Although the siRNA used targets both PAX6 isoforms, the expression of PAX6-5a was also reduced, but the decrease did not reach statistical significance. Despite the strong downregulation of the PAX6−5 isoform, treatment with duloxetine and ritanserin did not significantly increase PAX6 expression, contrary to expectations. Since the two PAX6 isoforms are known to cooperatively regulate different target genes [41], it is possible that the relatively higher expression level of PAX6-5a in knockdown cells, compared to PAX6−5, may have compensated for the effect of duloxetine and ritanserin on PAX6 expression. Therefore, we could not recapitulate completely the effect of duloxetine and ritanserin using the siRNA based aniridia cell model, as described previously for the CRISPR-CAS modified cells [39,40]. Similar discrepancy was also observed for primary limbal epithelial cells from aniridia patients, where duloxetine and ritanserin did not enhance the PAX6 gene expression.
Aniridia-associated keratopathy typically progresses through four to five stages, classified as AAK grades 1–5. However, PAX6 mRNA expression remained unchanged in aniridia samples from both AAK grade 3 and AAK grades 4–5. This could be due to the fact that the PAX6 mRNA level did not differ between healthy and aniridia patient pLECs [36,43] and aniridia (AN) iPSCs-derived limbal epithelial stem cells (LESCs), as described previously. The heterogeneous nature of mutations in the aniridia samples used in this study could also partly explain the lack of PAX6 upregulation following treatment with duloxetine and ritanserin.
Duloxetine is a norepinephrine and serotonin reuptake inhibitor and ritanserin, a serotonin reuptake inhibitor has been shown to be involved in the inhibition of pERK [47–50]. Previous studies have suggested that mitogen-activated protein kinase (MEK) inhibitors can indirectly increase PAX6 expression [51–53]. Rabiee et al., have demonstrated that PD0325901, a potent MEK inhibitor increased PAX6 protein expression in mutant mouse corneal epithelial cells and in PAX6-deficient aniridia, in newborn Pax6-deficient mice (Pax6Sey-Neu/+) [51]. The study by Srivastava et al., 2023 showed that PAX6 and ERK1\2 expression levels were inversely regulated and were functioning synergistically [52]. Therefore, it suggests that MEK is responsible for phosphorylation and activation of ERK and MEK inhibitors can inhibit the ERK pathway. Therefore, ERK pathway has negative feedback on PAX6 expression.
The transient activation of the MEK/ERK pathway, by treating the mut LSCs with EGF, reduced the PAX6 production [54,55]. Partial inhibition of ERK phosphorylation by duloxetine and ritanserin treatment has been shown to restore PAX6 expression in mutant limbal stem cells (mut LSCs) [39,40]. We observed inhibition of pERK in pLECs following treatment with duloxetine, as indicated by a reduction in pERK protein expression. In contrast, ritanserin-treated pLECs showed no evidence of pERK inhibition. The pERK level relative to total ERK also remained unchanged. Importantly, endogenous PAX6 protein expression was not enhanced in pLECs following treatment with either duloxetine or ritanserin. Interestingly, Dorot et al. (2023) reported that in wild-type limbal stem cells (LSCs), the effect of duloxetine on phosphorylated ERK was weaker compared to mutant LSCs, and endogenous PAX6 expression was not enhanced [39]. This may partially explain the absence of PAX6 rescue in our siRNA-mediated knockdown model, as these pLECs do not harbor mutations in either PAX6 allele and thus may respond differently to drug treatment.
The possibility that these differences are most likely due to the variations in the cultures systems cannot be completely ruled out. The primary LECs cultures of our group comprise a heterogenous population of cells and PAX6 expression also varies from donor to donor. The differences in the differentiation status of these cells might also contribute to the inability of duloxetine and ritanserin to enhance PAX6 expression. In contrast, the immortalized cells, used by Roux et al., 2018 express extremely low amount of markers that are related to corneal differentiation, thereby indicating their close match to stem cell phenotype [25]. In aniridia pLECs and AN iPSCs-derived LESCs, the stem cell marker ∆Np63α showed no differences in transcription level, compared to healthy controls [36,43]. Another stem cell marker, the ABCG2 mRNA level was upregulated in pLECs and iPSCs-derived LESCs from aniridia patients. The junction and keratin protein, DSG1 and KRT3 were highly significantly regulated genes that might be influenced by PAX6 expression [56–59]. The regulation of keratin protein KRT12 and RA signaling component ALDH1A1 showed overlapping results obtained from microarray of primary corneal epithelial cells [60] with aniridia patient RNA sequencing results [34]. In duloxetine and ritanserin treated pLECs, none of these genes showed significant alterations in gene expression in response to both used drugs. This could be due to the limited number of aniridia samples with very high genetic variability and different PAX6 mutations, used in our and in other studies, which makes it difficult to investigate the effects of duloxetine and ritanserin.
Such discrepancies in the siRNA based PAX6 knockdown model and in primary limbal epithelial cells from aniridia patients were also observed in qPCR experiments and using mRNA sequencing, showing a slight overlap in gene expression profiling and pathway analysis with immortalized PAX6+/− limbal epithelial cells [25,34]. Nevertheless, it cannot be completely ruled out that the observed gene expression results could be observed due to differences in the methodologies or due to low availability of samples. To our knowledge, this is the first study to demonstrate the application of the repurposed drugs duloxetine and ritanserin on cultured primary aniridia limbal epithelial cells. The results suggest that it is crucial to investigate the effects of drug treatment in different culture systems to better assess the efficacy of these drugs.
The aniridia samples used in this study represent heterogeneous mutations, as obtaining patient-derived aniridia samples is extremely challenging due to their limited availability. As a result, a homogeneous genetic mutation group was not feasible and remains a limitation of our study.
In summary, duloxetine and ritanserin treatment were unable to restore endogenous PAX6 expression in primary limbal epithelial cells with PAX6 knockdown and in primary aniridia limbal epithelial cell cultures. In this study, we observed that different culture conditions have various responses to drug treatment. Therefore, the use of in vivo models could further advance our understanding of duloxetine and ritanserin treatment in aniridia associated keratopathy.
