1. Introduction
Polychlorinated biphenyls (PCBs) are substances considered persistent organic pollutants (POPs) due to their ability to bioaccumulate in the environment. Until the mid-1980s, intense production and use of these compounds occurred in dielectric fluids to reduce the risk of explosion in capacitors and transformers, plasticizers, and flame retardants in construction products and paints [1]. In addition to their dielectric properties, PCBs also possess extreme lipophilicity, meaning that when ingested, they can aggregate in fat-rich tissues, causing the compound to remain in the body for longer and making it difficult to metabolize and excrete [2]. While PCB production was banned in 1980, legislation has allowed transformers to continue using PCBs until the replacement of their dielectric fluid, which, according to the Stockholm Convention, should happen by 2025. Spills and the improper disposal of equipment containing these compounds, combined with the potential of these substances to aggregate in organisms, have led to their widespread bioaccumulation [3]. Ultimately, these characteristics have enabled their global distribution. There are approximately 209 PCB congeners, including 3,3′,4,4′,5-pentachlorobiphenyl (PCB 126), which demonstrate high toxicity by acting as agonists of the aryl hydrocarbon receptor (AhR) [4]. This receptor is directly related to the maintenance of the homeostasis of the cardiovascular, hepatic, reproductive, and immune systems [5]. However, dysregulation of its activation results in reactive oxygen species (ROS) production, causing damage to cellular components and disrupting the body’s homeostasis [6].
PCBs cause several pathological changes, including cancer, endocrine and cardiovascular changes, immunotoxicity, and neurotoxicity [7,8,9]. Studies have shown that the brain is one of the organs that is susceptible to pathological changes caused by PCBs, such as increased ROS concentrations, oxidative stress, changes in neurotransmitter levels, neuroinflammation, and the consequent apoptosis of neurons and glial cells, resulting in neurodegeneration [10]. These alterations occur because nervous tissue is rich in lipids, which allows PCBs to aggregate in the organ [11]. The neurotoxic effects lead to neurodegeneration, damaging several neural pathways in the central nervous system (CNS), reducing the production and consequent quantity of endogenous neurotransmitters, and altering the functionality of several parts of the brain, leading to pathological changes that can culminate in the emergence of different motor, logical reasoning, learning, and memory difficulties [12].
Treating neurotoxicity is a significant challenge for pharmacology. Riluzole, for example, is a drug with potential use for treating neurodegeneration. However, its mechanism of action is related to blocking the release of glutamate to reduce excitotoxicity [13]. Therefore, it does not act directly on oxidative stress, which plays a key role in the effects of PCBs. Additionally, it causes adverse effects such as asthenia, nausea, and changes in liver function [14]. In light of this, the levels of human exposure to PCBs due to their persistence in the environment and bioaccumulation remain a growing concern, particularly considering the lack of effective treatments to mitigate their toxic effects, especially in terms of neurotoxicity and the associated systemic dysfunctions [15].
Many studies have demonstrated the essential role of medicinal plants that are rich in polyphenols in the treatment of psychiatric disease [16] due to their antioxidant, anti-inflammatory, and anti-apoptotic properties [17,18,19]. Alpinia zerumbet (Pers.) B.L.Burtt & R.M.Sm is a medicinal plant rich in polyphenols, popularly known as cologne due to its aroma. Although native to East Asia, Alpinia zerumbet has become naturalized in Brazil. It was introduced to the country in the 19th century and initially cultivated in the Rio de Janeiro Botanical Garden [20,21]. Since then, it has spread and adapted to several regions, including the northeast and southeast of Brazil [22]. This plant is commonly grown in gardens in the country for ornamental and medicinal use, such as for its antihypertensive, antiulcerogenic, and diuretic effects [23,24]. Moreover, previous findings have demonstrated that Alpinia zerumbet has more than 100 secondary metabolites that can be isolated from its leaves, flowers, rhizomes, seeds, pericarps, and fruits, such as kavalactones, chalcones, flavonoids, diterpenoids, sesquiterpenoids, monoterpenoids, meroterpenoids, steroids, diarylheptanoids, neolignans, glucoside esters, and phenolic compounds, among others [20,25,26,27,28,29,30].
Our group studied a hydroalcoholic extract of fresh leaves of Alpinia zerumbet (ALE), which contain high concentrations of epicatechins (33%), procyanidin B2, and pinocembrin [31]. Preclinical studies conducted by our group demonstrated that ALE presents vasodilatory, antihypertensive, and antioxidant effects in a model of spontaneous hypertension [32]. Data from the literature also showed that Alpinia zerumbet has anxiolytic [33,34], antidepressant [35], and antipsychotic effects [36], proving its potential to act in diseases that affect the CNS [37]. Given the antioxidant effect of Alpinia zerumbet found by our group and its properties on the CNS, as demonstrated by other researchers, we were interested in investigating its neuroprotective potential. Furthermore, the effects of this medicinal plant on the neurotoxicity, neurodegeneration, and behavioral changes induced by PCB 126 remained unexplored. Therefore, in the present study, we investigated the preventive effect of ALE with respect to the alterations induced by PCB 126.
2. Materials and Methods
2.1. Preparation of Alpinia Zerumbet Leaf Extract
Fresh leaves of Alpinia zerumbet were collected at the Catete Palace in Rio de Janeiro, RJ, Brazil (22°54′24.65″ S, 43°10′22.43″ W). Plants were authenticated, and a voucher specimen was deposited in the Herbarium Prof. Jorge Pedro Pereira Carauta of the Federal University of the State of Rio de Janeiro (UNIRIO), under the number HUNI5015.
ALE was obtained by weighing 50 g of fresh leaves and boiling them in 400 mL of distilled water for 10 min. After cooling, the decoction was extracted via the addition of 400 mL of ethanol. The resulting suspension was stored in amber bottles at 4 °C for 10 days, with 1 h daily stirring (Kline New Technique model NT 150). The obtained extract was filtered through Whatman #1 filter paper, and the ethanol was evaporated (Fisatom Scientific Equipment Ltd., São Paulo, Brazil) under low pressure at 65 °C, followed by further freeze drying (LIOTOP model 202, São Paulo, Brazil) at −40 °C under a 200 mmHg vacuum. The obtained extract was then maintained at 4–8 °C until use [31].
2.2. Chemical Composition Analyses
The ALE was analyzed via UHPLC/ESI-QTOF-MS, and the GNPS spectral libraries identified nine compounds: D-(+)-trehalose, (epi)catechin, procyanidin B2, querce-tin-3-O-glucuronide (Q3OG), kaempferol-3-O-glucoside-3″-rhamnoside (K3OG3R), kaempferol-3-O-glucuronide (K3OG), isorhamnetin-3-Oneohesperidoside (I3ON), alpinetin, and pinocembrin [31]. The extract used in this study was the same as that used to characterize chemical composition in the previously mentioned study (Supplementary Section S1, Figure S1 and Table S1).
2.3. Experimental Model
The Animal Experiments Ethics Committee of the Rio de Janeiro State University for the care and use of experimental animals approved all the protocols used in this study (CEUA/021/2021), minimizing the number of animals used and avoiding animal suffering, in accordance with Brazilian Law # 11.794/2008. All the experiments were carried out according to the U.K. Animals (Scientific Procedures) Act 1986 and associated guidelines. We used 40 male C57BL/6 mice (120 days old), obtained and maintained in the Bioterium of the Department of Pharmacology and Psychobiology/IBRAG/UERJ at an average temperature of 23 °C, with controlled humidity and a 12 h sleep–wake cycle, with light from 6:00 a.m. Each box contained three animals, divided into four experimental groups: Control, Control + ALE, PCB, and PCB + ALE. The experimental protocol lasted for four weeks. During this period, the animals were administered PCB 126 (2 mg/kg, Sigma-Aldrich, San Luis, MO, EUA) or vehicle via the intraperitoneal route once a week and ALE (50 mg/kg) in the drinking water daily. The vehicle used to dilute the PCB 126 was corn oil, and the ALE was changed every two days. The bottles containing the extract were carefully protected from light to prevent oxidation. As we intended to investigate the preventive neuroprotective effect of ALE, the extract administration started simultaneously with PCB 126 and lasted for four weeks. In the last week of the protocol, the animals carried out the elevated plus maze (EPM) and open field (OF) behavioral tests. Finally, we sacrificed the mice by decapitation, isolating the cerebral cortex and freezing it at −80 °C for analysis (Figure 1).
We used PCB 126 in our study because it binds to AhR receptor with high affinity, leading to CYP activation and subsequent oxidative stress and inflammation. Therefore, this chemical compound is considered a highly toxic congener [4,38]. The dose of PCB 126 used (2 mg/kg) and the intraperitoneal route of administration were chosen based on their proven neurotoxicity in previous studies with a similar dosage of PCB congeners in adult animals [19,39]. Regarding the ALE, we used 50 mg/kg in drinking water, as this concentration demonstrated beneficial biological effects in vivo and relevant antioxidant properties [32,40] that suggest its potential beneficial action on neurotoxicity induced by PCB 126.
2.4. Behavioral Tests
We performed the elevated plus maze first and the open field test on the following day. The animals remained in the room for thirty minutes for acclimation before the test was performed. The behavior room had indirect lighting. At the end of each test, the apparatus was sanitized with 50% ethanol and dried before the next one was performed.
2.4.1. Elevated Plus Maze Test
The elevated plus maze is a behavioral test used to investigate anxiety-like behavior in rodents, performed according to the method described by Fraga et al. [41]. The maze is formed by a cross-shaped structure that is elevated above the ground, with exposed open arms and closed arms surrounded by walls, creating a closed and protected environment. The intersection between the arms is called the central area. The test begins with the C57BL/6 mouse in the center of the apparatus, facing one of the open arms, with its movement through the apparatus being recorded for 5 min. We filmed the tests with a digital camera for later analysis, considering entry in the arms when all four of the animal’s paws crossed the line. We used the percentage of entries into the open arms to assess anxiety-like behavior and the total number of entries into the closed arms to investigate locomotor activity.
