Germline PARN Variants in Telomere Biology Disorders and Challenges in Variant Curation

Abstract

ABSTRACT

Background

PARN encodes poly(A)‐specific ribonuclease, a 3 exoribonuclease important in regulating RNA stability and maturation. Rare germline PARN variants have been reported in telomere biology disorders (TBDs) leading to its inclusion on gene panels for bone marrow failure syndromes and pulmonary diseases.

Methods

To understand the extent of germline PARN variation in human disease, we conducted a comprehensive literature review, curated the TBD‐associated PARN variants using AutoGVP and in silico prediction tools (MetaSVM, REVEL, and/or CADD) and assessed their frequency in the gnomAD database.

Results

Ninety‐three unique PARN variants were identified in the literature as present in individuals or families affected by TBDs, but clinical features were not consistently reported. Forty‐one variants (44.1%) were classified as pathogenic or likely pathogenic. These variants were spread across the entire gene with no obvious clustering. gnomAD data were notable for a paucity of common variants and metrics suggesting PARN variation would be tolerated.

Conclusion

The extent to which specific PARN variants can be associated with TBD etiology is limited due to incomplete literature, clinical data, lack of robust functional assays, and high frequency of rare variants.

Introduction

Telomere biology disorders (TBDs) are caused by pathogenic germline variants in genes essential for telomere maintenance, resulting in short and/or dysfunctional telomeres (Revy et al. 2022; Tummala et al. 2022; Niewisch et al. 2022). Dyskeratosis congenita (DC), the prototypical TBD, is a cancer-prone inherited bone marrow failure (BMF) syndrome classically diagnosed by the triad of nail dystrophy, reticular pigmentation of the neck/upper chest, and oral leukoplakia, amongst many other medical problems (Revy et al. 2022; Tummala et al. 2022; Niewisch et al. 2022). Hoyeraal-Hreidarsson syndrome (HH) usually presents in infancy with intrauterine growth retardation, immunodeficiency, and cerebellar hypoplasia, along with DC features (Burris et al. 2016).

PARN encodes poly(A)-specific ribonuclease and is one of at least 18 different telomere biology genes associated with TBDs (Burris et al. 2016; Moon et al. 2015; Tummala et al. 2015). Located on chromosome 16, PARN is a large gene with more than 20 reported transcripts and 24 exons (ENST00000437198.7, NM_002582.4) spanning nearly 195 Mb (chr16:14,435,701-14,630,260, GRCh38). It is a highly conserved exoribonuclease, important in regulating the stability and maturation of RNAs, and acts by shortening the mRNA poly(A) tail through deadenylation (Tummala et al. 2015). PARN regulates the turnover of mRNAs and the maturation and stabilization of the human telomerase RNA component (TERC) (Benyelles et al. 2019; Dejene et al. 2020). Pathogenic germline variants in PARN have been reported to reduce TERC stability and accelerate TERC degradation, impacting telomere biology (Shukla et al. 2020).

Biallelic PARN variants with autosomal recessive inheritance have been reported in DC and HH (Burris et al. 2016; Moon et al. 2015; Tummala et al. 2015). Heterozygous PARN variants have also been identified in numerous families with Interstitial Lung Disease (ILD), such as pulmonary fibrosis (PF), a progressive and fatal lung disease characterized by scarring and fibrotic deterioration (Newton et al. 2016; Zhang et al. 2019; Stuart et al. 2015). Individuals in PF families with PARN pathogenic variants usually do not develop clinical manifestations until middle-age, and variable penetrance and/or expressivity of the phenotype have been reported (Stuart et al. 2015). PARN is now included on a wide array of genetic testing panels, including those for BMF and ILD, but variant interpretation remains a challenge due to limited data on the functional consequences of PARN variants.

We conducted a comprehensive literature review, curated the disease-associated PARN variants, and compared these variants with those reported in the Genome Aggregation Database (gnomAD) to better understand the role of PARN variation in human disease and identify areas in need of additional study.

Methods

Literature Review

Human disease-associated germline PARN variants were identified through PubMed using search terms “dyskeratosis congenita and PARN,” “Hoyeraal-Hreidarsson syndrome and PARN,” “pulmonary fibrosis and PARN,” “germline mutation or variant and PARN,” “ILD germline genetics,” “ILD telomere biology disorders,” “telomere biology disorders and PARN,” and “ILD and PARN.” We cross-referenced all literature reported PARN variants with those in the Arizona State University (ASU) Telomerase Database (Podlevsky et al. 2008) to ensure completeness. Clinical features, including study participant telomere length (TL) were recorded if reported with genotype data. Data from the literature review were finalized on March 07, 2025 (Table 1).

TABLE 1 Summary of telomere biology disorder-associated germline PARN variants and their classifications.