Supporting information
S1 Fig. The typical cobblestone morphology of untransfected primary limbal epithelial cells (pLECs), as well as those transfected with 5 nM non-targeting control siRNA (si-CTRL) and 5 nM PAX6 siRNA (si-PAX6).
Cell morphology remained unchanged across the different transfection conditions.
https://doi.org/10.1371/journal.pone.0324829.s001
(TIF)
S2 Fig. Total Protein Normalization (TPN) using Invitrogen™ No-Stain™ Protein Labeling Reagent.
Following stimulation with UV light, the fluorescence of the protein labeling reagent—bound to the lysine side chains of the proteins—was detected and quantified densitometrically. TPN was used to normalize the band intensities in Western blot analysis, ensuring accurate comparison of protein expression levels across samples.
https://doi.org/10.1371/journal.pone.0324829.s002
(TIF)
S3 Fig. PAX6 mRNA levels in primary limbal epithelial cells (pLECs) transfected with 5 nM siRNA and using 1 µM duloxetine or ritanserin (A, B).
(A) Quantitative RT-PCR analysis of PAX6 level in pLECs transfected with 5 nM PAX6 siRNA and 5 nM non-targeting control siRNA (si-CTRL) for 48 h. The fold change (FC) in expression relative to the control (si-CTRL) confirms successful knockdown of PAX6 (p < 0.0001). (B) Fold changes in PAX6 expression in PAX6 siRNA-transfected pLECs treated with 1 µM duloxetine (si-PAX6 DUL) or 1 µM ritanserin (si-PAX6 RIT) for 24 h, compared to untreated PAX6 siRNA-transfected cells (si-PAX6 CTR). Drug treatment had no significant impact on PAX6 mRNA level (p ≥ 0.8). Data are represented as geometric mean ± geometric SD (one-way ANOVA, n = 5).
https://doi.org/10.1371/journal.pone.0324829.s003
(TIF)
S1. Raw_images.pdf.
https://doi.org/10.1371/journal.pone.0324829.s004
Acknowledgments
Acknowledgments The work of Shweta Suiwal, Tanja Stachon, Zhen Li, Mahsa Nastaranpour, Ning Chai, Maryam Amini, Fabian Norbert Fries and Nóra Szentmáry at the Rolf M. Schwiete Center for Limbal Stem Cell and Aniridia Research was supported by the Rolf M. Schwiete Foundation. The work of Zhen Li and Ning Chai has been supported by the China Scholarship Council. We would like to thank Mrs. Sabrina Häcker and Joanna Andrzejewska-Lemanowicz for their excellent technical assistance.
References
1. 1. Lim HT, Seo E-J, Kim G-H, Ahn H, Lee H, Shin KH, et al. Comparison between aniridia with and without PAX6 mutations: clinical and molecular analysis in 14 Korean patients with aniridia. Ophthalmology. 2012;119(6):1258–64. pmid:22361317
* View Article
* PubMed/NCBI
* Google Scholar
2. 2. Hingorani M, Williamson KA, Moore AT, van Heyningen V. Detailed ophthalmologic evaluation of 43 individuals with PAX6 mutations. Invest Ophthalmol Vis Sci. 2009;50(6):2581–90. pmid:19218613
* View Article
* PubMed/NCBI
* Google Scholar
3. 3. Lagali N, Wowra B, Fries FN, Latta L, Moslemani K, Utheim TP, et al. PAX6 Mutational Status Determines Aniridia-Associated Keratopathy Phenotype. Ophthalmology. 2020;127(2):273–5. pmid:31708273
* View Article
* PubMed/NCBI
* Google Scholar
4. 4. Neuhaus C, Betz C, Bergmann C, Bolz HJ. Genetik der kongenitalen Aniridie. Der Ophthalmologe: Zeitschrift der Deutschen Ophthalmologischen Gesellschaft. 2014;111(12):1157–63.
* View Article
* Google Scholar
5. 5. Gehring WJ. The master control gene for morphogenesis and evolution of the eye. Genes to Cells: Devoted to Molecular & Cellular Mechanisms. 1996;1(1):11–5.
* View Article
* Google Scholar
6. 6. Koroma BM, Yang JM, Sundin OH. The Pax-6 homeobox gene is expressed throughout the corneal and conjunctival epithelia. Investigative Ophthalmology & Visual Science. 1997;38(1):108–20.
* View Article
* Google Scholar
7. 7. Chen SY, Cheng AMS, Zhang Y, Zhu YT, He H, Mahabole M. Pax 6 Controls Neural Crest Potential of Limbal Niche Cells to Support Self-Renewal of Limbal Epithelial Stem Cells. Scientific Reports. 2019;9(1):9763.
* View Article
* Google Scholar
8. 8. Ochi S, Manabe S, Kikkawa T, Osumi N. Thirty Years’ History since the Discovery of Pax6: From Central Nervous System Development to Neurodevelopmental Disorders. Int J Mol Sci. 2022;23(11):6115. pmid:35682795
* View Article
* PubMed/NCBI
* Google Scholar
9. 9. Duan D, Fu Y, Paxinos G, Watson C. Spatiotemporal expression patterns of Pax6 in the brain of embryonic, newborn, and adult mice. Brain structure & function. 2013;218(2):353–72.
