Development of a novel PIK3CA-mutated pancreatic tumor mouse model and evaluation of the therapeutic effects of a PI3K inhibitor

Abstract

Pancreatic ductal adenocarcinoma (PDAC) is a fatal malignancy. Personalized medicine based on genetic mutations is required to improve its prognosis. The PI3K/AKT pathway plays a crucial role in cancer progression. While PI3K inhibitors have been developed for several malignancies, none have been clinically applied to PDAC. PIK3CA encodes the catalytic subunit of Class IA PI3K, and an activating mutation such as E545K and H1047R is oncogenic. In this study, we developed a novel pancreatic cancer mouse model with PIK3CA^H1047R mutation, designated Ptf1a^cre/+; Rosa26-LSL-PIK3CA^H1047R:p53^loxP/loxP (PPC) mice. At 150 days of age, PPC mice developed PDAC and AKT was activated in their tumor epithelial cells. We established a pancreatic cancer cell line from PPC mice, and alpelisib, an inhibitor of PI3K p110α, inhibited the proliferation of PPC cells in vitro. Furthermore, PPC cells were subcutaneously transplanted into NOD/SCID mice, and alpelisib significantly reduced the tumor burden of PPC cells. Western blotting upon treatment with alpelisib revealed compensatory activation of ERK in PPC cells. Combination treatment with alpelisib and the MEK inhibitor PD98059 significantly inhibited cell proliferation. These data indicate that PIK3CA mutation may be oncogenic in PDAC and that PI3K inhibitors can be effective against such tumors. Dual inhibition of the PI3K/AKT and MEK/ERK pathways may enhance therapeutic effects in PI3K/AKT-activated pancreatic tumors.

Background

Pancreatic ductal adenocarcinoma (PDAC) is a highly fatal malignancy, although its 5-year survival rate has improved by approximately 13% [1]. Personalized medicine based on genetic mutations or other predictive biomarkers of treatment response is required to improve its prognosis [2–4].

Phosphatidylinositol-3 kinase (PI3K) is a lipid kinase activated by a variety of receptor tyrosine kinases (RTKs) or G-protein coupled receptors (GPCRs). The PI3K lipid kinase family in mammals includes four classes (IA, IB, II, and III) based on sequence homology. The class-I PI3K phosphorylates a cell membrane phospholipid named phosphoinositide-4,5-bisphosphate (PIP2) into phosphoinositide-3,4,5-trisphosphate (PIP3) [5]. Then PIP3 activates the serine/threonine protein kinase AKT, also known as protein kinase B (PKB). AKT plays a key role in multiple cellular processes including survival, proliferation, and inhibition of apoptosis [6]. The PI3K/AKT signaling pathway is activated in many cancer cells and is a major oncogenic signal with diverse functions [7].

The PIK3CA gene encodes p110α, the catalytic subunit of Class IA PI3K, and its mutations have been reported in various cancer types [8]. Several mutation hotspots have been recognized in PIK3CA, and gain-of-function mutations such as E545K and H1047R are critical to carcinogenesis [9].

Molecular therapeutics targeting the PI3K/AKT pathway have been established for a variety of cancer types. For example, alpelisib (BYL719) is a small molecule that inhibits p110α, and this inhibitor also inhibits PIK3CA E545K and H1047R mutation [10]. Alpelisib has been clinically applied to breast cancer with mutation in the PIK3CA gene that is hormone receptor positive and HER2 negative [11].

While PIK3CA mutations are relatively common in breast, endometrial, and colorectal cancers [12], only about 3% of cases of pancreatic cancer have PIK3CA mutations [13]. Thus, the indications of these PI3K/AKT inhibitors in pancreatic cancer are limited. However, for pancreatic cancer, which currently has few molecular therapy targets [14], the potential application of these PI3K/AKT inhibitors is needed to improve prognosis [15].

In the present study, we generated a novel PI3K/AKT pathway-enhanced pancreatic cancer mouse model and explored the potential clinical application of PI3K inhibitors to pancreatic cancer.

Materials and methods

Mice

NOD/SCID mice were purchased from CLEA Japan. Ptf1a^{tm1.1(cre)Cvw} (Ptf1a^Cre/+) mice was generous gift from Prof. Christopher V. Wright [16]. LSL-Kras^G12D/+(#008179) Ptf1a^ER–Cre/+(#019378), Trp53^tm1Brn/+ (p53^loxP/+) (#008462), and Rosa26-LSL-PIK3CA^H1047R/+ (PIK3CA^H1047R/+) mice (#016977) were purchased from Jackson Lab (Bar Harbor, USA) [17–20]. PIK3CA^H1047R/+ mice were purchased on the NVB/NJ background, and the mice were backcrossed in our laboratory to C57BL/6 mice for over 10 generations. Other strains were developed on the C57BL/6 genetic background. Mice were maintained at the Graduate School of Medicine of Yokohama City University in filter-topped cages and fed autoclaved food and water according to the guidelines of the National Institutes of Health and Animal Research: Reporting of In Vivo Experiments guidelines [21]. The mice were housed under a 12-hour light/12-hour dark cycle, with lights on at 7:00 AM and off at 7:00 PM. While considering the humane endpoint, it was ensured that the tumors did not reach a size of 10 mm in any dimension. Mice were observed once every 3 days for the humane endpoints mentioned above. The duration of the experiments was about 250 days after birth. A total of 20 mice was used and euthanized. None of the mice was found dead during the experiments. Animal health and behavior were monitored every 3 days. All considerations for welfare were taken to minimize suffering and distress due to the creation of tumors. All animals were humanely euthanized via gradual CO₂ exposure followed by cervical dislocation.