Literature provided cDNA position and amino acid change	rsID	Chr 16 POS (hg19Ch38)	cDNA position (NM_002582.4) and amino acid change	gnomAD exomes (ALL)	Literature provided Telomere Length	AutoGVP call	Reference
c.1749_1750delAG p.Glu585Aspfs*4	rs1194089098	14,447,001 CCT>C	c.1749_1750del p.Glu585Aspfs*5	0	short, qPCR, 6th–7th %ile RTL (Newton et al. 2016)	P	(Newton et al. 2016; Philippot et al. 2022)
c.1749_1750delAG p.Ser585fs*5	rs1194089098	14,447,001 CCT>C	c.1749_1750del p.Glu585Aspfs*5	0	short by TRF	P	(Juge et al. 2017)
c.1603G>Aa p.Gly535Arg		14,447,011 C>T	c.1741G>A p.Gly581Arg	0.0042	short, qPCR, 30th %ile RTL	B	(Wang and Xu 2021)
p.Lys566Arg	rs1567284498	14,447,055 T>C	c.1697A>G p.Lys566Arg	0		VUS	(Petrovski et al. 2017)
c.1652delA p.His551fs	rs1567284498	14,482,655 GT>G	c.1652del p.His551Profs*14	0	short, FF TL, 5.9 bp	LP	(Belaya et al. 2021)
c.1635delC p.Tyr546Thrfs*19		14,482,672 AG>A	c.1635del p.Tyr546Thrfs*19	0		LP	(Philippot et al. 2022)
c.1613G>C p.Arg538Pro	rs377199187	14,482,695 C>G	c.1613G>C p.Arg538Pro	7.72E-05	long, qPCR, 5863 bp	VUS	(Ley et al. 2019)
c.1612C>T p.Arg538Trp	rs183781022	14,482,696 G>A	c.1612C>T p.Arg538Trp	1.22E-05		VUS	(Dressen et al. 2018)
c.1577_1578delGG p.Trp526fs*		14,482,729 TCC>T	c.1577_1578del p.Trp526Tyrfs*2	0		LP	(Dressen et al. 2018)
c.1493G>A p.Ser498Asn	rs200471459	14,482,815 C>T	c.1493G>A Ser498Asn	0.0002	short, qPCR?, 1st %ile (Kropski et al. 2017)	VUS	(Kropski et al. 2017; van der Vis et al. 2021)
c.1425_1426delGAinsAT p.Trp475*		14,552,075 TC>AT	c.1425_1426delinsAT p.Trp475_Ile476delins*	0		LP	(Philippot et al. 2022)
c.1414C>T	rs751946182	14,552,087 G>A	c.1414C>T p.Gln472*	0		P	(Philippot et al. 2022)
c.1381C>G p.Leu461Val		14,554,089 G>C	c.1381C>G p.Leu461Val	1.23E-05		VUS	(Petrovski et al. 2017)
p.Asp460Asn	rs747006604	14,554,092 C>T	c.1378G>A p.Asp460Asn	1.23E-05		VUS	(Petrovski et al. 2017)
p.Arg444His		14,554,139 C>T	c.1331G>A p.Arg444His	4.09E-06		VUS	(Petrovski et al. 2017)
c.1330C>T p.Arg444Cys	rs765981944	14,554,140 G>A	c.1330C>T p.Arg444Cys	3.27E-05	short, qPCR assay, homozygous carrier: 1st %ile, heterozygous carrier: 10th%ile	VUS	(Zhang et al. 2019)
c.1328A>G p.Lys443Arg		14,554,142 T>C	c.1328A>G p.Lys443Arg	0	long, qPCR, 5284 bp	VUS	(Ley et al. 2019)
c.1319-2A>T		14,554,153 T>A	c.1319-2A>T	0		P	(Manali et al. 2022)
c.1319-2A>G		14,554,153 T>C	c.1319-2A>G	0		P	(Philippot et al. 2022; Manali et al. 2022)
c.1318 + 2 T>C		14,555,652 A>G	c.1318 + 2 T>C	0		LP	(Dressen et al. 2018)
c.1310G>A		14,555,662 C>T	c.1310G>A p.Gly437Glu	0	short, MMqPCR	VUS	(van Batenburg et al. 2020)
c.1288dupA		14,555,683 A>AT	c.1288dup p.Ile430Asnfs*14	0		LP	(Philippot et al. 2022)
c.1286A>G p.Asp429Gly		14,555,686 T>C	c.1286A>G p.Asp429Gly	0		VUS	(Bluteau et al. 2018)
((c.1262A>G p.Lys421Arg	rs777090017	14,580,874 T>C	c.1262A>G p.Lys421Arg	8.13E-06	short, TRFL, < 1st %ile	VUS	(Stuart et al. 2015)
c.1251delT p.Phe418Phefs*6		14,580,878 TA>T	c.1257del p.Phe419Leufs*7	0	short, qPCR, 15th %ile	P	(Kropski et al. 2017)
c.1159G>A p.Gly387Arg		14,582,214 C>T	c.1159G>A p.Gly387Arg	8.12E-06	short, flow-FISH method, < 1st %ile (Dressen et al. 2018)	VUS	(Dressen et al. 2018; Kung et al. 2023)
c.1151A>G p.Tyr384Cys	rs199551987	14,582,222 T>C	c.1151A>G p.Tyr384Cys	4.06E-05		VUS	(Dressen et al. 2018)
c.1148C>T p.Ala383Val	rs786200999	14,582,225 G>A	c.1148C>T p.Ala383Val	0	short, FF, 1st %ile	VUS	(Tummala et al. 2015)
c.1132G>A p.Glu378Lys	rs761566642	14,582,241 C>T	c.1132G>A p.Glu378Lys	6.06E-05		VUS	(Philippot et al. 2022)
p.Glu374*		14,582,253 C>A	c.1120G>T p.Glu374*	0		P	(Petrovski et al. 2017)
c.1098dup p.Pro367Serfs*4		14,582,274 G>GA	c.1098dup p.Pro367Serfs*4	0		LP	(Philippot et al. 2022)