* View Article
* Google Scholar
10. 10. Lagali N, Wowra B, Dobrowolski D, Utheim TP, Fagerholm P, Wylegala E. Stage-related central corneal epithelial transformation in congenital aniridia-associated keratopathy. Ocul Surf. 2018;16(1):163–72. pmid:29133179
* View Article
* PubMed/NCBI
* Google Scholar
11. 11. Latta L, Figueiredo FC, Ashery-Padan R, Collinson JM, Daniels J, Ferrari S, et al. Pathophysiology of aniridia-associated keratopathy: Developmental aspects and unanswered questions. Ocul Surf. 2021;22:245–66. pmid:34520870
* View Article
* PubMed/NCBI
* Google Scholar
12. 12. Latta L, Ludwig N, Krammes L, Stachon T, Fries FN, Mukwaya A, et al. Abnormal neovascular and proliferative conjunctival phenotype in limbal stem cell deficiency is associated with altered microRNA and gene expression modulated by PAX6 mutational status in congenital aniridia. Ocul Surf. 2021;19:115–27. pmid:32422284
* View Article
* PubMed/NCBI
* Google Scholar
13. 13. Lagali N, Edén U, Utheim TP, Chen X, Riise R, Dellby A, et al. In vivo morphology of the limbal palisades of vogt correlates with progressive stem cell deficiency in aniridia-related keratopathy. Invest Ophthalmol Vis Sci. 2013;54(8):5333–42. pmid:23860752
* View Article
* PubMed/NCBI
* Google Scholar
14. 14. van Velthoven AJH, Utheim TP, Notara M, Bremond-Gignac D, Figueiredo FC, Skottman H, et al. Future directions in managing aniridia-associated keratopathy. Surv Ophthalmol. 2023;68(5):940–56. pmid:37146692
* View Article
* PubMed/NCBI
* Google Scholar
15. 15. Skeens HM, Brooks BP, Holland EJ. Congenital aniridia variant: minimally abnormal irides with severe limbal stem cell deficiency. Ophthalmology. 2011;118(7):1260–4. pmid:21376398
* View Article
* PubMed/NCBI
* Google Scholar
16. 16. Korecki AJ, Cueva-Vargas JL, Fornes O, Agostinone J, Farkas RA, Hickmott JW, et al. Human MiniPromoters for ocular-rAAV expression in ON bipolar, cone, corneal, endothelial, Müller glial, and PAX6 cells. Gene Ther. 2021;28(6):351–72. pmid:33531684
* View Article
* PubMed/NCBI
* Google Scholar
17. 17. Adair BA, Korecki AJ, Djaksigulova D, Wagner PK, Chiu NY, Lam SL. ABE8e Corrects Pax6-Aniridic Variant in Humanized Mouse ESCs and via LNPs in Ex Vivo Cortical Neurons. Ophthalmology and Therapy. 2023;12(4):2049–68.
* View Article
* Google Scholar
18. 18. Wang X, Gregory-Evans K, Wasan KM, Sivak O, Shan X, Gregory-Evans CY. (2017). Efficacy of Postnatal In Vivo Nonsense Suppression Therapy in a Pax6 Mouse Model of Aniridia. Molecular therapy. Nucleic acids, 7, 417–28.
* View Article
* Google Scholar
19. 19. Abdolkarimi D, Cunha DL, Lahne M, Moosajee M. PAX6 disease models for aniridia. Indian J Ophthalmol. 2022;70(12):4119–29. pmid:36453299
* View Article
* PubMed/NCBI
* Google Scholar
20. 20. Imada T, Nakamura S, Hisamura R, Izuta Y, Jin K, Ito M, et al. Serotonin hormonally regulates lacrimal gland secretory function via the serotonin type 3a receptor. Sci Rep. 2017;7(1):6965. pmid:28761086
* View Article
* PubMed/NCBI
* Google Scholar
21. 21. Crider JY, Williams GW, Drace CD, Katoli P, Senchyna M, Sharif NA. Pharmacological characterization of a serotonin receptor (5-HT7) stimulating cAMP production in human corneal epithelial cells. Invest Ophthalmol Vis Sci. 2003;44(11):4837–44. pmid:14578406
* View Article
* PubMed/NCBI
* Google Scholar
22. 22. Chhadva P, Lee T, Sarantopoulos CD, Hackam AS, McClellan AL, Felix ER, et al. Human Tear Serotonin Levels Correlate with Symptoms and Signs of Dry Eye. Ophthalmology. 2015;122(8):1675–80. pmid:25983214
* View Article
* PubMed/NCBI
* Google Scholar
23. 23. Shohayeb B, Cooper HM. The ups and downs of Pax6 in neural stem cells. J Biol Chem. 2023;299(5):104680. pmid:37028762
* View Article
* PubMed/NCBI
* Google Scholar
24. 24. Thakurela S, Tiwari N, Schick S, Garding A, Ivanek R, Berninger B, et al. Mapping gene regulatory circuitry of Pax6 during neurogenesis. Cell Discov. 2016;2:15045. pmid:27462442
* View Article
* PubMed/NCBI
* Google Scholar
25. 25. Roux LN, Petit I, Domart R, Concordet J-P, Qu J, Zhou H, et al. Modeling of Aniridia-Related Keratopathy by CRISPR/Cas9 Genome Editing of Human Limbal Epithelial Cells and Rescue by Recombinant PAX6 Protein. Stem Cells. 2018;36(9):1421–9. pmid:29808941
* View Article
* PubMed/NCBI
* Google Scholar
26. 26. Singh SP, Singh V, Kar N, Chan K. Efficacy of antidepressants in treating the negative symptoms of chronic schizophrenia: meta-analysis. Br J Psychiatry. 2010;197(3):174–9. pmid:20807960
* View Article
* PubMed/NCBI
* Google Scholar
27. 27. Bymaster FP, Lee TC, Knadler MP, Detke MJ, Iyengar S. The dual transporter inhibitor duloxetine: a review of its preclinical pharmacology, pharmacokinetic profile, and clinical results in depression. Curr Pharm Des. 2005;11(12):1475–93. pmid:15892657
* View Article
* PubMed/NCBI
* Google Scholar
28. 28. Calabrese F, Molteni R, Cattaneo A, Macchi F, Racagni G, Gennarelli M, et al. Long-Term duloxetine treatment normalizes altered brain-derived neurotrophic factor expression in serotonin transporter knockout rats through the modulation of specific neurotrophin isoforms. Mol Pharmacol. 2010;77(5):846–53. pmid:20159945
* View Article
* PubMed/NCBI
* Google Scholar
29. 29. Iyengar S, Webster AA, Hemrick-Luecke SK, Xu JY, Simmons RMA. Efficacy of duloxetine, a potent and balanced serotonin-norepinephrine reuptake inhibitor in persistent pain models in rats. J Pharmacol Exp Ther. 2004;311(2):576–84. pmid:15254142
* View Article
* PubMed/NCBI
* Google Scholar
30. 30. Meng J, Zhang Q, Yang C, Xiao L, Xue Z, Zhu J. Duloxetine, a Balanced Serotonin-Norepinephrine Reuptake Inhibitor, Improves Painful Chemotherapy-Induced Peripheral Neuropathy by Inhibiting Activation of p38 MAPK and NF-κB. Front Pharmacol. 2019;10:365. pmid:31024320
* View Article
* PubMed/NCBI
* Google Scholar
31. 31. Piccolo J, Kolesar JM. Prevention and treatment of chemotherapy-induced peripheral neuropathy. Am J Health Syst Pharm. 2014;71(1):19–25.