2.4.2. Open Field Test
The open field test investigated locomotor activity and anxiety-like behavior, performed according to the method described by de Bem et al. [16]. The apparatus used to perform the test consisted of a square box (90 × 90 × 40 cm) with high walls, in which the mice were always inserted in the same quadrant, on the periphery of the apparatus, and were allowed to explore it for 10 min. We filmed the tests with a digital camera for later analysis, considering entry into the quadrant when all four of the animal’s paws crossed the quadrant line. We used the first five minutes of filming to assess locomotor activity through the number of crossings and anxious-type behavior based on the percentage of time spent in the center and on the periphery of the apparatus.
2.5. Oxidative Damage Determination
Lipid membrane damage was determined by the formation of products of lipid peroxidation (malondialdehyde) in the left cerebral cortex homogenates using the thiobarbituric acid reactive substances (TBARS) method, as previously described [42]. The left cerebral cortex was homogenized in phosphate buffer, and 50 microliters of each sample was mixed with 100 microliters of 10% trichloroacetic acid and centrifuged at 2000 rpm for 10 min. Subsequently, we collected 100 microliters of the supernatant, to which we added 100 microliters of 0.67% thiobarbituric acid and then heated them in a boiling water bath for 30 min. The absorbance of the organic phase containing the pink chromogen was measured spectrophotometrically at 532 nm (Ultrospec 2100 pro spectrophotometer from Amersham Bioscience, Piscataway, NJ, USA). MDA equivalents were expressed in nanomoles per milligram protein.
2.6. Superoxide Dismutase (SOD) Activity
Antioxidant activity was determined in left cerebral cortex homogenates. The SOD activity was assayed by measuring the inhibition of adrenaline auto-oxidation according to the absorbance at 480 nm [43]. For the assay, left cerebral cortex sample homogenates were used in 10, 30, and 50 μL amounts. These samples were incubated in separate cuvettes containing 2 × 970 μL of glycine buffer, 40 μL of norepinephrine, and 20 μL of enzyme to remove the hydrogen peroxide generated by the reaction catalyzed by SOD. The adrenochrome concentration was determined by spectrophotometry at 480 nm, with measurements taken every 10 s for 180 s.
2.7. Quantitative Real-Time PCR
We evaluated the iNOS, IL6, and TNF gene expression levels in right cerebral cortex homogenates. Total RNA was isolated using the PureLink™RNA Mini Kit (Thermo Fisher, Waltham, MA, USA), according to the manufacturer’s instructions. The quantification and quality assessment of the material were performed using a NanoVue® spectrophotometer (GE Healthcare, London, U.K.). cDNA synthesis was performed using a High-Capacity Cdna Reverse Transcription Kit (Applied Biosystem, Waltham, MA, USA) and the purified mRNA, according to the manufacturer’s instructions. The samples were stored at −80 °C until further use. Quantitative real-time PCRs (qPCRs) were performed using a QuantStudio™ 3 Real-Time PCR System. The primers used were designed using the online PrimerQuest Tool (IDT-Integrated DNA Technologies, Coralville, IA, USA), obtained from the literature, or were already available (Table 1). Briefly, the qPCRs contained specific primers, 1× Quantifast SYBR Green PCR master mix (Life Technologies, Carlsbad, CA, USA), and 1 μL (10 ng) of template cDNA, in a final reaction volume of 10 μL. The relative expression difference, represented as the fold change, was calculated using the Livak method (2−ΔΔCt) [44].
2.8. Western Blotting
The expression levels of BAX, Bcl-2, D2 receptor, β-actin, and α-tubulin were evaluated in the right cerebral cortex from all the groups, which was homogenized in RIPA buffer (Sigma-Aldrich, San Luis, MO, EUA) containing Complete Protease Inhibitor Cocktail Tablets (Roche, Basel, Switzerland) using an Ultra-Turrax homogenizer (IKA Werke GmbH & Co. KG, Staufen, Germany). The total protein content was determined using the BCA protein assay kit (Pierce, Rockford, IL, USA). Samples (10 μg total protein) were electrophoresed in Tris-glycine sodium dodecyl sulfate polyacrylamide gels (10%, 12% or 15%). The proteins were transferred to polyvinylidene fluoride membranes (Hybond ECL; Amersham Pharmacia Biotech, London, U.K.). The blots were blocked with 5% bovine albumin (Sigma-Aldrich Co., St. Louis, MO, USA) in T-TBS (0.02 M Tris/0.15 M NaCl, pH 7.5, containing 0.1% Tween 20) at room temperature for 1 h and incubated with primary antibody (1:1000 concentration) overnight at 4 °C. After washing them with T-TBS, the blots were incubated with the secondary horseradish peroxidase HRP-conjugated antibody (catalog numbers: SC-2004 and SC-2005) at a 1:5000 concentration for 1 h. The antibodies were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). We also incubated all the membranes with the β-actin antibody (catalog number: SC-47778) in order to avoid possible inconsistency in protein loading and/or transfer. The blots were developed via enhanced chemiluminescence (ECL; Amersham Biosciences Inc., Piscataway, NJ, USA). The signals were visualized using a ChemiDoc Resolutions System and determined through a quantitative analysis of digital images of the gels using Adobe Photoshop version 13.0 (Adobe System Incorporated).
2.9. Ultra-High Performance Liquid Chromatography (UHPLC)
We evaluated the tyrosine, dopamine (DA), levodopa (L-DOPA), and 3,4-dihydroxyphenylacetic acid (DOPAC) levels via UHPLC (Acquity UHPLC I class coupled with Triple Quadrupole TDQ from Waters, Manchester, U.K.) in the right cerebral cortex homogenates, according to previously described methodology [45]. Furthermore, the DA turnover was estimated according to the DOPAC/DA ratio.
2.9.1. Tissue Preparation
We used the right cortex samples for UHPLC analysis. The tissue was placed in previously labeled Precellys® tubes, to which we added 500 μL of ascorbic acid solution (1 mM) and formic acid (2%). Subsequently, we added an isoprenaline standard (1 mM) into each tube. The samples were processed in the Precellys tissue homogenizer (Berlin Technologies—Precellys 24 DUAL) at a temperature of 12 °C. After homogenization, the samples were centrifuged (Eppendorf® 5427R) at 8000 rpm and 4 °C for 2 min to reduce the foam that formed. The homogenate was transferred to 1.5 mL microtubes and diluted in 500 μL of LC-MS water. The samples were centrifuged at 1400 rpm at 4 °C for 30 min. For protein precipitation, we transferred 200 μL of the supernatant to new 1.5 mL microtubes containing 800 μL of acetonitrile, and the samples were centrifuged again at 1400 rpm, at 4 °C for 30 min. In the next step, 500 μL of the supernatant was transferred to vials and mixed with 500 μL of diluent. The final sample dilution was 10×.
2.9.2. Neurotransmitter Quantification
We evaluated the tyrosine, dopamine (DA), levodopa (L-DOPA), and 3,4-dihydroxyphenylacetic acid (DOPAC) levels by UHPLC with electrospray ionization, operated in a positive mode in the right cerebral cortex homogenates. The MassLynx software, version 4.1 (Waters Corp., Manchester, U.K.), was used for data collection associated with the TargetLyx program (Waters Corp., Manchester, U.K.). Additionally, the DA turnover was estimated according to the DOPAC/DA ratio.
2.10. Statistical Analysis
The data are presented as the mean and standard error of the mean. We used the Shapiro–Wilk test, which demonstrated that all the data analyzed were normally distributed. The differences among groups were analyzed via one-way analysis of variance (ANOVA), followed by the post hoc Fisher’s least significant difference (FLSD) test, using GraphPad Prism version 6.0 (GraphPad Software, San Diego, CA, USA). p-values (p < 0.05) were considered to determine statistical significance.
3. Results
3.1. ALE Treatment Prevents PCB 126-Induced Locomotor Deficits Without Affecting Anxiety in Mice
In the EPM test, the PCB group demonstrated a reduction (p < 0.0006) in locomotor activity compared to the Control + ALE group, according to the number of entries into the closed arms. ALE treatment prevented (p < 0.0285) this reduction in the PCB + ALE group when compared to the PCB group (Figure 2A). Furthermore, the Control + ALE group also showed an increase (p < 0.0452) in locomotor activity compared to the Control group (Figure 2A). In turn, in the open field test, there was a reduction (p < 0.0160) in the number of crossings in the PCB group compared to the control, confirming PCB’s negative effect on locomotion (Figure 2B). The ALE treatment groups presented locomotor activity similar to the control group (Figure 2B).
Finally, there was no statistically significant difference between the groups in terms of the percentage of entries into the open arms in the EPM test (Table 2). Furthermore, we did not observe a statistically significant difference between the groups in terms of the percentage of time that the animals spent in the center and on the periphery of the open field (Table 2), confirming that PCB 126 did not induce anxiety-like behavior.
3.2. ALE Treatment Attenuates Oxidative Stress Without Affecting Neuroinflammation in PCB 126-Exposed Mice
The results obtained from the left cerebral cortex homogenates demonstrated an increase in lipid peroxidation in the PCB group compared to the control (p < 0.0132) and Control + ALE (p < 0.0109) groups (Figure 3A). ALE treatment prevented (p < 0.0053) this damage in the PCB + ALE group when compared to the PCB group (Figure 3A).
We also evaluated the SOD antioxidant activity and observed no statistically significant difference between the control and PCB groups (Figure 3B). However, ALE treatment increased (p < 0.0124) the activity of this enzyme in the PCB + ALE group compared to the PCB group (Figure 3B).