c.1082-1G>C		14,582,292 C>G	c.1082-1G>C	0		P	(Dressen et al. 2018)
c.1081 + 1G>A		14,584,346 C>T	c.1081 + 1G>A	0	short, TRF, ~3rd %ile	P	(Stuart et al. 2015)
c.1056_1057delGA p.Glu352Aspfs*7		14,584,370 G>A	c.1056_1057del p.Glu352Aspfs*7	0		LP	(Philippot et al. 2022; Verduyn et al. 2017)
c.1045C>T p.Arg349Trp	rs754368658	14,584,383 T>C	c.1045C>T p.Arg349Trp	8.13E-06	short, FF, < 1st %ile (Dhanraj et al. 2015); short, FF, 10th–50th %ile (Banaszak et al. 2023); short, flow-FISH, 1st %ile (Groen et al. 2024)	VUS	(Dhanraj et al. 2015; Banaszak et al. 2023; Groen et al. 2024)
c.1006-2A>G	rs1469272825	14,584,424 T>C	c.1006-2A>G	4.08E-06	short, FF, 10th %ile	P	(Feurstein et al. 2020)
c.1006-11G>A		14,584,433 C>T	c.1006-11G>A	3.68E-05	short, qPCR, 1st %ile, 2nd %ile	VUS	(Kropski et al. 2017)
c.962 + 1G>A		14,586,317 C>T	c.962 + 1G>A	0		P	(Dressen et al. 2018)
c.948_949delAT p.Val318Phefs*8	rs1461036243	14,586,330 CAT>T	c.948_949del p.Val318Phefs*8	5.96E-06		P	(Philippot et al. 2022)
c.918 + 1G>T	rs756132866	14,593,300 C>A	c.918 + 1G>T	8.15E-06	short, flow-FISH and MMqPCR, 1st %ile	VUS	(Tummala et al. 2015)
c.887_888delCA p.Thr296Serfs*14		14,593,330 CTG>C	c.887_888del p.Thr296Serfs*14	0	short, qPCR, 2nd %ile, 3rd %ile	LP	(Kropski et al. 2017)
p.Met294Ile		14,593,337 C>A	c.882G>T p.Met294Ile	0		VUS	(Petrovski et al. 2017)
c.874delG p.Asp292Thrfs*16		14,593,344 TC>T	c.874del p.Asp292Thrfs*17	0	short, qPCR, 10th–11th %ile	LP	(Newton et al. 2016)
p.Met289Val		14,593,354 T>C	c.865A>G p.Met289Val	4.07E-06		VUS	(Dressen et al. 2018)
c.863dupA p.Asn288Lysfs*23	rs786201001	14,593,355 A>AT	c.863dup p.Asn288Lysfs*23	0	not determined due to lack of quality DNA	LP	(Tummala et al. 2015)
c.840 + 6 T>C	rs59687658	14,599,898 A>G	c.840 + 6 T>C	0.0024	short, qPCR, 1st %ile	B	(Kropski et al. 2017)
c.840 + 1_841-1_1262 + 1_1263-1del		14,599,902 AC>A	c.840 + 1del	0		VUS	(Philippot et al. 2022)
c.819_820insTAGAAATCATTTCTAGAGTC p.Ile274*	rs1596812454	14,599,924 T>TGACTCTAGAAATGATTTCTA	c.819_820insTAGAAATCATTTCTAGAGTC p.Ile274*	0	normal length, FF, 50th %ile	P	(Dodson et al. 2019)
c.783 + 1G>A		14,604,145 C>T	c.783 + 1G>A	0		P	(Philippot et al. 2022)
c.760C>T p.Gln254*		14,604,169 G>A	c.760C>T p.Gln254*	0	short, flow-FISH, 6.5kB	P	(Benyelles et al. 2019)
c.751delA p.Arg251Glufs*14		14,604,177 CT>C	c.751del p.Arg251Glufs*14	0	short, TRF, 30th %ile	LP	(Stuart et al. 2015)
c.745C>T p.Arg249Cys	rs774170618	14,604,184 G>A	c.745C>T p.Arg249Cys	5.23E-05	long, qPCR, 5683 bp	VUS	(Ley et al. 2019)
c.709C>T p.Arg237*	rs760506977	14,604,220 G>A	c.709C>T p.Arg237*	4.75E-06	short, flow-FISH, 10th, 10th–50th, 10th–50th, 10th–50th, 1st–10th %ile (Feurstein et al. 2020)	P	(Burris et al. 2016; Feurstein et al. 2020)
c.703-11_703-10delAT		14,604,235 CAT>C	c.703-11_703-10del		short, qPCR, 1st %ile, 2nd %ile	LB	(Kropski et al. 2017)
c.698A>G p.Glu233Gly		14,606,488 T>C	c.698A>G p.Glu233Gly	0		VUS	(Bluteau et al. 2018)
c.677A>G p.His226Arg		14,606,509 T>C	c.677A>G p.His226Arg	0		VUS	(Bluteau et al. 2018)
c.665C>T p.Pro222Leu		14,606,521 G>A	c.665C>T p.Pro222Leu	2.82E-05		VUS	(Dressen et al. 2018)
c.659 + 4_659 + 7delAGTA		14,608,273 ATACT>A	c.659 + 4_659 + 7del	4.80E-05	not determined due to lack of quality DNA	VUS	(Tummala et al. 2015)
c.625C>T p. Gln209*		14,608,315 G>A	c.625C>T p.Gln209*	0		P	(Philippot et al. 2022; Manali et al. 2022)
c.620 + 5G>A		14,609,053 C>T	c.620 + 5G>A	0	short, qPCR, 1st %ile	VUS	(Kropski et al. 2017)
c.620 + 1G>A		14,609,057 C>T	c.620 + 1G>A	0		P	(Dressen et al. 2018)
c.565G>T p.Glu189*		14,609,113 C>A	c.565G>T p.Glu189*	0	short, qPCR: 1st %ile, 1st %ile, 12th %ile	P	(Kropski et al. 2017)
c.563_564insT p.Ile188Ilefs*7		14,609,114 T>TA	c.563dup p.Glu189Argfs*7	0	short, TRF, ~7th %ile	P	(Stuart et al. 2015)