* View Article
* Google Scholar
32. 32. Berntsson SG, Kristoffersson A, Daniilidou M, Dahl N, Ekström C, Semnic R. Aniridia with PAX6 mutations and narcolepsy. Journal of Sleep Research. 2020;29(6):e12982.
* View Article
* Google Scholar
33. 33. Olmez I, Love S, Xiao A, Manigat L, Randolph P, McKenna BD, et al. Targeting the mesenchymal subtype in glioblastoma and other cancers via inhibition of diacylglycerol kinase alpha. Neuro Oncol. 2018;20(2):192–202. pmid:29048560
* View Article
* PubMed/NCBI
* Google Scholar
34. 34. Latta L, Nordström K, Stachon T, Langenbucher A, Fries FN, Szentmáry N, et al. Expression of retinoic acid signaling components ADH7 and ALDH1A1 is reduced in aniridia limbal epithelial cells and a siRNA primary cell based aniridia model. Exp Eye Res. 2019;179:8–17. pmid:30292490
* View Article
* PubMed/NCBI
* Google Scholar
35. 35. Maxeiner S, Sester M, Krasteva-Christ G. Novel human sex-typing strategies based on the autism candidate gene NLGN4X and its male-specific gametologue NLGN4Y. Biol Sex Differ. 2019;10(1):62. pmid:31852540
* View Article
* PubMed/NCBI
* Google Scholar
36. 36. Latta L, Viestenz A, Stachon T, Colanesi S, Szentmáry N, Seitz B, et al. Human aniridia limbal epithelial cells lack expression of keratins K3 and K12. Exp Eye Res. 2018;167:100–9. pmid:29162348
* View Article
* PubMed/NCBI
* Google Scholar
37. 37. Nastaranpour M, Suiwal S, Stachon T, Fries FN, Amini M, Seitz B, et al. miRNA Expression Profile in Primary Limbal Epithelial Cells of Aniridia Patients. Invest Ophthalmol Vis Sci. 2025;66(1):20. pmid:39786759
* View Article
* PubMed/NCBI
* Google Scholar
38. 38. Moritz CP. Tubulin or Not Tubulin: Heading Toward Total Protein Staining as Loading Control in Western Blots. Proteomics. 2017;17(20). pmid:28941183
* View Article
* PubMed/NCBI
* Google Scholar
39. 39. Dorot O, Roux LN, Zennaro L, Oved K, Bremond-Gignac D, Pichinuk E, et al. The antipsychotropic drug Duloxetine rescues PAX6 haploinsufficiency of mutant limbal stem cells through inhibition of the MEK/ERK signaling pathway. The ocular surface. 2022;23:140–2.
* View Article
* Google Scholar
40. 40. Oved K, Zennaro L, Dorot O, Zerbib J, Frank E, Roux LN, et al. Ritanserin, a potent serotonin 2A receptor antagonist, represses MEK/ERK signalling pathway to restore PAX6 production and function in aniridia-like cellular model. Biochem Biophys Res Commun. 2021;582:100–4. pmid:34700241
* View Article
* PubMed/NCBI
* Google Scholar
41. 41. Sasamoto Y, Hayashi R, Park S-J, Saito-Adachi M, Suzuki Y, Kawasaki S, et al. PAX6 Isoforms, along with Reprogramming Factors, Differentially Regulate the Induction of Cornea-specific Genes. Sci Rep. 2016;6:20807. pmid:26899008
* View Article
* PubMed/NCBI
* Google Scholar
42. 42. Kiselev Y, Eriksen TE, Forsdahl S, Nguyen LHT, Mikkola I. 3T3 cell lines stably expressing Pax6 or Pax6(5a)--a new tool used for identification of common and isoform specific target genes. PLoS One. 2012;7(2):e31915. pmid:22384097
* View Article
* PubMed/NCBI
* Google Scholar
43. 43. Lima Cunha D, Sarkar H, Eintracht J, Harding P, Zhou JH, Moosajee M. Restoration of functional PAX6 in aniridia patient iPSC-derived ocular tissue models using repurposed nonsense suppression drugs. Mol Ther Nucleic Acids. 2023;33:240–53. pmid:37483273
* View Article
* PubMed/NCBI
* Google Scholar
44. 44. Walther C, Gruss P. Pax-6, a murine paired box gene, is expressed in the developing CNS. Dev. 1991;113(4):1435–49.
* View Article
* Google Scholar
45. 45. Glaser T, Walton DS, Maas RL. Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nat Genet. 1992;2(3):232–9. pmid:1345175
* View Article
* PubMed/NCBI
* Google Scholar
46. 46. Epstein JA, Glaser T, Cai J, Jepeal L, Walton DS, Maas RL. Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes Dev. 1994;8(17):2022–34. pmid:7958875
* View Article
* PubMed/NCBI
* Google Scholar
47. 47. Sagara A, Nakata K, Matsumoto S, Guan W, Shinkawa T, Iwamoto C. Repositioning of duloxetine to target pancreatic stellate cells. Oncology Letters. 2021;22(4):744.