Regarding neuroinflammation, we found no significant differences in the gene expression of pro-inflammatory markers such as iNOS, IL6, and TNF among the experimental groups (Figure 4). Despite its beneficial effects on oxidative stress, ALE may not influence the gene expression of these markers, or immune activation may follow a specific time course, requiring a kinetic analysis to detect potential changes in expression over time.
3.3. ALE Treatment Modulates Apoptotic Pathway Changes in PCB 126-Exposed Mice
In the right cerebral cortex homogenates, we evaluated the expression of BAX, a pro-apoptotic marker, and observed an increase (p < 0.0020) in the PCB group compared to the Control + ALE group (Figure 5A). Meanwhile, ALE treatment prevented the increase (p < 0.0206) in expression of this protein in the PCB + ALE group when compared to the PCB group (Figure 5A).
We also evaluated the content of Bcl-2, an anti-apoptotic protein, because an imbalance between BAX and Bcl-2 expression indicates apoptotic processes. However, there were no statistically significant differences in the expression of this protein between the groups studied (Figure 5B).
3.4. ALE Treatment Modulates Dopaminergic Pathways in PCB 126-Exposed Mice
In our study, there was an increase in tyrosine levels in the PCB (p < 0.0436) and PCB + ALE (p < 0.0284) groups compared to the Control group in the right cerebral cortex homogenates (Figure 6A). However, there were no differences in the dopamine and levodopa levels between groups (Figure 6B,C). Additionally, we observed decreased (p < 0.0156) DOPAC levels in the PCB group compared to the Control group (Figure 6D), while ALE treatment prevented (p < 0.0229) this reduction (Figure 6D). Furthermore, the Control + ALE group also showed a decrease (p < 0.0343) in DOPAC levels compared to the control group (Figure 6D). In turn, we found a reduced dopamine turnover (p < 0.0030) in the PCB group when compared to the Control group (Figure 6E). Meanwhile, ALE treatment resulted in dopamine turnover similar to that in the Control groups (Figure 6E).
Finally, we also investigated dopaminergic D2 receptor expression, as the action of dopamine on these receptors inhibits the indirect pathway of movement control, causing motor stimulation. In our study, we observed a reduction (p < 0.0250) in the protein content of the D2 receptor in the PCB group when compared to the Control + ALE group (Figure 7). Meanwhile, ALE treatment led to expression of this receptor similar to that in the control group (Figure 7).
4. Discussion
PCBs are synthetic compounds that can bioaccumulate and that remain in use despite the ban on their production. This has led to their inappropriate use, storage, and disposal, leading to contamination of the entire global ecosystem, including the air, water, soil, plants, animals, humans, and food [46,47,48]. A study conducted in the United States in the 2000s found that approximately 80% of Americans have some level of PCBs in their blood [49]. Additionally, research conducted in Brazil revealed widespread contamination with these compounds, with traces found in marine mammals along the southern and south-eastern coasts [50], as well as in breast milk samples obtained in various regions of the country [51,52]. PCBs have also been detected in food products, including rice [53], beans, pork, and beef [54]. Thus, despite regulatory efforts, PCBs persist in the environment and human tissue [55,56,57,58,59] and are still routinely detected, inducing neurotoxicity and neurodegeneration, which no drugs are capable of adequately preventing or treating.
These compounds are present in both the food we consume and in the environment to which the population is continuously exposed, highlighting the importance of conducting studies that demonstrate the actions of PCBs on the CNS and the search for therapeutic tools to prevent or treat the harmful effects of PCBs. Previous studies have highlighted the neuroprotective potential of polyphenols in combating PCB-induced neurotoxicity [17]. Our research group conducted a study to analyze the polyphenolic contents of ALE, revealing a significant presence of polyphenols such as phenolic acids and tannins, with a particular emphasis on compounds such as epicatechins (33%), procyanidin B2, and pinocembrin, which were found in higher concentrations [31]. These results improve our understanding of the chemical composition of ALE, highlighting its potential as a promising source of polyphenols. In the present study, our data demonstrated for the first time that treatment with ALE prevented PCB-induced locomotor reduction and oxidative damage and increased the expression of BAX, which is involved in the stimulation of apoptosis and neurodegeneration. Furthermore, ALE also maintained DA turnover and exhibited dopaminergic D2 receptor expression similar to that found in the cerebral cortex of control animals. These data suggest a neuroprotective potential of the extract against the neurotoxic and neurodegenerative effects induced by PCB 126.
Previous studies have documented that PCBs reduce dopaminergic signaling in the nigrostriatal pathway, thus affecting locomotor activity, considering the significant implications that these pollutants may have for tyrosine hydroxylase activity and dopamine synthesis [60,61]. In our investigation, we observed locomotor activity reduction in animals exposed to PCB 126 in the EPM test, which was corroborated by the decrease in the number of crossings between the different quadrants of the OF by animals exposed to this compound. Therefore, our data agree with the existing literature in documenting the role of PCB in reducing locomotion. Notably, we observed that treatment with ALE prevented the occurrence of locomotor alterations in animals exposed to PCB 126. These behavioral tests also demonstrated that PCB 126 did not induce an anxiolytic-like effect. However, previous studies have identified the development of anxious behavior in animals exposed to Aroclor, a mixture of PCBs [19]. The divergence of our data from the literature may be due to differences between the protocols, such as the compound used and the administration time.
Neurotoxicity induced by PCBs may play a key role in the locomotor alterations observed in the study. Data from the literature have shown that these compounds cause oxidative damage and decreased antioxidant activity in different regions of the CNS, promoting damage to cellular components, such as the peroxidation of membrane lipids, the oxidation of proteins, and DNA damage [19,62]. In our study, PCB 126 promoted lipid peroxidation in the left cerebral cortex, demonstrating the neurotoxic actions of the compound. ALE treatment prevented the occurrence of such oxidative damage and increased SOD activity, highlighting its neuroprotective potential. Previous studies have identified mechanisms involved in the neurotoxic effect of PCBs, showing that coplanar PCBs such as PCB 126 induce oxidative stress mainly through a mechanism mediated by CYP1A1 uncoupling, producing large amounts of ROS such as superoxide anion and hydrogen peroxide [63]. Furthermore, PCB 126 may also affect other cellular pathways that contribute to oxidative stress, such as through the activation of the AhR receptor, which may lead to ROS production and neuroinflammation [64]. We hypothesize that the uncoupling of CYP1A1 and activation of the AhR receptor participates in PCB 126’s induction of ROS production and oxidative damage, causing the neurotoxicity observed in the present study.
The neuroprotective effect of ALE, as described above, may be due to the actions of the bioactive compounds that compose it. A previous study by our group analyzed the chemical composition of ALE and demonstrated that the extract is predominantly composed of trehalose, epicatechins, procyanidin B2, quercetin-3-O-glucuronide, kaempferol-3-O-glucoside, kaempferol-3-glucoside-3”-rhamnoside, pinocembrin, and alpinetin [31]. The polyphenols present in the extract can act by donating electrons that neutralize reactive species, thus reducing cellular damage [65], as observed in this study. Furthermore, other research groups have highlighted the antioxidant effects of Alpinia zerumbet in vitro and in an experimental model of schizophrenia [36,37,66,67]. Finally, data from the literature also demonstrated that quercetin, a polyphenol present in ALE, decreased oxidative stress and hippocampal damage in rats exposed to a mixture of PCBs [19].
Neuroinflammation is also involved in PCB-induced neurotoxicity. Activated microglia and astrocytes induce neurotoxic effects by releasing pro-inflammatory factors such as IL-6 and TNF-α. Moreover, inflammation promotes iNOS hyperactivation, increasing nitric oxide production and peroxynitrite formation and further contributing to oxidative stress and tissue damage [68]. Given this, our study focused on investigating the expression of the iNOS, IL6, and TNF genes in the right cerebral cortex. However, we did not observe any statistically significant differences in the expression of these pro-inflammatory factors between the experimental groups. The literature has reported that neuroinflammation only occurs with exposure to PCBs during the developmental period [69,70]. However, a recent study has shown that PCB 126 can increase plasma TNF-α and IL-6 levels [71]. Additionally, another study found elevated pro-inflammatory cytokines in the colons of mice exposed to this chemical compound. These findings suggest that the influence of intestinal inflammation and microbiota changes induced by PCB 126 could be significant factors in neuroinflammation [72]. Therefore, we hypothesize that neuroinflammation is time-dependent and may be developing in our experimental model.
As PCB 126 induced oxidative stress and neurotoxicity development, we evaluated the expression of proteins involved in apoptosis. We found increased BAX expression in the right cerebral cortex homogenates from the PCB group. In contrast, the ALE extract prevented this protein expression elevation. Regarding Bcl-2 expression, there were no statistically significant differences in the content of this protein between the groups studied. Our data follow previous findings showing that exposure to PCBs increases the Bax/Bcl2 ratio in the hippocampus of rats [73]. The polyphenols present in the extract may be involved in preventing the activation of this pathway, which culminates in apoptosis and neurodegeneration. A previous investigation that used quercetin, a polyphenol present in ALE, proved the beneficial role of this bioactive compound in restoring the balance between the expression of Bax and Bcl-2 in the context of neurotoxicity induced by PCBs in the hippocampus of rats [73]. Therefore, we suggest that this effect of ALE may involve decreasing apoptosis and neurodegeneration, contributing to the prevention of locomotor activity reduction in the considered experimental model.