c.534G>T p.Lys178Asn		14,610,664 C>A	c.534G>T p.Lys178Asn	4.06E-06		VUS	(Dressen et al. 2018)
c.529C>T p.Gln177*	rs876661305	14,610,669 G>A	c.529C>T p.Gln177*	0	short, TRF < 1st %ile (Stuart et al. 2015), short, TRF (Yildirim et al. 2020)	P	(Stuart et al. 2015; Yildirim et al. 2020)
c.482A>G p.Tyr161Cys	rs201990148	14,610,716 T>C	c.482A>G p.Tyr161Cys	6.50E-05		VUS	(Philippot et al. 2022; Attardi et al. 2024)
c.459G>C p.Ala153Ala		14,610,739 C>G	c.459G>C p.Ala153Ala	4.06E-06	short, qPCR, 21st %ile, 22nd %ile	LB	(Kropski et al. 2017)
c.448C>T p.Arg150Cys	rs777558836	14,610,750 G>A	c.448C>T p.Arg150Cys	4.47E-05	short, FF	VUS	(Liu and Rose 2022)
c.421C>T p.Gln141*		14,610,777 G>A	c.421C>T p.Gln141*	0	long, qPCR, 5788 bp	P	(Ley et al. 2019)
c.388G>A p.Gly130Arg		14,617,590 C>T	c.388G>A p.Gly130Arg	4.06E-06	short, FF, < 1st %ile, 1st–10th %ile (Zhang et al. 2024)	VUS	(Dressen et al. 2018; Zhang et al. 2024)
p.Arg128Gln		14,617,595 C>T	c.383G>A p.Arg128Gln	1.63E-05		VUS	(Dressen et al. 2018)
c.382C>T p.Arg128*	rs1318821563	14,617,596 G>A	c.382C>T p.Arg128*	4.01E-06		P	(Wang et al. 2024)
c.345 T>G p.Phe115Leu		14,617,630 TAGAA>T	c.344_347del p.Phe115*	0		LP	(Philippot et al. 2022)
c.344_347del p.Phe115*		14,617,633 A>C	c.345 T>G p.Phe115Leu	0		VUS	(Philippot et al. 2022]
c.338 T > A p.Ille113Asn		14,617,638 CA>C	c.339del p.Ile113Metfs*4		short, flow-FISH, < 1st %ile	LP	(Banaszak et al. 2023)
c.281C>T p.Pro94Leu		14,627,152 G>A	c.281C>T p.Pro94Leu	0	short, qFISH (van Batenburg et al. 2018)	VUS	[Dressen et al. 2018; van Batenburg et al. 2018]
c.272A>G p.Tyr91Cys	rs201765587	14,627,161 T>C	c.272A>G p.Tyr91Cys	7.05E-05	short, FF, < 1st %ile (Dodson et al. 2019)	LP	(Philippot et al. 2022; Dressen et al. 2018; Dodson et al. 2019)
p.Phe90Val		14,627,165 A>C	c.268 T>G p.Phe90Val	0	short, FF, < 1st %ile	VUS	(Alder et al. 2018)
c.260C>T p.Ser87Leu		14,627,173 G>A	c.260C>T p.Ser87Leu	0	short, FF, < 1st %ile	VUS	(Moon et al. 2015)
c.246-1G>A		14,627,188 C>T	c.246-1G>A		short, qPCR, < 1 RTL	P	(Cheng et al. 2024)
c.246-2A>G	rs751381953	14,627,189 T>C	c.246-2A>G	4.30E-06	short, TRF, < 1st %ile (Stuart et al. 2015); short, qPCR, 1st–2nd %ile (Newton et al. 2016)	P	(Newton et al. 2016; Stuart et al. 2015)
c.245 + 75_245 + 77delCCC		14,627,191 GGAT>G	c.246-7_246-5del	0	short, qPCR, 15th %ile	VUS	(Kropski et al. 2017)
c.204G>T p.Gln68His		14,627,310 C>A	c.204G>T p.Gln68His	0	short, FF, 3.4 kB (Benyelles et al. 2019)	VUS	(Benyelles et al. 2019; Zeng et al. 2020)
c.178_245del p.Ly59fs*6		14,627,269–14,627,336	c.178_245del Exon 4 deletion	0	short, qPCR, < 1st %ile RTL	Long Deletion, unable to run AutoGVP	(Zeng et al. 2020)
c.178-3C>T		14,627,339 G>A	c.178-3C>T	1.56E-05	short, qPCR, 7th %ile. 9th %ile	VUS	(Kropski et al. 2017)
c.168G>C p.Lys56Asn		14,628,181 C>G	c.168G>C p.Lys56Asn	2.87E-05	short, qPCR, 5th %ile, 5th %ile	VUS	(Kropski et al. 2017)
c.80 T>G p.Ile27Ser		14,629,614 A>C	c.80 T>G p.Ile27Ser	0		VUS	(Dressen et al. 2018)
p.Ala26Val		14,629,617 G>A	c.77C>T p.Ala26Val	0		VUS	(Petrovski et al. 2017)
c.24del p.Phe8Leufs*12	rs1555512179	14,629,669 TA>T	c.24del p.Phe8Leufs*12	0	short, FF, < 1st %ile (Alder et al. 2018); short, FF, 10th %ile (Feurstein et al. 2020)	P	(Feurstein et al. 2020; Alder et al. 2018)
c.19A>C p.Asn7His		14,630,107 T>G	c.19A>C p.Asn7His	0	short, FF, 1st %ile	VUS	(Moon et al. 2015)
c.8 T>A p.Ile3Lys		14,630,118 A>T	c.8 T>A p.Ile3Lys	0		VUS	(Dressen et al. 2018)
Deletion exon 1–21					short, FF, 10th %ile, 50th %ile, 10th–50th %ile, 10th–50th %ile, not determined due to lack of quality DNA (5×)	Long Deletion, unable to run AutoGVP	(Feurstein et al. 2020)
Deletion exon 12					short, FF, < 1st %ile	Long Deletion, unable to run AutoGVP	(Feurstein et al. 2020)