* View Article
* Google Scholar
48. 48. Zhang L, Yin J-B, Hu W, Zhao W-J, Fan Q-R, Qiu Z-C, et al. Analgesic Effects of Duloxetine on Formalin-Induced Hyperalgesia and Its Underlying Mechanisms in the CeA. Front Pharmacol. 2018;9:317. pmid:29692727
* View Article
* PubMed/NCBI
* Google Scholar
49. 49. Tan J, Zhong M, Hu Y, Pan G, Yao J, Tang Y, et al. Ritanserin suppresses acute myeloid leukemia by inhibiting DGKα to downregulate phospholipase D and the Jak-Stat/MAPK pathway. Discov Oncol. 2023;14(1):118. pmid:37392305
* View Article
* PubMed/NCBI
* Google Scholar
50. 50. Boroda S, Niccum M, Raje V, Purow BW, Harris TE. Dual activities of ritanserin and R59022 as DGKα inhibitors and serotonin receptor antagonists. Biochem Pharmacol. 2017;123:29–39. pmid:27974147
* View Article
* PubMed/NCBI
* Google Scholar
51. 51. Rabiee B, Anwar KN, Shen X, Putra I, Liu M, Jung R, et al. Gene dosage manipulation alleviates manifestations of hereditary PAX6 haploinsufficiency in mice. Sci Transl Med. 2020;12(573):eaaz4894. pmid:33298563
* View Article
* PubMed/NCBI
* Google Scholar
52. 52. Srivastava K, Mishra R. Pax6 affects Ras-Raf-ERK1/2 in mouse aging brain. Biogerontology. 2023;24(6):901–12. pmid:37436500
* View Article
* PubMed/NCBI
* Google Scholar
53. 53. Moustardas P, Aberdam D, Lagali N. MAPK Pathways in Ocular Pathophysiology: Potential Therapeutic Drugs and Challenges. Cells. 2023;12(4):617. pmid:36831285
* View Article
* PubMed/NCBI
* Google Scholar
54. 54. Li T, Lu L. Epidermal growth factor-induced proliferation requires down-regulation of Pax6 in corneal epithelial cells. The Journal of Biological Chemistry. 2005;280(13):12988–95.
* View Article
* Google Scholar
55. 55. Janssens V, Goris J. Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J. 2001;353(Pt 3):417–39. pmid:11171037
* View Article
* PubMed/NCBI
* Google Scholar
56. 56. Latta L, Knebel I, Bleil C, Stachon T, Katiyar P, Zussy C, et al. Similarities in DSG1 and KRT3 Downregulation through Retinoic Acid Treatment and PAX6 Knockdown Related Expression Profiles: Does PAX6 Affect RA Signaling in Limbal Epithelial Cells?. Biomolecules. 2021;11(11):1651. pmid:34827649
* View Article
* PubMed/NCBI
* Google Scholar
57. 57. Polisetti N, Schlunck G, Reinhard T. PAX6 Expression Patterns in the Adult Human Limbal Stem Cell Niche. Cells. 2023;12(3):400. pmid:36766742
* View Article
* PubMed/NCBI
* Google Scholar
58. 58. Kitazawa K, Hikichi T, Nakamura T, Sotozono C, Kinoshita S, Masui S. PAX6 regulates human corneal epithelium cell identity. Experimental Eye Research. 2017;154:30–8.
* View Article
* Google Scholar
59. 59. Katiyar P, Stachon T, Fries FN, Parow F, Ulrich M, Langenbucher A, et al. Decreased FABP5 and DSG1 protein expression following PAX6 knockdown of differentiated human limbal epithelial cells. Exp Eye Res. 2022;215:108904. pmid:34954205
* View Article
* PubMed/NCBI
* Google Scholar
60. 60. Greco D, Vellonen K-S, Turner HC, Häkli M, Tervo T, Auvinen P, et al. Gene expression analysis in SV-40 immortalized human corneal epithelial cells cultured with an air-liquid interface. Mol Vis. 2010;16:2109–20. pmid:21139686
* View Article
* PubMed/NCBI
* Google Scholar
Citation: Suiwal S, Stachon T, Li Z, Corton M, Nastaranpour M, Chai N, et al. (2025) Gene expression study in the siRNA based aniridia cell model and in primary aniridia limbal epithelial cells following duloxetine and ritanserin treatment. PLoS One 20(6): e0324829. https://doi.org/10.1371/journal.pone.0324829
About the Authors:
Shweta Suiwal
Roles: Formal analysis, Investigation, Methodology, Validation, Writing – original draft, Writing – review & editing
E-mail: [email protected]
Affiliation: Dr. Rolf M. Schwiete Center for Limbal Stem Cell and Aniridia Research, Saarland University, Homburg/Saar, Germany
ORICD: https://orcid.org/0000-0002-1230-1279
Tanja Stachon
Roles: Conceptualization, Supervision, Writing – review & editing
Affiliation: Dr. Rolf M. Schwiete Center for Limbal Stem Cell and Aniridia Research, Saarland University, Homburg/Saar, Germany
Zhen Li
Roles: Writing – review & editing
Affiliation: Dr. Rolf M. Schwiete Center for Limbal Stem Cell and Aniridia Research, Saarland University, Homburg/Saar, Germany
ORICD: https://orcid.org/0000-0001-5491-2169
Marta Corton
Roles: Data curation, Formal analysis, Resources, Validation, Writing – review & editing
Affiliation: Departamento de Genética, Hospital Universitario Fundación Jiménez Díaz Madrid España, Área de Genética & Genómica, Instituto de Investigación Sanitaria - Fundación Jiménez Díaz - Universidad Autónoma de Madrid (IIS-FJD, UAM) Madrid España; Centro de Investigación en Red de Enfermedades Raras (CIBERER), ISCIII Madrid España,
Mahsa Nastaranpour
Roles: Investigation, Methodology
Affiliation: Dr. Rolf M. Schwiete Center for Limbal Stem Cell and Aniridia Research, Saarland University, Homburg/Saar, Germany
Ning Chai
Roles: Methodology, Writing – review & editing
Affiliation: Dr. Rolf M. Schwiete Center for Limbal Stem Cell and Aniridia Research, Saarland University, Homburg/Saar, Germany
Maryam Amini
Roles: Writing – review & editing
Affiliation: Dr. Rolf M. Schwiete Center for Limbal Stem Cell and Aniridia Research, Saarland University, Homburg/Saar, Germany
Berthold Seitz
Roles: Writing – review & editing
Affiliation: Department of Ophthalmology, Saarland University Medical Center, Homburg/Saar, Germany
ORICD: https://orcid.org/0000-0001-9701-8204
Fabian N. Fries
Roles: Resources, Writing – review & editing
Affiliations: Dr. Rolf M. Schwiete Center for Limbal Stem Cell and Aniridia Research, Saarland University, Homburg/Saar, Germany, Department of Ophthalmology, Saarland University Medical Center, Homburg/Saar, Germany
ORICD: https://orcid.org/0000-0002-8526-4712
Thomas Tschernig
Roles: Resources, Writing – review & editing
Affiliation: Institute for Anatomy and Cell Biology, Saarland University, Homburg/Saar, Germany
Nóra Szentmáry
Roles: Conceptualization, Funding acquisition, Supervision, Writing – review & editing
Affiliation: Dr. Rolf M. Schwiete Center for Limbal Stem Cell and Aniridia Research, Saarland University, Homburg/Saar, Germany
1. Lim HT, Seo E-J, Kim G-H, Ahn H, Lee H, Shin KH, et al. Comparison between aniridia with and without PAX6 mutations: clinical and molecular analysis in 14 Korean patients with aniridia. Ophthalmology. 2012;119(6):1258–64. pmid:22361317
2. Hingorani M, Williamson KA, Moore AT, van Heyningen V. Detailed ophthalmologic evaluation of 43 individuals with PAX6 mutations. Invest Ophthalmol Vis Sci. 2009;50(6):2581–90. pmid:19218613
3. Lagali N, Wowra B, Fries FN, Latta L, Moslemani K, Utheim TP, et al. PAX6 Mutational Status Determines Aniridia-Associated Keratopathy Phenotype. Ophthalmology. 2020;127(2):273–5. pmid:31708273
4. Neuhaus C, Betz C, Bergmann C, Bolz HJ. Genetik der kongenitalen Aniridie. Der Ophthalmologe: Zeitschrift der Deutschen Ophthalmologischen Gesellschaft. 2014;111(12):1157–63.