Due to the essential role of DA in locomotor activity, we investigated the effects of PCB 126 on the levels of this neurotransmitter as well as its precursors, metabolites, and receptors in right cerebral cortex homogenates. Our study showed an increase in tyrosine in the PCB and PCB + ALE groups, while there were no statistically significant differences in the levodopa and dopamine levels between the groups studied. However, we observed reductions in DOPAC levels and DA turnover (an index that indicates changes in dopamine utilization) in the PCB group. Remarkably, ALE prevented the DOPAC decrease and caused DA turnover to return to control levels. A previous study showed that PCBs can reduce tyrosine hydroxylase activity, minimizing dopamine synthesis and increasing tyrosine levels [60]. Moreover, other data have shown that 3-O-methyldopa administration did not alter DA levels but significantly decreased DOPAC, DA turnover, and locomotor activity [74], similar to our data. These findings can explain the increase in tyrosine found in the PCB groups in our study, with no change in dopamine synthesis but a reduction in this neurotransmitter’s bioavailability. We suggest that the polyphenols present in ALE reduce neurotoxicity and neurodegeneration and might counteract the actions of PCB 126, promoting the availability of DA. Additionally, another investigation demonstrated that quercetin, a chemical compound present in ALE, causes the inhibition of monoamine oxidase-B [75] and A [76]. This inhibition may contribute to ALE’s effect on DOPAC levels in animals in the Control + ALE group because the reduction in dopamine metabolism results in lower DOPAC levels, as found in the present study.
The dorsolateral region of the prefrontal cortex actively participates in the control of voluntary movements and acts in the movement’s control [77]. Previous findings have highlighted the importance of the right hemisphere because they demonstrated increased activity in this region in older adults during walking [78]. In line with these data, another study demonstrated increased blood flow in the right cerebral hemisphere compared to the left hemisphere during faster walking [79]. Therefore, given the importance of this cerebral hemisphere in the movement’s control, we used samples from the right cerebral cortex (which also contained the prefrontal cortex region) to evaluate the expression of dopaminergic D2 receptors and identified that PCB 126 administration reduced this receptor’s expression, similar to a previous study [80]. Adequate levels of DA neurotransmitter are essential for locomotor activity because it acts to regulate such activity through direct and indirect movement control pathways. The action of DA on dopaminergic D2 receptors causes inhibits the inhibitory pathway, promoting the stimulation of movements [81]. Notably, ALE causes the D2 receptor content to return to control expression levels. The polyphenols in the extract may participate in this effect, as a study using quercetin (one of the ALE compounds) reported normalized D2 receptor expression in animals exposed to PCB [80]. Regarding the mechanisms of quercetin, this bioactive compound of ALE increases the phosphorylation of the proteins protein kinase A (PKA) and dopamine- and cAMP-regulated neuronal phosphoprotein (DARP-32) and reduces the phosphorylation of protein phosphatase 1α (PP1α). This highlights a key role of this polyphenol in modulating motor function because the phosphorylation of DARPP-32 at threonine- 34 by PKA activates the inhibitory function of DARPP-32 on PP1α [82]. Therefore, we propose that the preventive effect of our extract on locomotor changes induced by PCB 126 also involves action on dopaminergic D2 receptors, promoting the stimulation of movement.
Exposure to PCBs can have distinct neurobehavioral effects between the sexes. The literature reports that social interaction and grooming behavior are affected in males but not females exposed to PCBs during development [83], highlighting the importance of studies investigating the neurotoxic properties of these chemicals between the sexes not only during development but also in adult animals. Despite the promising findings in our research, the use of male mice is a limitation since there is a lack of female animal data. Another essential point of discussion is the striking differences between the intraperitoneal and oral administration routes. The intraperitoneal route used for the administration of PCB 126 in our study has the advantage of enabling chronic administration of substances in mice since continuous administration via the intravenous route is a challenge. In addition, compounds administered via the intraperitoneal route avoid passing through the gastrointestinal tract, during which degradation or modification may occur [84], a key characteristic for administering PCBs that promotes their toxic effects when they exceed the body’s metabolization capacity. Thus, intraperitoneal administration of this chemical compound enables its arrival in the CNS and the development of its neurotoxic effects. In contrast, oral administration of ALE through drinking water, despite causing it to pass through the gastrointestinal tract and subjecting the extract to metabolism, also allows its consumption throughout the day, an essential characteristic for choosing oral administration since our group has not yet investigated the bioavailability and half-life of ALE.
Finally, a previous study reported the dose-dependent effect of PCB in inducing cell death in neuroblastoma SH-SY5Y cells [85]. As our work involves investigating the neuroprotective effect of Alpinia zerumbet, we chose a dose of PCB that could cause neurotoxicity, following previous studies [19,39]. However, a dose-dependent study of PCB 126 would be fascinating and a significant contribution to the literature. Therefore, further studies are needed to assess ALE’s potential for chronic use and better understand its pharmacokinetics characteristics and therapeutic prospects in managing PCB-induced dose-dependent neurotoxicity and sex differences.
5. Conclusions
In conclusion, we demonstrated for the first time that ALE prevented the locomotor changes induced by PCB 126 in adult mice. The mechanisms underlying this beneficial effect of ALE may involve the prevention of PCB-induced oxidative stress, increased BAX expression, and decreased DOPAC, DA turnover, and D2 receptor expression in the cerebral cortex. These mechanisms contribute to neuroprotection, apoptosis reduction, DA availability, and the stimulation of movement. Therefore, this preclinical study suggests that ALE could be used to prevent the neurotoxicity induced by PCB 126. However, further studies are needed to deepen our knowledge about the mechanisms involved in ALE’s neuroprotective properties against PCB-induced damage.
P.H.F.d.S., data curation, formal analysis, investigation, methodology, and writing—original draft; J.I.F., investigation, formal analysis, and methodology; M.P.d.M., investigation and methodology; F.L.F.-D., investigation, visualization, and writing—review and editing; A.L.N.F., investigation and methodology; R.E.C., investigation and methodology; U.C.d.A., investigation and methodology; D.T.O., investigation, visualization, and writing—review and editing; C.A.d.C., investigation, visualization, and writing—review and editing; C.C.F., investigation, visualization, methodology, and resources; A.C.M., methodology and resources; J.B.D., investigation, visualization, methodology, and resources; A.d.C.R., validation, visualization, resources, and writing—review and editing; G.F.d.B., conceptualization, validation, visualization, supervision, project administration, funding acquisition, and writing—review and editing. All authors have read and agreed to the published version of the manuscript.
All the experimental procedures were approved by the Institute of Biology/UERJ Ethical Committee for Animal Research (protocol#: CEUA/021/2021), minimizing the number of animals used and avoiding animal suffering, in accordance with Brazilian Law #11.794/2008. The animal study protocol was approved by the Institutional Ethics Committee of the Institute of Biology/UERJ (protocol#: CEUA/021/2021, 06/2021).
Not applicable.
The data used to support the findings of this study are available from the corresponding author upon request.
We would like to thank the undergraduate students, Carina da Silva Alves, Ana Caroline de Assis Fernandes da Silva, and Wallace Ferreira Falque, for their contributions during the experiments. Moreover, I would also like to thank Lenize Costa dos Reis Marins de Carvalho and Thamires Christinne de Souza Lopes Cruz Serrão for helping with the experiments and UHPLC analyses, respectively.
The authors declare no conflicts of interest.
The following abbreviations are used in this manuscript:
| AhR | Aryl Hydrocarbon Receptor |
| ALE | Hydroalcoholic Extract of Fresh Leaves of Alpinia zerumbet |
| CNS | Central Nervous System |
| DA | Dopamine |
| DOPAC | 3,4-Dihydroxyphenylacetic Acid |
| EPM | Elevated Plus Maze |
| L-DOPA | Levodopa |
| OF | Open Field |
| PCB 126 | 3,3′,4,4′,5-Pentachlorobiphenyl |
| PCBs | Polychlorinated Biphenyls |
| POPs | Persistent Organic Pollutants |
| ROS | Reactive Oxygen Species |
| SOD | Superoxide Dismutase |
| TBARS | Thiobarbituric Acid Reactive Substances |
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Figure 1 Schematic timeline of the experimental protocol. Figure abbreviations: PN, postnatal day; ALE, hydroalcoholic extract of fresh leaves of Alpinia zerumbet; IP, intra-peritoneally; PCB 126, 3,3′,4,4′,5-pentachlorobiphenyl; qPCR, quantitative real-time PCR; UHPLC, ultra-high-performance liquid chromatography.
Figure 2 Effects of treatment with ALE (50 mg/kg/day) on locomotor activity in EPM (A) and OF (B) tests in C57BL/6 adult male mice exposed to PCB 126. Data are means ± SEMs n = 10 for all groups. * Significantly different (p < 0.05) from the Control group. # Significantly different (p < 0.05) from the Control + ALE group. + Significantly different (p < 0.05) from the PCB group. Significant values between the pairs of groups were examined by one-way ANOVA in GraphPad Prism analysis of LSD variance statistically significant difference test.
Figure 3 Effects of treatment with ALE (50 mg/kg/day) on lipid peroxidation (A) and SOD antioxidant activity (B) in left cerebral cortex homogenates from C57BL/6 adult male mice exposed to PCB 126. Data are means ± SEMs (n = 6–7 per group). * Significantly different (p < 0.05) from the Control group. # Significantly different (p < 0.05) from the Control + ALE group. + Significantly different (p < 0.05) from the PCB group. Significant values between the pairs of groups were examined by one-way ANOVA in GraphPad Prism analysis of LSD variance statistically significant difference test.
Figure 4 Effects of treatment with ALE (50 mg/kg/day) on iNOS (A), TNF (B), and IL6 (C) gene expression in right cerebral cortex homogenates from C57BL/6 adult male mice exposed to PCB 126. Data are means ± SEMs (n = 5–6 per group). Significant values between the pairs of groups were examined by one-way ANOVA in GraphPad Prism analysis of LSD variance statistically significant difference test.