PARN Variants in gnomAD

The Genome Aggregation Database (gnomAD v4.1.0) was last accessed for this study on March 07, 2025 (Chen et al. 2024). PARN variants assessed included those in unrelated individuals (n = 807,162) and all exonic and splice-site region (< 10 intronic base pairs from intron/exon boundary) variants from the PARN transcript NM_002582.4/ENST00000437198.7, including missense, nonsense, and frameshift variants. Intronic, untranslated region (UTR), and synonymous variants were excluded.

PARN Variant Curation

Automated Germline Variant Pathogenicity (AutoGVP), a tool that integrates germline variant pathogenicity annotations from ClinVar and InterVar to support clinically oriented classification of germline sequence variants, was used to classify all variants (Kim et al. 2024). It applies the variant classification rules established by the American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG-AMP) by systematically evaluating pathogenicity criteria (Kim et al. 2024; Richards et al. 2015).

ANNOVAR was also used to annotate in silico predictions scores as additional support for AutoGVP variant classification (Wang et al. 2010). Variants not reported as pathogenic/likely pathogenic (P/LP) by AutoGVP but predicted to affect protein function by ANNOVAR or splice by SpliceAI were deemed likely deleterious (LD). Missense variants were deemed LD if at least two of the three in silico predictions scores were concordant (MetaSVM > 0, REVEL ³0.5, and/or CADD ³20) (Kim et al. 2017; Ioannidis et al. 2016; Kircher et al. 2014). Splice region variants were assessed using SpliceAI and deemed LD if scores for the respective site (donor or acceptor) were > 0.5 (Desmet et al. 2009).

Results

Disease-Associated PARN Variants in the Literature

There were 93 unique TBD-associated PARN variants in the literature (Figure 1, Table 1 and Table S1). AutoGVP classified 41(44.1%) literature variants as P/LP, 45 (48.4%) as variants of uncertain significance (VUS) and 4 (4.3%) as benign or likely benign (B/LB) (Figure 1). Curation of splice region variants was consistent, with all being classified as P/LP by AutoGVP and LD by Splice AI. Of the coding variants classified as LD by ANNOVAR or Splice AI, only three variants (c.345 T > G, c.388 T > A, and c.272A>G) also aligned with AutoGVP's P/LP classification (Table S1). In contrast, 16.13% of variants classified as LD by in silico tools were categorized as VUS by AutoGVP.

[IMAGE OMITTED. SEE PDF]

Of the 41 P/LP literature variants, 4 (9.8%) were associated with bone marrow failure (BMF), 33 (80.5%) with ILD, and 4 (9.8%) with both ILD and BMF (Figure 1). Six of the P/LP variants were reported in manuscripts focused on multi-system TBDs, including DC and HH. Of the 45 VUS literature variants, 10 (22.2%) were reported in BMF, 32 (71.1%) were reported in ILD, and 3 (6.7%) were both ILD and BMF.

PARN Variants in the gnomAD

To better understand the extent of germline PARN variation, we next queried the unrelated individuals in gnomAD (n = 807,162). Notably, no variants were present at a minor allele frequency (MAF) > 0.01. There were 1002 distinct, rare PARN variants with MAFs ranging from 9.12 × 10⁻³ to 6.2 × 10⁻⁷ present across all ancestry groups (Table S2). AutoGVP classified 116 variants as P/LP and 880 variants as VUS. Sixteen of the 116 P/LP variants found in gnomAD were also reported as disease-associated P/LP variants in the literature (Table 1, Tables S1 and S2).

Constraint metrics in gnomAD suggest that PARN may be tolerant of germline variation with ratios of observed to expected (O/E) synonymous and nonsynonymous variants each equal to 1 (90% confidence intervals 0.84–1.19 and 0.94–1.15, respectively). It is also likely to tolerate loss of function variation with an O/E = 0.59 (90% CI 0.39–0.92) and a probability of being loss-of-function intolerant (pLI) score of 0.

Telomere Length

In the literature, TL was assessed using telomere restriction fragment (TRF), quantitative polymerase chain reaction (qPCR), and flow cytometry with fluorescent in situ hybridization (flow-FISH) (Table 1 and Table S1). Not all reports assessed TL. Across all methods of measurement, individuals with PARN variants associated with ILD and BMF had short TL, with most cases below the 1st percentile. Specifically, reports of individuals with BMF indicated TL less than the 1st percentile (flow FISH) or < 6.5kB (TRF). Variants associated with ILD and both ILD and BMF also showed individuals with short telomeres but with much more variability (ranging between 2nd and 50th percentile). Despite the predominance of short TL, a small subset of ILD cases presented with long TL (such as c.1613G > C with 5863 bp and c.1328A > G with 5284 bp), with values greater than the 50th percentile (Ley et al. 2019).

Discussion

Rare germline variation in PARN is attributed to the etiology of TBDs including familial PF, ILD, DC, and HH. This study sought to understand the spectrum of germline PARN variation by compiling and curating literature variants reported in patients with TBDs and assessing PARN variants in the general populations. Given PARN's key role in RNA maturation and stability, we expected to find that PARN would have few rare variants, and that curation would show most literature variants to be P/LP. However, variant curation classified less than half (44.1%) of TBD associated literature variants that met P/LP criteria. No distinct clustering of variants (i.e., a mutational hot spot) or associated phenotypes was observed within specific domains of the PARN protein, making it difficult to infer functional significance or establish a clear correlation with P/LP classification (Figure 1).