5. Gehring WJ. The master control gene for morphogenesis and evolution of the eye. Genes to Cells: Devoted to Molecular & Cellular Mechanisms. 1996;1(1):11–5.
6. Koroma BM, Yang JM, Sundin OH. The Pax-6 homeobox gene is expressed throughout the corneal and conjunctival epithelia. Investigative Ophthalmology & Visual Science. 1997;38(1):108–20.
7. Chen SY, Cheng AMS, Zhang Y, Zhu YT, He H, Mahabole M. Pax 6 Controls Neural Crest Potential of Limbal Niche Cells to Support Self-Renewal of Limbal Epithelial Stem Cells. Scientific Reports. 2019;9(1):9763.
8. Ochi S, Manabe S, Kikkawa T, Osumi N. Thirty Years’ History since the Discovery of Pax6: From Central Nervous System Development to Neurodevelopmental Disorders. Int J Mol Sci. 2022;23(11):6115. pmid:35682795
9. Duan D, Fu Y, Paxinos G, Watson C. Spatiotemporal expression patterns of Pax6 in the brain of embryonic, newborn, and adult mice. Brain structure & function. 2013;218(2):353–72.
10. Lagali N, Wowra B, Dobrowolski D, Utheim TP, Fagerholm P, Wylegala E. Stage-related central corneal epithelial transformation in congenital aniridia-associated keratopathy. Ocul Surf. 2018;16(1):163–72. pmid:29133179
11. Latta L, Figueiredo FC, Ashery-Padan R, Collinson JM, Daniels J, Ferrari S, et al. Pathophysiology of aniridia-associated keratopathy: Developmental aspects and unanswered questions. Ocul Surf. 2021;22:245–66. pmid:34520870
12. Latta L, Ludwig N, Krammes L, Stachon T, Fries FN, Mukwaya A, et al. Abnormal neovascular and proliferative conjunctival phenotype in limbal stem cell deficiency is associated with altered microRNA and gene expression modulated by PAX6 mutational status in congenital aniridia. Ocul Surf. 2021;19:115–27. pmid:32422284
13. Lagali N, Edén U, Utheim TP, Chen X, Riise R, Dellby A, et al. In vivo morphology of the limbal palisades of vogt correlates with progressive stem cell deficiency in aniridia-related keratopathy. Invest Ophthalmol Vis Sci. 2013;54(8):5333–42. pmid:23860752
14. van Velthoven AJH, Utheim TP, Notara M, Bremond-Gignac D, Figueiredo FC, Skottman H, et al. Future directions in managing aniridia-associated keratopathy. Surv Ophthalmol. 2023;68(5):940–56. pmid:37146692
15. Skeens HM, Brooks BP, Holland EJ. Congenital aniridia variant: minimally abnormal irides with severe limbal stem cell deficiency. Ophthalmology. 2011;118(7):1260–4. pmid:21376398
16. Korecki AJ, Cueva-Vargas JL, Fornes O, Agostinone J, Farkas RA, Hickmott JW, et al. Human MiniPromoters for ocular-rAAV expression in ON bipolar, cone, corneal, endothelial, Müller glial, and PAX6 cells. Gene Ther. 2021;28(6):351–72. pmid:33531684
17. Adair BA, Korecki AJ, Djaksigulova D, Wagner PK, Chiu NY, Lam SL. ABE8e Corrects Pax6-Aniridic Variant in Humanized Mouse ESCs and via LNPs in Ex Vivo Cortical Neurons. Ophthalmology and Therapy. 2023;12(4):2049–68.
18. Wang X, Gregory-Evans K, Wasan KM, Sivak O, Shan X, Gregory-Evans CY. (2017). Efficacy of Postnatal In Vivo Nonsense Suppression Therapy in a Pax6 Mouse Model of Aniridia. Molecular therapy. Nucleic acids, 7, 417–28.