Figure 5 Effects of treatment with ALE (50 mg/kg/day) on BAX (A) and Bcl-2 (B) expression in the right cerebral cortex homogenates from C57BL/6 adult male mice exposed to PCB 126. Data are mean ± SEM (n = 5–6 per group). # Significantly different (p < 0.05) from the Control + ALE group. + Significantly different (p < 0.05) from the PCB group. Significant values between the pairs of groups were examined by one-way ANOVA in GraphPad Prism analysis of LSD variance statistically significant difference test.
Figure 6 Effects of treatment with ALE (50 mg/kg/day) on tyrosine (A), L-DOPA (B), DA (C), DOPAC (D), and DA turnover (E) levels in right cerebral cortex homogenates from C57BL/6 adult male mice exposed to PCB 126. Data are means ± SEMs (n = 5–6 per group). * Significantly different (p < 0.05) from the Control group. + Significantly different (p < 0.05) from the PCB group. Significant values between the pairs of groups were examined by one-way ANOVA in GraphPad Prism analysis of LSD variance statistically significant difference test.
Figure 7 Effects of treatment with ALE (50 mg/kg/day) on D2 receptor expression in right cerebral cortex homogenates from C57BL/6 adult male mice exposed to PCB 126. Data are means ± SEMs (n = 5–6 per group). # Significantly different (p < 0.05) from the Control + ALE group. Significant values between the pairs of groups were examined by one-way ANOVA in GraphPad Prism analysis of LSD variance statistically significant difference test.
Used primers, along with their respective sense and antisense sequences.
| Forward Primer (5′→3′) | Reverse Primer (3′→5′) | |
|---|---|---|
| β-actin | AGGCGACAGCAGTTGGTTGGA | TTGGGAGGGTGAGGGACTTCCT |
| iNOS | TGGCTTGCCCCTGGAAGTTT | GCTGAGAACAGCACAAGGGG |
| TNF | AGCCCCCAGTCTGTATCCTT | CTCCCTTTGCAGAACTCAGG |
| IL6 | CGGAGAGGAGACTTCACAGAGG | GCAAGTGCATCATCGTTGTTCA |
Effects of ALE (50 mg/kg/day) on anxiety-like behavior in C57BL/6 adult male mice exposed to PCB 126.
| Control | Control + ALE | PCB | PCB + ALE | |
|---|---|---|---|---|
| % Entry into open arms (EPM) | 35.9 ± 3.1 | 33.5 ± 2.7 | 24.4 ± 6.4 | 33.7 ± 5.1 |
| % Time in center (OF) | 8.0 ± 1.2 | 7.1 ± 0.9 | 5.5 ± 0.9 | 5.3 ± 0.08 |
| % Time in the periphery (OF) | 92.0 ± 1.2 | 92.9 ± 0.9 | 94.5 ± 0.9 | 94.7 ± 0.8 |
Data are means ± SEMs (n = 10) one-way ANOVA was performed. Abbreviations: EPM, elevated plus maze; OF, open field.
Supplementary Materials
The following supporting information can be downloaded at
1. Melymuk, L.; Blumenthal, J.; Sáňka, O.; Shu-Yin, A.; Singla, V.; Šebková, K.; Pullen Fedinick, K.; Diamond, M.L. Persistent Problem: Global Challenges to Managing PCBs. Environ. Sci. Technol.; 2022; 56, pp. 9029-9040. [DOI: https://dx.doi.org/10.1021/acs.est.2c01204] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35647669]
2. Coteur, G.; Danis, B.; Fowler, S.W.; Teyssié, J.-L.; Dubois, P.; Warnau, M. Effects of PCBs on Reactive Oxygen Species (ROS) Production by the Immune Cells of Paracentrotus Lividus (Echinodermata). Mar. Pollut. Bull.; 2001; 42, pp. 667-672. [DOI: https://dx.doi.org/10.1016/S0025-326X(01)00063-7] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11525284]
3. Penteado, J.C.P.; Vaz, J.M. O legado das bifenilas policloradas (PCBs). Quím. Nova; 2001; 24, pp. 390-398. [DOI: https://dx.doi.org/10.1590/S0100-40422001000300016]
4. Wu, X.; Yang, J.; Morisseau, C.; Robertson, L.W.; Hammock, B.; Lehmler, H.-J. 3,3′,4,4′,5-Pentachlorobiphenyl (PCB 126) Decreases Hepatic and Systemic Ratios of Epoxide to Diol Metabolites of Unsaturated Fatty Acids in Male Rats. Toxicol. Sci.; 2016; 152, pp. 309-322. [DOI: https://dx.doi.org/10.1093/toxsci/kfw084]
5. Shivanna, B.; Chu, C.; Moorthy, B. The Aryl Hydrocarbon Receptor (AHR): A Novel Therapeutic Target for Pulmonary Diseases?. Int. J. Mol. Sci.; 2022; 23, 1516. [DOI: https://dx.doi.org/10.3390/ijms23031516]
6. Schrenk, D.; Chopra, M. Dioxins and Polychlorinated Biphenyls in Foods. Chemical Contaminants and Residues in Food; Elsevier: Amsterdam, The Netherlands, 2017; pp. 69-89. ISBN 978-0-08-100674-0
7. Buha Djordjevic, A.; Antonijevic, E.; Curcic, M.; Milovanovic, V.; Antonijevic, B. Endocrine-Disrupting Mechanisms of Polychlorinated Biphenyls. Curr. Opin. Toxicol.; 2020; 19, pp. 42-49. [DOI: https://dx.doi.org/10.1016/j.cotox.2019.10.006]
8. Klocke, C.; Sethi, S.; Lein, P.J. The Developmental Neurotoxicity of Legacy vs. Contemporary Polychlorinated Biphenyls (PCBs): Similarities and Differences. Environ. Sci. Pollut. Res.; 2020; 27, pp. 8885-8896. [DOI: https://dx.doi.org/10.1007/s11356-019-06723-5] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31713823]
9. Perkins, J.T.; Petriello, M.C.; Newsome, B.J.; Hennig, B. Polychlorinated Biphenyls and Links to Cardiovascular Disease. Environ. Sci. Pollut. Res.; 2016; 23, pp. 2160-2172. [DOI: https://dx.doi.org/10.1007/s11356-015-4479-6]
10. Pessah, I.N.; Lein, P.J.; Seegal, R.F.; Sagiv, S.K. Neurotoxicity of Polychlorinated Biphenyls and Related Organohalogens. Acta Neuropathol.; 2019; 138, pp. 363-387. [DOI: https://dx.doi.org/10.1007/s00401-019-01978-1]
11. Seelbach, M.; Chen, L.; Powell, A.; Choi, Y.J.; Zhang, B.; Hennig, B.; Toborek, M. Polychlorinated Biphenyls Disrupt Blood–Brain Barrier Integrity and Promote Brain Metastasis Formation. Environ. Health Perspect.; 2010; 118, pp. 479-484. [DOI: https://dx.doi.org/10.1289/ehp.0901334]
12. Przedborski, S.; Vila, M.; Jackson-Lewis, V. Series Introduction: Neurodegeneration: What Is It and Where Are We?. J. Clin. Investig.; 2003; 111, pp. 3-10. [DOI: https://dx.doi.org/10.1172/JCI200317522] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/12511579]
13. Daverey, A.; Agrawal, S.K. Neuroprotective Effects of Riluzole and Curcumin in Human Astrocytes and Spinal Cord White Matter Hypoxia. Neurosci. Lett.; 2020; 738, 135351. [DOI: https://dx.doi.org/10.1016/j.neulet.2020.135351] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32891672]
14. Miller, R.G.; Mitchell, J.D.; Moore, D.H. Riluzole for Amyotrophic Lateral Sclerosis (ALS)/Motor Neuron Disease (MND). Cochrane Database Syst. Rev.; 2012; 2012, CD001447. [DOI: https://dx.doi.org/10.1002/14651858.CD001447.pub3] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22419278]
15. Gupta, P.; Thompson, B.L.; Wahlang, B.; Jordan, C.T.; Zach Hilt, J.; Hennig, B.; Dziubla, T. The Environmental Pollutant, Polychlorinated Biphenyls, and Cardiovascular Disease: A Potential Target for Antioxidant Nanotherapeutics. Drug Deliv. Transl. Res.; 2018; 8, pp. 740-759. [DOI: https://dx.doi.org/10.1007/s13346-017-0429-9]
16. de Bem, G.F.; Okinga, A.; Ognibene, D.T.; da Costa, C.A.; Santos, I.B.; Soares, R.A.; Silva, D.L.B.; da Rocha, A.P.M.; Isnardo Fernandes, J.; Fraga, M.C.
17. Newsome, B.J.; Petriello, M.C.; Han, S.G.; Murphy, M.O.; Eske, K.E.; Sunkara, M.; Morris, A.J.; Hennig, B. Green Tea Diet Decreases PCB 126-Induced Oxidative Stress in Mice by up-Regulating Antioxidant Enzymes. J. Nutr. Biochem.; 2014; 25, pp. 126-135. [DOI: https://dx.doi.org/10.1016/j.jnutbio.2013.10.003]
18. Oppedisano, F.; Maiuolo, J.; Gliozzi, M.; Musolino, V.; Carresi, C.; Nucera, S.; Scicchitano, M.; Scarano, F.; Bosco, F.; Macrì, R.