Rare variation is common in PARN and it is notable that there were no exonic or splice site variants present at MAF > 0.01 in the 807,162 gnomAD samples. Notably, across the entire gene, there were only three predicted benign intronic variants present at MAF > 0.01 in all populations combined and only 13 (non-exonic and non-splice site) variants had a MAF > 0.01 in any population (gnomAD GroupMax = maximum filtering allele frequency across all non-bottlenecked regions). gnomAD metrics also suggested that loss of function variation may not be pathogenic. This makes PARN variant interpretation even more challenging because TBD phenotypes can present later in life and/or with variable disease expressivity.

Partial gene deletions of single or multiple exons and insertion/deletion variants ranging from 2 to 20 bp were present in literature cases and not able to be assessed due to bioinformatic limitations. These copy number variants require specific study to assess whether challenges in sequencing or aligning this region of the genome exist.

While critically short telomeres (< 1st percentile) are a hallmark of TBDs, TL in individuals with TBD-associated PARN variants was not always short. The literature was notable for significant variability in TL measurement methods, introducing additional challenges in assessing PARN-related TBDs. Most reports used qPCR or flow-FISH, with a minority using TRF. Flow-FISH has been demonstrated to be more sensitive and reproducible, particularly for detecting telomeres below the 10th percentile, a range that is significant for many individuals with PARN variants and TBDs (Gutierrez-Rodrigues et al. 2014). The inconsistency in TL assessment methods represents a limitation in fully understanding the role of telomere biology in PARN-related TBDs and highlights the need for standardized measurement approaches.

All the variants classified as LD by ANNOVAR or Splice AI corresponded with AutoGVP P/LP classification. However, not all literature disease-associated variants classified as P/LP through AutoGVP were classified as LD by these predictive tools, demonstrating the limitations of in silico predictions. This highlights the need for integrating additional evidence, such as functional studies and clinical data, to improve variant interpretation.

Given the frequency of rare variants in PARN and its inclusion on many genetic testing panels for BMF and ILD, a comprehensive assessment of variants on PARN function is required to improve curation. Individuals identified with rare germline PARN variants should be carefully assessed for features of TBDs, including BMF, PF, ILD, liver disease, cancer, other medical complications, and have lymphocyte telomeres measured by flow-FISH, given its high sensitivity for detecting critically short telomeres (Revy et al. 2022; Tummala et al. 2022; Niewisch et al. 2022). Family medical history should be assessed, and family members evaluated as needed. Since genetic testing often identifies individuals without the expected phenotype, the scientific literature would benefit from consistency in the publication of phenotype data in conjunction with reports of germline variants. To enhance consistency in phenotype data reporting, we recommend that publications describing TBD variants include standardized phenotype categories such as pulmonary, liver, cutaneous, myeloid, and cancer-related features. Establishing clear reporting guidelines will aid in variant curation and improve the utility of genetic testing for PARN-associated disease.

Author Contributions

H.T.N. and M.B.T. collected, analyzed, and interpreted data and drafted the manuscript. A.S.T., M.R.N., K.C.A., and L.J.M. interpreted the results and edited the manuscript. S.A.S. designed the study, interpreted the results, wrote the manuscript, and provided supervision. All authors approved the final manuscript.

Acknowledgments

This work was supported by the Division of Cancer Epidemiology and Genetics, National Cancer Institute (NCI), National Institutes of Health (NIH). We utilized the computational resources of the NIH HPC Biowulf cluster (). M.B.T. was supported by the iCURE program of the NCI. M.R.N. was supported by the Mildred-Scheel-Postdoctoral Fellowship Program of German Cancer Aid. H.T.N. was supported by the Undergraduate Scholars Program of the NIH.

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data that support the findings of this study are available in gnomAD at . These data were derived from the following resources available in the public domain: PubMed, .

References

Alder, J. K., V. S. Hanumanthu, M. A. Strong, et al. 2018. “Diagnostic Utility of Telomere Length Testing in a Hospital‐Based Setting.” Proceedings of the National Academy of Sciences of the United States of America 115, no. 10: E2358–E2365.

Attardi, E., L. Tiberi, G. Mattiuz, et al. 2024. “Prospective Genetic Germline Evaluation in a Consecutive Group of Adult Patients Aged <60 Years With Myelodysplastic Syndromes.” HemaSphere 8, no. 7: e112.

Banaszak, L. G., K. Smith‐Simmer, K. Shoger, et al. 2023. “Implementation of a Prospective Screening Strategy to Identify Adults With a Telomere Biology Disorder Among Those Undergoing Lung Transplant Evaluation for Interstitial Lung Disease.” Respiratory Medicine 220: 107464.

Belaya, Z., O. Golounina, A. Nikitin, et al. 2021. “Multiple Bilateral Hip Fractures in a Patient With Dyskeratosis Congenita Caused by a Novel Mutation in the PARN Gene.” Osteoporosis International 32, no. 6: 1227–1231.

Benyelles, M., H. Episkopou, M. F. O'Donohue, et al. 2019. “Impaired Telomere Integrity and rRNA Biogenesis in PARN‐Deficient Patients and Knock‐Out Models.” EMBO Molecular Medicine 11, no. 7: e10201.

Bluteau, O., M. Sebert, T. Leblanc, et al. 2018. “A Landscape of Germ Line Mutations in a Cohort of Inherited Bone Marrow Failure Patients.” Blood 131, no. 7: 717–732.

Burris, A. M., B. J. Ballew, J. B. Kentosh, et al. 2016. “Hoyeraal‐Hreidarsson Syndrome due to PARN Mutations: Fourteen Years of Follow‐Up.” Pediatric Neurology 56: 62–68.