19. Abdolkarimi D, Cunha DL, Lahne M, Moosajee M. PAX6 disease models for aniridia. Indian J Ophthalmol. 2022;70(12):4119–29. pmid:36453299
20. Imada T, Nakamura S, Hisamura R, Izuta Y, Jin K, Ito M, et al. Serotonin hormonally regulates lacrimal gland secretory function via the serotonin type 3a receptor. Sci Rep. 2017;7(1):6965. pmid:28761086
21. Crider JY, Williams GW, Drace CD, Katoli P, Senchyna M, Sharif NA. Pharmacological characterization of a serotonin receptor (5-HT7) stimulating cAMP production in human corneal epithelial cells. Invest Ophthalmol Vis Sci. 2003;44(11):4837–44. pmid:14578406
22. Chhadva P, Lee T, Sarantopoulos CD, Hackam AS, McClellan AL, Felix ER, et al. Human Tear Serotonin Levels Correlate with Symptoms and Signs of Dry Eye. Ophthalmology. 2015;122(8):1675–80. pmid:25983214
23. Shohayeb B, Cooper HM. The ups and downs of Pax6 in neural stem cells. J Biol Chem. 2023;299(5):104680. pmid:37028762
24. Thakurela S, Tiwari N, Schick S, Garding A, Ivanek R, Berninger B, et al. Mapping gene regulatory circuitry of Pax6 during neurogenesis. Cell Discov. 2016;2:15045. pmid:27462442
25. Roux LN, Petit I, Domart R, Concordet J-P, Qu J, Zhou H, et al. Modeling of Aniridia-Related Keratopathy by CRISPR/Cas9 Genome Editing of Human Limbal Epithelial Cells and Rescue by Recombinant PAX6 Protein. Stem Cells. 2018;36(9):1421–9. pmid:29808941
26. Singh SP, Singh V, Kar N, Chan K. Efficacy of antidepressants in treating the negative symptoms of chronic schizophrenia: meta-analysis. Br J Psychiatry. 2010;197(3):174–9. pmid:20807960
27. Bymaster FP, Lee TC, Knadler MP, Detke MJ, Iyengar S. The dual transporter inhibitor duloxetine: a review of its preclinical pharmacology, pharmacokinetic profile, and clinical results in depression. Curr Pharm Des. 2005;11(12):1475–93. pmid:15892657
28. Calabrese F, Molteni R, Cattaneo A, Macchi F, Racagni G, Gennarelli M, et al. Long-Term duloxetine treatment normalizes altered brain-derived neurotrophic factor expression in serotonin transporter knockout rats through the modulation of specific neurotrophin isoforms. Mol Pharmacol. 2010;77(5):846–53. pmid:20159945
29. Iyengar S, Webster AA, Hemrick-Luecke SK, Xu JY, Simmons RMA. Efficacy of duloxetine, a potent and balanced serotonin-norepinephrine reuptake inhibitor in persistent pain models in rats. J Pharmacol Exp Ther. 2004;311(2):576–84. pmid:15254142
30. Meng J, Zhang Q, Yang C, Xiao L, Xue Z, Zhu J. Duloxetine, a Balanced Serotonin-Norepinephrine Reuptake Inhibitor, Improves Painful Chemotherapy-Induced Peripheral Neuropathy by Inhibiting Activation of p38 MAPK and NF-κB. Front Pharmacol. 2019;10:365. pmid:31024320
31. Piccolo J, Kolesar JM. Prevention and treatment of chemotherapy-induced peripheral neuropathy. Am J Health Syst Pharm. 2014;71(1):19–25.
32. Berntsson SG, Kristoffersson A, Daniilidou M, Dahl N, Ekström C, Semnic R. Aniridia with PAX6 mutations and narcolepsy. Journal of Sleep Research. 2020;29(6):e12982.
33. Olmez I, Love S, Xiao A, Manigat L, Randolph P, McKenna BD, et al. Targeting the mesenchymal subtype in glioblastoma and other cancers via inhibition of diacylglycerol kinase alpha. Neuro Oncol. 2018;20(2):192–202. pmid:29048560
34. Latta L, Nordström K, Stachon T, Langenbucher A, Fries FN, Szentmáry N, et al. Expression of retinoic acid signaling components ADH7 and ALDH1A1 is reduced in aniridia limbal epithelial cells and a siRNA primary cell based aniridia model. Exp Eye Res. 2019;179:8–17. pmid:30292490
35. Maxeiner S, Sester M, Krasteva-Christ G. Novel human sex-typing strategies based on the autism candidate gene NLGN4X and its male-specific gametologue NLGN4Y. Biol Sex Differ. 2019;10(1):62. pmid:31852540
36. Latta L, Viestenz A, Stachon T, Colanesi S, Szentmáry N, Seitz B, et al. Human aniridia limbal epithelial cells lack expression of keratins K3 and K12. Exp Eye Res. 2018;167:100–9. pmid:29162348
37. Nastaranpour M, Suiwal S, Stachon T, Fries FN, Amini M, Seitz B, et al. miRNA Expression Profile in Primary Limbal Epithelial Cells of Aniridia Patients. Invest Ophthalmol Vis Sci. 2025;66(1):20. pmid:39786759
38. Moritz CP. Tubulin or Not Tubulin: Heading Toward Total Protein Staining as Loading Control in Western Blots. Proteomics. 2017;17(20). pmid:28941183
39. Dorot O, Roux LN, Zennaro L, Oved K, Bremond-Gignac D, Pichinuk E, et al. The antipsychotropic drug Duloxetine rescues PAX6 haploinsufficiency of mutant limbal stem cells through inhibition of the MEK/ERK signaling pathway. The ocular surface. 2022;23:140–2.
40. Oved K, Zennaro L, Dorot O, Zerbib J, Frank E, Roux LN, et al. Ritanserin, a potent serotonin 2A receptor antagonist, represses MEK/ERK signalling pathway to restore PAX6 production and function in aniridia-like cellular model. Biochem Biophys Res Commun. 2021;582:100–4. pmid:34700241
41. Sasamoto Y, Hayashi R, Park S-J, Saito-Adachi M, Suzuki Y, Kawasaki S, et al. PAX6 Isoforms, along with Reprogramming Factors, Differentially Regulate the Induction of Cornea-specific Genes. Sci Rep. 2016;6:20807. pmid:26899008
42. Kiselev Y, Eriksen TE, Forsdahl S, Nguyen LHT, Mikkola I. 3T3 cell lines stably expressing Pax6 or Pax6(5a)--a new tool used for identification of common and isoform specific target genes. PLoS One. 2012;7(2):e31915. pmid:22384097
43. Lima Cunha D, Sarkar H, Eintracht J, Harding P, Zhou JH, Moosajee M. Restoration of functional PAX6 in aniridia patient iPSC-derived ocular tissue models using repurposed nonsense suppression drugs. Mol Ther Nucleic Acids. 2023;33:240–53. pmid:37483273
44. Walther C, Gruss P. Pax-6, a murine paired box gene, is expressed in the developing CNS. Dev. 1991;113(4):1435–49.
45. Glaser T, Walton DS, Maas RL. Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nat Genet. 1992;2(3):232–9. pmid:1345175
46. Epstein JA, Glaser T, Cai J, Jepeal L, Walton DS, Maas RL. Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes Dev. 1994;8(17):2022–34. pmid:7958875
47. Sagara A, Nakata K, Matsumoto S, Guan W, Shinkawa T, Iwamoto C. Repositioning of duloxetine to target pancreatic stellate cells. Oncology Letters. 2021;22(4):744.