19. Selvakumar, K.; Bavithra, S.; Ganesh, L.; Krishnamoorthy, G.; Venkataraman, P.; Arunakaran, J. Polychlorinated Biphenyls Induced Oxidative Stress Mediated Neurodegeneration in Hippocampus and Behavioral Changes of Adult Rats: Anxiolytic-like Effects of Quercetin. Toxicol. Lett.; 2013; 222, pp. 45-54. [DOI: https://dx.doi.org/10.1016/j.toxlet.2013.06.237]
20. Nishidono, Y.; Tanaka, K. Phytochemicals of Alpinia Zerumbet: A Review. Molecules; 2024; 29, 2845. [DOI: https://dx.doi.org/10.3390/molecules29122845]
21. Batista, T.S.C.; Barros, G.S.; Damasceno, F.C.; Cândido, E.A.F.; Batista, M.V.A. Chemical Characterization and Effects of Volatile Oil of Alpinia zerumbet on the Quality of Collagen Deposition and Caveolin-1 Expression in a Muscular Fibrosis Murine Model. Braz. J. Biol.; 2024; 84, e253616. [DOI: https://dx.doi.org/10.1590/1519-6984.253616]
22. Faculty of Applied Sciences, UCSI University Chan, E.W.C.; Wong, S.K.; Chan, H.T. Alpinia Zerumbet, a Ginger Plant with a Multitude of Medicinal Properties: An Update on Its Research Findings. J. Chin. Pharm. Sci.; 2017; 26, 775. [DOI: https://dx.doi.org/10.5246/jcps.2017.11.088]
23. Lahlou, S.; Interaminense, L.F.L.; Leal-Cardoso, J.H.; Duarte, G.P. Antihypertensive Effects of the Essential Oil of Alpinia zerumbet and Its Main Constituent, Terpinen-4-ol, in DOCA-salt Hypertensive Conscious Rats. Fundam. Clin. Pharmacol.; 2003; 17, pp. 323-330. [DOI: https://dx.doi.org/10.1046/j.1472-8206.2003.00150.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/12803571]
24. Santos, B.A.; Roman-Campos, D.; Carvalho, M.S.; Miranda, F.M.F.; Carneiro, D.C.; Cavalcante, P.H.; Cândido, E.A.F.; Filho, L.X.; Cruz, J.S.; Gondim, A.N.S. Cardiodepressive Effect Elicited by the Essential Oil of Alpinia Speciosa Is Related to L-Type Ca2+ Current Blockade. Phytomedicine; 2011; 18, pp. 539-543. [DOI: https://dx.doi.org/10.1016/j.phymed.2010.10.015]
25. Ohtsuki, T.; Kikuchi, H.; Koyano, T.; Kowithayakorn, T.; Sakai, T.; Ishibashi, M. Death Receptor 5 Promoter-Enhancing Compounds Isolated from Catimbium Speciosum and Their Enhancement Effect on TRAIL-Induced Apoptosis. Bioorganic Med. Chem.; 2009; 17, pp. 6748-6754. [DOI: https://dx.doi.org/10.1016/j.bmc.2009.07.041]
26. You, H.; He, M.; Pan, D.; Fang, G.; Chen, Y.; Zhang, X.; Shen, X.; Zhang, N. Kavalactones Isolated from Alpinia zerumbet (Pers.) Burtt. et Smith with Protective Effects against Human Umbilical Vein Endothelial Cell Damage Induced by High Glucose. Nat. Prod. Res.; 2022; 36, pp. 5740-5746. [DOI: https://dx.doi.org/10.1080/14786419.2021.2023866]
27. Xiong, T.; Zeng, J.; Chen, L.; Wang, L.; Gao, J.; Huang, L.; Xu, J.; Wang, Y.; He, X. Anti-Inflammatory Terpenoids from the Rhizomes of Shell Ginger. J. Agric. Food Chem.; 2024; 72, pp. 424-436. [DOI: https://dx.doi.org/10.1021/acs.jafc.3c07967] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/38126326]
28. Xiao, T.; Wu, A.; Wang, X.; Guo, Z.; Huang, F.; Cheng, X.; Shen, X.; Tao, L. Anti-Hypertensive and Composition as Well as Pharmacokinetics and Tissues Distribution of Active Ingredients from Alpinia Zerumbet. Fitoterapia; 2024; 172, 105753. [DOI: https://dx.doi.org/10.1016/j.fitote.2023.105753]
29. Mpalantinos, M.A.; Soares De Moura, R.; Parente, J.P.; Kuster, R.M. Biologically Active Flavonoids and Kava Pyrones from the Aqueous Extract ofAlpinia Zerumbet. Phytother. Res.; 1998; 12, pp. 442-444. [DOI: https://dx.doi.org/10.1002/(SICI)1099-1573(199809)12:6<442::AID-PTR320>3.0.CO;2-Y]
30. Zhang, Y.; Yu, Y.-Y.; Peng, F.; Duan, W.-T.; Wu, C.-H.; Li, H.-T.; Zhang, X.-F.; Shi, Y.-S. Neolignans and Diarylheptanoids with Anti-Inflammatory Activity from the Rhizomes of Alpinia zerumbet. J. Agric. Food Chem.; 2021; 69, pp. 9229-9237. [DOI: https://dx.doi.org/10.1021/acs.jafc.1c02271]
31. Da Silva, M.A.; De Carvalho, L.C.R.M.; Victório, C.P.; Ognibene, D.T.; Resende, A.C.; De Souza, M.A.V. Chemical Composition and Vasodilator Activity of Different Alpinia zerumbet Leaf Extracts, a Potential Source of Bioactive Flavonoids. Med. Chem. Res.; 2021; 30, pp. 2103-2113. [DOI: https://dx.doi.org/10.1007/s00044-021-02791-w]
32. Menezes, M.P.; Santos, G.P.; Nunes, D.V.Q.; Silva, D.L.B.; Victório, C.P.; Fernandes-Santos, C.; de Bem, G.F.; Costa, C.A.; Resende, A.C.; Ognibene, D.T. Alpinia zerumbet Leaf Extract Reverses Hypertension and Improves Adverse Remodeling in the Left Ventricle and Aorta in Spontaneously Hypertensive Rats. Braz. J. Med. Biol. Res.; 2025; 58, e14210. [DOI: https://dx.doi.org/10.1590/1414-431x2024e14210] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/39907407]
33. Murakami, S.; Matsuura, M.; Satou, T.; Hayashi, S.; Koike, K. Effects of the Essential Oil from Leaves of Alpinia zerumbet on Behavioral Alterations in Mice. Nat. Prod. Commun.; 2009; 4, pp. 129-132. [DOI: https://dx.doi.org/10.1177/1934578X0900400128] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19370890]
34. Satou, T.; Murakami, S.; Matsuura, M.; Hayashi, S.; Koike, K. Anxiolytic Effect and Tissue Distribution of Inhaled Alpinia zerumbet Essential Oil in Mice. Nat. Prod. Commun.; 2010; 5, pp. 143-146. [DOI: https://dx.doi.org/10.1177/1934578X1000500133] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20184040]
35. Bevilaqua, F.; Mocelin, R.; Grimm, C.; Da Silva Junior, N.S.; Buzetto, T.L.B.; Conterato, G.M.M.; Roman, W.A.; Piato, A.L. Involvement of the Catecholaminergic System on the Antidepressant-like Effects of Alpinia zerumbet in Mice. Pharm. Biol.; 2016; 54, pp. 151-156. [DOI: https://dx.doi.org/10.3109/13880209.2015.1025287]
36. De Araújo, F.Y.R.; Chaves Filho, A.J.M.; Nunes, A.M.; De Oliveira, G.V.; Gomes, P.X.L.; Vasconcelos, G.S.; Carletti, J.; De Moraes, M.O.; De Moraes, M.E.; Vasconcelos, S.M.M.
37. Ferreira, F.D.S.; Silva, P.H.F.D.; Mattos, J.L.A.D.; Resende, A.D.C.; Ognibene, D.T.; Costa, C.A.D.; Montes, G.C.; Fontes-Dantas, F.L.; Bem, G.F.D. Alpinia zerumbet Anxiolytic and Antidepressant Effects: A Literature Review. Ann. Res. Rev. Biol.; 2024; 39, pp. 36-51. [DOI: https://dx.doi.org/10.9734/arrb/2024/v39i102138]
38. Leece, B.; Denomme, M.A.; Towner, R.; Li, S.M.A.; Safe, S. Polychlorinated Biphenyls: Correlation between in Vivo and in Vitro Quantitative Structure-activity Relationships (QSARs). J. Toxicol. Environ. Health; 1985; 16, pp. 379-388. [DOI: https://dx.doi.org/10.1080/15287398509530748]
39. Venkataraman, P.; Muthuvel, R.; Krishnamoorthy, G.; Arunkumar, A.; Sridhar, M.; Srinivasan, N.; Balasubramanian, K.; Aruldhas, M.M.; Arunakaran, J. PCB (Aroclor 1254) Enhances Oxidative Damage in Rat Brain Regions: Protective Role of Ascorbic Acid. NeuroToxicology; 2007; 28, pp. 490-498. [DOI: https://dx.doi.org/10.1016/j.neuro.2006.11.002] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17141323]
40. De Moura, R.S.; Emiliano, A.F.; De Carvalho, L.C.R.M.; Souza, M.A.V.; Guedes, D.C.; Tano, T.; Resende, A.C. Antihypertensive and Endothelium-Dependent Vasodilator Effects of Alpinia zerumbet, a Medicinal Plant. J. Cardiovasc. Pharmacol.; 2005; 46, pp. 288-294. [DOI: https://dx.doi.org/10.1097/01.fjc.0000175239.26326.47]
41. Fraga, M.C.; De Moura, E.G.; Da Silva Lima, N.; Lisboa, P.C.; De Oliveira, E.; Silva, J.O.; Claudio-Neto, S.; Filgueiras, C.C.; Abreu-Villaça, Y.; Manhães, A.C. Anxiety-like, Novelty-Seeking and Memory/Learning Behavioral Traits in Male Wistar Rats Submitted to Early Weaning. Physiol. Behav.; 2014; 124, pp. 100-106. [DOI: https://dx.doi.org/10.1016/j.physbeh.2013.11.001]
42. Draper, H.H.; Hadley, M. [43] Malondialdehyde determination as index of lipid Peroxidation. Methods in Enzymology; Elsevier: Amsterdam, The Netherlands, 1990; Volume 186, pp. 421-431. ISBN 978-0-12-182087-9
43. Bannister, J.V.; Calabrese, L. Assays for Superoxide Dismutase. Methods of Biochemical Analysis; Glick, D. Wiley: Hoboken, NJ, USA, 1987; Volume 32, pp. 279-312. ISBN 978-0-471-82195-3
44. Rezende, B.; Marques, K.L.; De Carvalho, F.E.A.; Gonçalves, V.M.D.S.; De Oliveira, B.C.C.A.; Nascimento, G.G.; Dos Santos, Y.B.; Antunes, F.; Barradas, P.C.; Fontes-Dantas, F.L.