Chen, S., L. C. Francioli, J. K. Goodrich, et al. 2024. “A Genomic Mutational Constraint Map Using Variation in 76,156 Human Genomes.” Nature 625, no. 7993: 92–100.

Cheng, H. C., A. Nanda, C. Y. Lin, J. A. McGrath, and C. K. Hsu. 2024. “Hoyeraal–Hreidarsson Syndrome Associated With a New Homozygous Splice Variant in PARN.” Clinical and Experimental Dermatology 49, no. 10: 1284–1287.

Dejene, E. A., Y. Li, Z. Showkatian, H. Ling, and E. Seto. 2020. “Regulation of Poly(a)‐specific Ribonuclease Activity by Reversible Lysine Acetylation.” Journal of Biological Chemistry 295, no. 30: 10255–10270.

Desmet, F. O., D. Hamroun, M. Lalande, G. Collod‐Béroud, M. Claustres, and C. Béroud. 2009. “Human Splicing Finder: An Online Bioinformatics Tool to Predict Splicing Signals.” Nucleic Acids Research 37, no. 9: e67.

Dhanraj, S., S. M. Gunja, A. P. Deveau, et al. 2015. “Bone Marrow Failure and Developmental Delay Caused by Mutations in Poly(A)‐Specific Ribonuclease (PARN).” Journal of Medical Genetics 52, no. 11: 738–748.

Dodson, L. M., A. Baldan, M. Nissbeck, et al. 2019. “From Incomplete Penetrance With Normal Telomere Length to Severe Disease and Telomere Shortening in a Family With Monoallelic and Biallelic PARN Pathogenic Variants.” Human Mutation 40, no. 12: 2414–2429.

Dressen, A., A. R. Abbas, C. Cabanski, et al. 2018. “Analysis of Protein‐Altering Variants in Telomerase Genes and Their Association With MUC5B Common Variant Status in Patients With Idiopathic Pulmonary Fibrosis: A Candidate Gene Sequencing Study.” Lancet Respiratory Medicine 6, no. 8: 603–614.

Feurstein, S., A. Adegunsoye, D. Mojsilovic, et al. 2020. “Telomere Biology Disorder Prevalence and Phenotypes in Adults With Familial Hematologic and/or Pulmonary Presentations.” Blood Advances 4, no. 19: 4873–4886.

Groen, K., J. J. van der Vis, A. A. van Batenburg, et al. 2024. “A New Variant in the ZCCHC8 Gene: Diverse Clinical Phenotypes and Expression in the Lung.” ERJ Open Research 10, no. 1: 00487‐2023.

Gutierrez‐Rodrigues, F., B. A. Santana‐Lemos, P. S. Scheucher, R. M. Alves‐Paiva, and R. T. Calado. 2014. “Direct Comparison of Flow‐FISH and qPCR as Diagnostic Tests for Telomere Length Measurement in Humans.” PLoS One 9, no. 11: e113747.

Ioannidis, N. M., J. H. Rothstein, V. Pejaver, et al. 2016. “REVEL: An Ensemble Method for Predicting the Pathogenicity of Rare Missense Variants.” American Journal of Human Genetics 99, no. 4: 877–885.

Juge, P. A., R. Borie, C. Kannengiesser, et al. 2017. “Shared Genetic Predisposition in Rheumatoid Arthritis‐Interstitial Lung Disease and Familial Pulmonary Fibrosis.” European Respiratory Journal 49, no. 5: 1602314.

Kim, J., A. S. Naqvi, R. J. Corbett, et al. 2024. “AutoGVP: A Dockerized Workflow Integrating ClinVar and InterVar Germline Sequence Variant Classification.” Bioinformatics 40, no. 3: btae114.

Kim, S., J. H. Jhong, J. J. Lee, and J. Y. Koo. 2017. “Meta‐Analytic Support Vector Machine for Integrating Multiple Omics Data.” Biodata Mining 10: 2.

Kircher, M., D. M. Witten, P. Jain, B. J. O'Roak, G. M. Cooper, and J. Shendure. 2014. “A General Framework for Estimating the Relative Pathogenicity of Human Genetic Variants.” Nature Genetics 46, no. 3: 310–315.

Kropski, J. A., S. Reiss, C. Markin, et al. 2017. “Rare Genetic Variants in PARN Are Associated With Pulmonary Fibrosis in Families.” American Journal of Respiratory and Critical Care Medicine 196, no. 11: 1481–1484.

Kung, S. C., O. Dixon, S. Kentwell, et al. 2023. “Telomere Biology Disorder Presenting Acutely With Pulmonary Fibrosis and Hepatopulmonary Syndrome in a Young Adult Male.” Respirology Case Reports 11, no. 8: e01182.

Ley, B., D. G. Torgerson, J. M. Oldham, et al. 2019. “Rare Protein‐Altering Telomere‐Related Gene Variants in Patients With Chronic Hypersensitivity Pneumonitis.” American Journal of Respiratory and Critical Care Medicine 200, no. 9: 1154–1163.

Liu, H., and M. J. Rose. 2022. “Dysplastic Megakaryocytes in Dyskeratosis Congenita With Variant in PARN.” Blood 139, no. 26: 3779.

Manali, E. D., C. Kannengiesser, R. Borie, et al. 2022. “Genotype‐Phenotype Relationships in Inheritable Idiopathic Pulmonary Fibrosis: A Greek National Cohort Study.” Respiration 101, no. 6: 531–543.

Moon, D. H., M. Segal, B. Boyraz, et al. 2015. “Poly(A)‐specific Ribonuclease (PARN) Mediates 3′‐End Maturation of the Telomerase RNA Component.” Nature Genetics 47, no. 12: 1482–1488.