48. Zhang L, Yin J-B, Hu W, Zhao W-J, Fan Q-R, Qiu Z-C, et al. Analgesic Effects of Duloxetine on Formalin-Induced Hyperalgesia and Its Underlying Mechanisms in the CeA. Front Pharmacol. 2018;9:317. pmid:29692727
49. Tan J, Zhong M, Hu Y, Pan G, Yao J, Tang Y, et al. Ritanserin suppresses acute myeloid leukemia by inhibiting DGKα to downregulate phospholipase D and the Jak-Stat/MAPK pathway. Discov Oncol. 2023;14(1):118. pmid:37392305
50. Boroda S, Niccum M, Raje V, Purow BW, Harris TE. Dual activities of ritanserin and R59022 as DGKα inhibitors and serotonin receptor antagonists. Biochem Pharmacol. 2017;123:29–39. pmid:27974147
51. Rabiee B, Anwar KN, Shen X, Putra I, Liu M, Jung R, et al. Gene dosage manipulation alleviates manifestations of hereditary PAX6 haploinsufficiency in mice. Sci Transl Med. 2020;12(573):eaaz4894. pmid:33298563
52. Srivastava K, Mishra R. Pax6 affects Ras-Raf-ERK1/2 in mouse aging brain. Biogerontology. 2023;24(6):901–12. pmid:37436500
53. Moustardas P, Aberdam D, Lagali N. MAPK Pathways in Ocular Pathophysiology: Potential Therapeutic Drugs and Challenges. Cells. 2023;12(4):617. pmid:36831285
54. Li T, Lu L. Epidermal growth factor-induced proliferation requires down-regulation of Pax6 in corneal epithelial cells. The Journal of Biological Chemistry. 2005;280(13):12988–95.
55. Janssens V, Goris J. Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J. 2001;353(Pt 3):417–39. pmid:11171037
56. Latta L, Knebel I, Bleil C, Stachon T, Katiyar P, Zussy C, et al. Similarities in DSG1 and KRT3 Downregulation through Retinoic Acid Treatment and PAX6 Knockdown Related Expression Profiles: Does PAX6 Affect RA Signaling in Limbal Epithelial Cells?. Biomolecules. 2021;11(11):1651. pmid:34827649
57. Polisetti N, Schlunck G, Reinhard T. PAX6 Expression Patterns in the Adult Human Limbal Stem Cell Niche. Cells. 2023;12(3):400. pmid:36766742
58. Kitazawa K, Hikichi T, Nakamura T, Sotozono C, Kinoshita S, Masui S. PAX6 regulates human corneal epithelium cell identity. Experimental Eye Research. 2017;154:30–8.
59. Katiyar P, Stachon T, Fries FN, Parow F, Ulrich M, Langenbucher A, et al. Decreased FABP5 and DSG1 protein expression following PAX6 knockdown of differentiated human limbal epithelial cells. Exp Eye Res. 2022;215:108904. pmid:34954205
60. Greco D, Vellonen K-S, Turner HC, Häkli M, Tervo T, Auvinen P, et al. Gene expression analysis in SV-40 immortalized human corneal epithelial cells cultured with an air-liquid interface. Mol Vis. 2010;16:2109–20. pmid:21139686
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2025 Suiwal et al. This is an open access article distributed under the terms of the Creative Commons Attribution License: http://creativecommons.org/licenses/by/4.0/ (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Progressive aniridia associated keratopathy is worsening visual acuity of congenital aniridia subjects lifelong. Restoration of PAX6 expression in PAX6 haploinsufficient limbal epithelial cells could be one therapeutic option. In a previous study using aniridia-like CRISPR/Cas9 genome-edited corneal epithelial cells, the antipsychotic drugs duloxetine and ritanserin increased PAX6 mRNA and protein expression. Our purpose was to investigate the effect of duloxetine and ritanserin on cultured primary limbal epithelial cells (pLECs) without and with PAX6 knockdown. pLECs were isolated from 11 aniridia patients and corneoscleral rims of 8 healthy human donors and were treated with 5 µM duloxetine or ritanserin for 24 hours. In addition, pLECs were transfected with small interfering RNA (siRNA) (PAX6 knockdown) in the siRNA-based aniridia cell model and were also treated by 5 µM duloxetine or ritanserin for 24 hours. Gene and protein expression were analyzed using qPCR and Western blot. In both primary aniridia limbal epithelial cells and the siRNA-based aniridia cell model, the expression of PAX6 at the transcriptional or translational level did not show significant changes through duloxetine or ritanserin treatment (p > 0.5). The target genes of PAX6 such as KRT3, KRT12, DSG1, ALDH1A1, ADH7, FABP5, ABCG2 also did not change significantly (p ≥ 0.2). Our study shows that primary cultures of limbal epithelial cells from both aniridia patients and healthy donors were unresponsive to drug treatment. Therefore, our data suggest that different aniridia cell models or cell culture conditions exhibit varying responses to duloxetine and ritanserin. The use of in vivo models could further enhance our understanding of duloxetine and ritanserin treatment in aniridia-associated keratopathy.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
; Stachon, Tanja; Li, Zhen
; Corton, Marta; Nastaranpour, Mahsa; Chai, Ning; Amini, Maryam; Seitz, Berthold
; Fries, Fabian N
; Tschernig, Thomas; Szentmáry, Nóra