45. Dutra-Tavares, A.C.; Ribeiro-Carvalho, A.; Nunes, F.; Araújo, U.C.; Bruno, V.; Marcourakis, T.; Filgueiras, C.C.; Manhães, A.C.; Abreu-Villaça, Y. Lifetime Caffeine and Adolescent Nicotine Exposure in Mice: Effects on Anxiety-like Behavior and Reward. J. Dev. Orig. Health Dis.; 2023; 14, pp. 362-370. [DOI: https://dx.doi.org/10.1017/S2040174423000077] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37009674]
46. Dreyer, A.; Minkos, A. Polychlorinated Biphenyls (PCB) and Polychlorinated Dibenzo-Para-Dioxins and Dibenzofurans (PCDD/F) in Ambient Air and Deposition in the German Background. Environ. Pollut.; 2023; 316, 120511. [DOI: https://dx.doi.org/10.1016/j.envpol.2022.120511]
47. Mohr, S.; Costabeber, I.H. Aspectos Toxicológicos e Ocorrência Dos Bifenilos Policlorados Em Alimentos. Cienc. Rural.; 2012; 42, pp. 559-566. [DOI: https://dx.doi.org/10.1590/S0103-84782012000300028]
48. Megson, D.; Brown, T.; Jones, G.R.; Robson, M.; Johnson, G.W.; Tiktak, G.P.; Sandau, C.D.; Reiner, E.J. Polychlorinated Biphenyl (PCB) Concentrations and Profiles in Marine Mammals from the North Atlantic Ocean. Chemosphere; 2022; 288, 132639. [DOI: https://dx.doi.org/10.1016/j.chemosphere.2021.132639]
49. Steenland, K.; Hein, M.J.; Cassinelli, R.T.; Prince, M.M.; Nilsen, N.B.; Whelan, E.A.; Waters, M.A.; Ruder, A.M.; Schnorr, T.M. Polychlorinated Biphenyls and Neurodegenerative Disease Mortality in an Occupational Cohort. Epidemiology; 2006; 17, pp. 8-13. [DOI: https://dx.doi.org/10.1097/01.ede.0000190707.51536.2b] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16357589]
50. Dorneles, P.R.; Sanz, P.; Eppe, G.; Azevedo, A.F.; Bertozzi, C.P.; Martínez, M.A.; Secchi, E.R.; Barbosa, L.A.; Cremer, M.; Alonso, M.B.
51. Kowalski, C.H.; Da Silva, G.A.; Godoy, H.T.; Poppi, R.J.; Augusto, F. Application of Kohonen Neural Network for Evaluation of the Contamination of Brazilian Breast Milk with Polychlorinated Biphenyls. Talanta; 2013; 116, pp. 315-321. [DOI: https://dx.doi.org/10.1016/j.talanta.2013.05.033]
52. Kowalski, C.H.; Costa, J.G.; Godoy, H.T.; Augusto, F. Determination of Polychlorinated Biphenyls in Brazilian Breast Milk Samples Using Solid-Phase Microextraction and Gas Chromatography-Electron Capture Detection. J. Braz. Chem. Soc.; 2010; 21, pp. 502-509. [DOI: https://dx.doi.org/10.1590/S0103-50532010000300016]
53. Cocco, R.; Schwanz, T.G.; Mohr, S.; Ceolin, J.; Braga, A.C.M.; Zanatta, N.; Costabeber, I.H. Bifenilos Policlorados Em Arroz e Feijão Do Estado Do Rio Grande Do Sul. Cienc. Rural; 2015; 45, pp. 1522-1527. [DOI: https://dx.doi.org/10.1590/0103-8478cr20130624]
54. Costabeber, I.; Sifuentes Dos Santos, J.; Odorissi Xavier, A.A.; Weber, J.; Leal Leães, F.; Bogusz, S.; Emanuelli, T. Levels of Polychlorinated Biphenyls (PCBs) in Meat and Meat Products from the State of Rio Grande Do Sul, Brazil. Food Chem. Toxicol.; 2006; 44, pp. 1-7. [DOI: https://dx.doi.org/10.1016/j.fct.2005.01.005] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16216403]
55. Lemaitre, M.; Frenoy, P.; Fiolet, T.; Besson, C.; Mancini, F.R. Dietary Exposure to Polychlorinated Biphenyls (PCB) and Risk of Non-Hodgkin’s Lymphoma: Evidence from the French E3N Prospective Cohort. Environ. Res.; 2021; 197, 111005. [DOI: https://dx.doi.org/10.1016/j.envres.2021.111005] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33722527]
56. Bandow, N.; Conrad, A.; Kolossa-Gehring, M.; Murawski, A.; Sawal, G. Polychlorinated Biphenyls (PCB) and Organochlorine Pesticides (OCP) in Blood Plasma—Results of the German Environmental Survey for Children and Adolescents 2014–2017 (GerES V). Int. J. Hyg. Environ. Health; 2020; 224, 113426. [DOI: https://dx.doi.org/10.1016/j.ijheh.2019.113426] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31978724]
57. Lan, T.; Liu, B.; Bao, W.; Thorne, P.S. Identification of PCB Congeners and Their Thresholds Associated with Diabetes Using Decision Tree Analysis. Sci. Rep.; 2023; 13, 18322. [DOI: https://dx.doi.org/10.1038/s41598-023-45301-1]
58. Frederiksen, M.; Andersen, H.V.; Haug, L.S.; Thomsen, C.; Broadwell, S.L.; Egsmose, E.L.; Kolarik, B.; Gunnarsen, L.; Knudsen, L.E. PCB in Serum and Hand Wipes from Exposed Residents Living in Contaminated High-Rise Apartment Buildings and a Reference Group. Int. J. Hyg. Environ. Health; 2020; 224, 113430. [DOI: https://dx.doi.org/10.1016/j.ijheh.2019.113430]
59. Ermler, S.; Kortenkamp, A. Systematic Review of Associations of Polychlorinated Biphenyl (PCB) Exposure with Declining Semen Quality in Support of the Derivation of Reference Doses for Mixture Risk Assessments. Environ. Health; 2022; 21, 94. [DOI: https://dx.doi.org/10.1186/s12940-022-00904-5]
60. Choksi, N. Effects of Polychlorinated Biphenyls (PCBs) on Brain Tyrosine Hydroxylase Activity and Dopamine Synthesis in Rats. Fundam. Appl. Toxicol.; 1997; 39, pp. 76-80. [DOI: https://dx.doi.org/10.1006/faat.1997.2351]
61. Seegal, R.F. The Neurochemical Effects of PCB Exposure Are Age-Dependent. Use of Mechanistic Information in Risk Assessment; Bolt, H.M.; Hellman, B.; Dencker, L. Springer: Berlin/Heidelberg, Germany, 1994; pp. 128-137. ISBN 978-3-642-78642-6
62. Ighodaro, O.M.; Akinloye, O.A. First Line Defence Antioxidants-Superoxide Dismutase (SOD), Catalase (CAT) and Glutathione Peroxidase (GPX): Their Fundamental Role in the Entire Antioxidant Defence Grid. Alex. J. Med.; 2018; 54, pp. 287-293. [DOI: https://dx.doi.org/10.1016/j.ajme.2017.09.001]
63. Petriello, M.C.; Newsome, B.; Hennig, B. Influence of Nutrition in PCB-Induced Vascular Inflammation. Environ. Sci. Pollut. Res.; 2014; 21, pp. 6410-6418. [DOI: https://dx.doi.org/10.1007/s11356-013-1549-5]
64. Lai, I.; Chai, Y.; Simmons, D.; Luthe, G.; Coleman, M.C.; Spitz, D.; Haschek, W.M.; Ludewig, G.; Robertson, L.W. Acute Toxicity of 3,3′,4,4′,5-Pentachlorobiphenyl (PCB 126) in Male Sprague–Dawley Rats: Effects on Hepatic Oxidative Stress, Glutathione and Metals Status. Environ. Int.; 2010; 36, pp. 918-923. [DOI: https://dx.doi.org/10.1016/j.envint.2009.11.002]
65. Arias-Sánchez, R.A.; Torner, L.; Fenton Navarro, B. Polyphenols and Neurodegenerative Diseases: Potential Effects and Mechanisms of Neuroprotection. Molecules; 2023; 28, 5415. [DOI: https://dx.doi.org/10.3390/molecules28145415] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37513286]
66. De Araújo, F.Y.R.; De Oliveira, G.V.; Gomes, P.X.L.; Soares, M.A.; Silva, M.I.G.; Carvalho, A.F.; De Moraes, M.O.; De Moraes, M.E.A.; Vasconcelos, S.M.M.; Viana, G.S.B.