Newton, C. A., K. Batra, J. Torrealba, et al. 2016. “Telomere‐Related Lung Fibrosis Is Diagnostically Heterogeneous but Uniformly Progressive.” European Respiratory Journal 48, no. 6: 1710–1720.

Niewisch, M. R., N. Giri, L. J. McReynolds, et al. 2022. “Disease Progression and Clinical Outcomes in Telomere Biology Disorders.” Blood 139, no. 12: 1807–1819.

Petrovski, S., J. L. Todd, M. T. Durheim, et al. 2017. “An Exome Sequencing Study to Assess the Role of Rare Genetic Variation in Pulmonary Fibrosis.” American Journal of Respiratory and Critical Care Medicine 196, no. 1: 82–93.

Philippot, Q., C. Kannengiesser, M. P. Debray, et al. 2022. “Interstitial Lung Diseases Associated With Mutations of Poly(A)‐Specific Ribonuclease: A Multicentre Retrospective Study.” Respirology 27, no. 3: 226–235.

Podlevsky, J. D., C. J. Bley, R. V. Omana, X. Qi, and J. J. Chen. 2008. “The Telomerase Database.” Nucleic Acids Research 36, no. Database issue: D339–D343.

Revy, P., C. Kannengiesser, and A. A. Bertuch. 2022. “Genetics of Human Telomere Biology Disorders.” Nature Reviews. Genetics 24: 86–108.

Richards, S., N. Aziz, S. Bale, et al. 2015. “Standards and Guidelines for the Interpretation of Sequence Variants: A Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.” Genetics in Medicine 17, no. 5: 405–424.

Shukla, S., H. C. Jeong, C. M. Sturgeon, R. Parker, and L. F. Z. Batista. 2020. “Chemical Inhibition of PAPD5/7 Rescues Telomerase Function and Hematopoiesis in Dyskeratosis Congenita.” Blood Advances 4, no. 12: 2717–2722.

Stuart, B. D., J. Choi, S. Zaidi, et al. 2015. “Exome Sequencing Links Mutations in PARN and RTEL1 With Familial Pulmonary Fibrosis and Telomere Shortening.” Nature Genetics 47, no. 5: 512–517.

Tummala, H., A. Walne, and I. Dokal. 2022. “The Biology and Management of Dyskeratosis Congenita and Related Disorders of Telomeres.” Expert Review of Hematology 15, no. 8: 685–696.

Tummala, H., A. Walne, L. Collopy, et al. 2015. “Poly(A)‐specific Ribonuclease Deficiency Impacts Telomere Biology and Causes Dyskeratosis Congenita.” Journal of Clinical Investigation 125, no. 5: 2151–2160.

van Batenburg, A. A., K. M. Kazemier, M. F. M. van Oosterhout, et al. 2020. “From Organ to Cell: Multi‐Level Telomere Length Assessment in Patients With Idiopathic Pulmonary Fibrosis.” PLoS One 15, no. 1: e0226785.

van Batenburg, A. A., K. M. Kazemier, T. Peeters, et al. 2018. “Cell Type‐Specific Quantification of Telomere Length and DNA Double‐Strand Breaks in Individual Lung Cells by Fluorescence In Situ Hybridization and Fluorescent Immunohistochemistry.” Journal of Histochemistry and Cytochemistry 66, no. 7: 485–495.

van der Vis, J. J., J. J. van der Smagt, A. A. van Batenburg, et al. 2021. “Pulmonary Fibrosis in Non‐Mutation Carriers of Families With Short Telomere Syndrome Gene Mutations.” Respirology 26, no. 12: 1160–1170.

Verduyn, M., M. Rigaud, and C. Dromer. 2017. “A Rare Familial Form of Idiopathic Pulmonary Fibrosis With Poly(A)‐Specific Ribonuclease (PARN) Mutation.” Revue de Pneumologie Clinique 73, no. 5: 272–275.

Wang, C. Y., L. Liu, H. Peng, and H. Luo. 2024. “A Nonsense Mutation (c.382C>T) of PARN in a Patient With Idiopathic Pulmonary Fibrosis.” QJM: Monthly Journal of the Association of Physicians 117, no. 8: 605–607.

Wang, K., M. Li, and H. Hakonarson. 2010. “ANNOVAR: Functional Annotation of Genetic Variants From High‐Throughput Sequencing Data.” Nucleic Acids Research 38, no. 16: e164.

Wang, P., and Z. Xu. 2021. “Pulmonary Fibrosis in Dyskeratosis Congenita: A Case Report With a PRISMA‐Compliant Systematic Review.” BMC Pulmonary Medicine 21, no. 1: 279.

Yildirim, H., P. Yildiz, and E. Coskunpinar. 2020. “Investigation of Telomere Related Gene Mutations in Idiopathic Pulmonary Fibrosis.” Molecular Biology Reports 47, no. 10: 7851–7860.

Zeng, T., G. Lv, X. Chen, et al. 2020. “CD8(+) T‐Cell Senescence and Skewed Lymphocyte Subsets in Young Dyskeratosis Congenita Patients With PARN and DKC1 Mutations.” Journal of Clinical Laboratory Analysis 34, no. 9: e23375.

Zhang, D., C. M. Eckhardt, C. McGroder, et al. 2024. “Clinical Impact of Telomere Length Testing for Interstitial Lung Disease.” Chest 166, no. 5: 1071–1081.

Zhang, D., Z. Zhou, M. Abu‐Hijleh, K. Batra, C. Xing, and C. K. Garcia. 2019. “Homozygous Rare PARN Missense Mutation in Familial Pulmonary Fibrosis.” American Journal of Respiratory and Critical Care Medicine 199, no. 6: 797–799.