67. Roman Junior, W.A.; Piato, A.L.; Marafiga Conterato, G.M.; Wildner, S.M.; Marcon, M.; Moreira, S.; Santo, G.D.; Mocelin, R.; Emanuelli, T.; Santos, C.A.D.M. Psychopharmacological and Antioxidant Effects of Hydroethanolic Extract of Alpinia zerumbet Leaves in Mice. Pharmacogn. J.; 2013; 5, pp. 113-118. [DOI: https://dx.doi.org/10.1016/j.phcgj.2013.05.003]
68. Zhang, D.; Hu, X.; Qian, L.; O’Callaghan, J.P.; Hong, J.-S. Astrogliosis in CNS Pathologies: Is There A Role for Microglia?. Mol. Neurobiol.; 2010; 41, pp. 232-241. [DOI: https://dx.doi.org/10.1007/s12035-010-8098-4] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20148316]
69. Peixoto-Rodrigues, M.C.; Monteiro-Neto, J.R.; Teglas, T.; Toborek, M.; Soares Quinete, N.; Hauser-Davis, R.A.; Adesse, D. Early-Life Exposure to PCBs and PFAS Exerts Negative Effects on the Developing Central Nervous System. J. Hazard. Mater.; 2025; 485, 136832. [DOI: https://dx.doi.org/10.1016/j.jhazmat.2024.136832]
70. Walker, K.A.; Rhodes, S.T.; Liberman, D.A.; Gore, A.C.; Bell, M.R. Microglial Responses to Inflammatory Challenge in Adult Rats Altered by Developmental Exposure to Polychlorinated Biphenyls in a Sex-Specific Manner. NeuroToxicology; 2024; 104, pp. 95-115. [DOI: https://dx.doi.org/10.1016/j.neuro.2024.07.009]
71. Quitete, F.T.; Teixeira, A.V.S.; Peixoto, T.C.; Martins, B.C.; Atella, G.C.; Resende, A.D.C.; Mucci, D.D.B.; Martins, F.; Daleprane, J.B. Long-Term Exposure to Polychlorinated Biphenyl 126 Induces Liver Fibrosis and Upregulates miR-155 and miR-34a in C57BL/6 Mice. PLoS ONE; 2024; 19, e0308334. [DOI: https://dx.doi.org/10.1371/journal.pone.0308334]
72. Li, T.; Tian, D.; Lu, M.; Wang, B.; Li, J.; Xu, B.; Chen, H.; Wu, S. Gut Microbiota Dysbiosis Induced by Polychlorinated Biphenyl 126 Contributes to Increased Brain Proinflammatory Cytokines: Landscapes from the Gut-Brain Axis and Fecal Microbiota Transplantation. Ecotoxicol. Environ. Saf.; 2022; 241, 113726. [DOI: https://dx.doi.org/10.1016/j.ecoenv.2022.113726]
73. Selvakumar, K.; Bavithra, S.; Suganya, S.; Ahmad Bhat, F.; Krishnamoorthy, G.; Arunakaran, J. Effect of Quercetin on Haematobiochemical and Histological Changes in the Liver of Polychlorined Biphenyls-Induced Adult Male Wistar Rats. J. Biomark.; 2013; 2013, 960125. [DOI: https://dx.doi.org/10.1155/2013/960125]
74. Onzawa, Y.; Kimura, Y.; Uzuhashi, K.; Shirasuna, M.; Hirosawa, T.; Taogoshi, T.; Kihira, K. Effects of 3-O-Methyldopa, L-3,4-Dihydroxyphenylalanine Metabolite, on Locomotor Activity and Dopamine Turnover in Rats. Biol. Pharm. Bull.; 2012; 35, pp. 1244-1248. [DOI: https://dx.doi.org/10.1248/bpb.b110714]
75. Lee, M.-H.; Lin, R.-D.; Shen, L.-Y.; Yang, L.-L.; Yen, K.-Y.; Hou, W.-C. Monoamine Oxidase B and Free Radical Scavenging Activities of Natural Flavonoids in Melastoma candidum D. Don. J. Agric. Food Chem.; 2001; 49, pp. 5551-5555. [DOI: https://dx.doi.org/10.1021/jf010622j] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11714358]
76. Van Diermen, D.; Marston, A.; Bravo, J.; Reist, M.; Carrupt, P.-A.; Hostettmann, K. Monoamine Oxidase Inhibition by Rhodiola rosea L. Roots. J. Ethnopharmacol.; 2009; 122, pp. 397-401. [DOI: https://dx.doi.org/10.1016/j.jep.2009.01.007] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19168123]
77. Yogev-Seligmann, G.; Hausdorff, J.M.; Giladi, N. The Role of Executive Function and Attention in Gait. Mov. Disord.; 2008; 23, pp. 329-342. [DOI: https://dx.doi.org/10.1002/mds.21720]
78. Hoang, I.; Paire-Ficout, L.; Derollepot, R.; Perrey, S.; Devos, H.; Ranchet, M. Increased Prefrontal Activity during Usual Walking in Aging. Int. J. Psychophysiol.; 2022; 174, pp. 9-16. [DOI: https://dx.doi.org/10.1016/j.ijpsycho.2022.01.011] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35093479]
79. Greenfield, J.; Delcroix, V.; Ettaki, W.; Derollepot, R.; Paire-Ficout, L.; Ranchet, M. Left and Right Cortical Activity Arising from Preferred Walking Speed in Older Adults. Sensors; 2023; 23, 3986. [DOI: https://dx.doi.org/10.3390/s23083986]
80. Bavithra, S.; Selvakumar, K.; Pratheepa Kumari, R.; Krishnamoorthy, G.; Venkataraman, P.; Arunakaran, J. Polychlorinated Biphenyl (PCBs)-Induced Oxidative Stress Plays a Critical Role on Cerebellar Dopaminergic Receptor Expression: Ameliorative Role of Quercetin. Neurotox. Res.; 2012; 21, pp. 149-159. [DOI: https://dx.doi.org/10.1007/s12640-011-9253-z]
81. Dreher, J.K.; Jackson, D.M. Role of D1 and D2 Dopamine Receptors in Mediating Locomotor Activity Elicited from the Nucleus Accumbens of Rats. Brain Res.; 1989; 487, pp. 267-277. [DOI: https://dx.doi.org/10.1016/0006-8993(89)90831-7]
82. Gupta, R.; Shukla, R.K.; Pandey, A.; Sharma, T.; Dhuriya, Y.K.; Srivastava, P.; Singh, M.P.; Siddiqi, M.I.; Pant, A.B.; Khanna, V.K. Involvement of PKA/DARPP-32/PP1α and β- Arrestin/Akt/GSK-3β Signaling in Cadmium-Induced DA-D2 Receptor-Mediated Motor Dysfunctions: Protective Role of Quercetin. Sci. Rep.; 2018; 8, 2528. [DOI: https://dx.doi.org/10.1038/s41598-018-20342-z] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29410441]
83. Sethi, S.; Keil Stietz, K.P.; Valenzuela, A.E.; Klocke, C.R.; Silverman, J.L.; Puschner, B.; Pessah, I.N.; Lein, P.J. Developmental Exposure to a Human-Relevant Polychlorinated Biphenyl Mixture Causes Behavioral Phenotypes That Vary by Sex and Genotype in Juvenile Mice Expressing Human Mutations That Modulate Neuronal Calcium. Front. Neurosci.; 2021; 15, 766826. [DOI: https://dx.doi.org/10.3389/fnins.2021.766826]
84. Al Shoyaib, A.; Archie, S.R.; Karamyan, V.T. Intraperitoneal Route of Drug Administration: Should It Be Used in Experimental Animal Studies?. Pharm. Res.; 2020; 37, 12. [DOI: https://dx.doi.org/10.1007/s11095-019-2745-x]
85. Formisano, L.; Guida, N.; Cocco, S.; Secondo, A.; Sirabella, R.; Ulianich, L.; Paturzo, F.; Di Renzo, G.; Canzoniero, L.M.T. The Repressor Element 1-Silencing Transcription Factor Is a Novel Molecular Target for the Neurotoxic Effect of the Polychlorinated Biphenyl Mixture Aroclor 1254 in Neuroblastoma SH-SY5Y Cells. J. Pharmacol. Exp. Ther.; 2011; 338, pp. 997-1003. [DOI: https://dx.doi.org/10.1124/jpet.111.181289] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21693630]
© 2025 by the authors. Published by MDPI on behalf of the Österreichische Pharmazeutische Gesellschaft. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Fernandes, Jemima Isnardo 2 ; de Menezes Matheus Pontes 1 ; Fontes-Dantas, Fabrícia Lima 1
; Freitas André Luiz Nunes 2 ; Correa, Rayane Efraim 2
; de Araujo Ulisses Cesar 2 ; Ognibene, Dayane Teixeira 1
; da Costa Cristiane Aguiar 1
; Filgueiras Cláudio Carneiro 2
; Manhães, Alex Christian 2
; Beltrame, Daleprane Júlio 3
; de Castro, Resende Angela 1 ; de Bem Graziele Freitas 1
1 Department of Pharmacology and Psychobiology, Roberto Alcantara Gomes Biology Institute (IBRAG), Rio de Janeiro State University (UERJ), Rio de Janeiro 20551-030, RJ, Brazil; [email protected] (P.H.F.d.S.); [email protected] (M.P.d.M.); [email protected] (F.L.F.-D.); [email protected] (D.T.O.); [email protected] (C.A.d.C.); [email protected] (A.d.C.R.)
2 Department of Physiology, Roberto Alcantara Gomes Biology Institute (IBRAG), Rio de Janeiro State University (UERJ), Rio de Janeiro 20551-030, RJ, Brazil; [email protected] (J.I.F.); [email protected] (A.L.N.F.); [email protected] (R.E.C.); [email protected] (U.C.d.A.); [email protected] (C.C.F.); [email protected] (A.C.M.)
3 Department of Basic Experimental Nutrition, Institute of Nutrition, Rio de Janeiro State University (UERJ), Rio de Janeiro 20551-030, RJ, Brazil; [email protected]