Reagents

Alpelisib (#HY-15244) was purchased from MedChemExpress (New Jersey, USA) and PD98059 (#S1177) was obtained from Selleck (Houston, USA). The following primary antibodies were used: anti-AKT (ABclonal, Massachusetts, USA, #A11016), anti-phospho-AKT (Ser473) (Cell Signaling Technology, Massachusetts, USA, #4060), anti-p44/42 MAPK (ERK1/2) (Cell Signaling Technology, #4695), anti-phospho-p44/42 MAPK (ERK1/2) (Cell Signaling Technology, #4370), anti-α-SMA (Cell Signaling Technology, #56856), anti-TROMA-III (CK19) (Developmental Studies Hybridoma Bank, Iowa, USA, #AB_2133570), anti-Ki67 (Cell Signaling Technology, #12202), anti-cleaved caspase-3 (Cell Signaling Technology, #9661), and anti-β-actin (Wako, Kyoto, Japan, # 66009–1-Ig).

Immunohistochemical examination

The pancreas and subcutaneous tumors were isolated from mice and fixed in 10% formalin neutral buffer solution (Wako, #068–01663). Tissues were embedded in paraffin, sectioned, mounted on slides, subjected to staining with hematoxylin (Muto Chemicals, #30141) and eosin (Muto Chemicals, #32081) (H&E) and processed for immunohistochemistry (IHC). After deparaffinization and rehydration, the slides were autoclaved for 10 min at 121°C for antigen retrieval and incubated with 0.3% H₂O₂ at room temperature to block endogenous peroxidase activity. Then the slides were incubated overnight at 4°C with the indicated primary antibodies. Immunoreactivity was visualized using 3,3-diaminobenzidine (DAB; Nichirei, Tokyo, Japan, #425011) and the peroxidase-based Histofine Simple Stain Kit (MAX PO R, Nichirei, #424142).

Immunoblotting

Cells were washed and lysed with sodium dodecyl sulfate sample buffer. Next, proteins were separated through 5–20% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (Atto, Tokyo, Japan, #2331380), and transferred to a polyvinylidene difluoride membrane (Merck, Darmstadt, Germany, #IPVH00010). Excess membrane was cut off prior to hybridization with the antibody. The membrane was incubated with the indicated primary antibodies at 4°C overnight. After incubation with a horseradish peroxidase-linked secondary antibody, immunoreactive bands were detected using the Amersham Image Quant 800UV Imaging System (Cytiva, Tokyo, Japan).

Cell culture

We established a mouse pancreatic cancer cell line from Ptf1a^Cre/+; LSL-PIK3CA^H1047R/+:p53^loxP/loxP mice (PPC mice) and Ptf1a^ER–Cre/+ Kras^G12D/+ p53 ^loxP/loxP mice (KPC mice). Isolated pancreatic tissue was minced and digested in dissociation medium consisting of Dulbecco’s modified Eagle medium (DMEM, Wako, #043–30085) supplemented with 1% fetal bovine serum (FBS, Biosera, Cholet, France, #515–99055) and 5 mg/mL collagenase II (Sigma, St. Louis, USA, #C2-22). Cells were cultured in DMEM containing penicillin–streptomycin (Wako, #168–23191) at standard concentration with FBS added at 10%.

Cell proliferation

Cell proliferation was measured through Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan, #343−07623) assays. In accordance with the standard protocol, 5000 cells were seeded into 96-well plates with four replicates. The cells were treated with alpelisib, PD98059, or both for 24–96 h. Then, 10 µL CCK-8 solution was added to each well and the plates were incubated for 45 min. Optical density at 450 nm was determined with a Synergy LX (BioTek, Winooski, USA) microplate reader. Synergistic effects were analyzed using Synergy Finder+ (https://synergyfinder.org).

Subcutaneous tumor allograft model

Pancreatic tumor cells (PPC and KPC cells) were implanted subcutaneously into four locations on the backs of 8-week-old NOD/SCID mice (2.0 × 10⁶ cells/location). Alpelisib (40 mg/kg) or vehicle was given via oral gavage for two weeks (5 out of 7 days) [22,23]. Tumor area (mm²) was calculated as: (major diameter) × (minor diameter); tumor diameters were measured using calipers.

Statistical analysis

Values are presented as mean ± standard error of the mean (SEM). The significance of differences was examined using Student’s t-test. P < 0.05 was considered indicative of statistical significance.

Ethical Statements

The animal experiments were approved by the Ethics Committee for Animal Experimentation of Yokohama City University and were conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals. All considerations for welfare were taken to minimize suffering and distress due to the creation of tumors.

Results

Generation of a PI3K/AKT pathway-activated pancreatic cancer mouse model

We generated Ptf1a^Cre/+:PIK3CA^H1047R/+ mice (PC mice) crossed with Ptf1a^Cre/+ and PIK3CA^H1047R/+ mice. We found that 87.5% (7/8) of PC mice formed cystic pancreatic tumors at about 250 days of age, while no tumor was formed at about 150 days of age (S1 Table). Representative H&E staining results for the tumors are shown in Fig 1A. Thus, we expected that the PIK3CA mutation is oncogenic for pancreatic cancer. Next, we explored whether combining the Tp53 mutation, a tumor suppressor gene, with PIK3CA mutation would lead to the development of invasive pancreatic tumors. We crossed Ptf1a^cre/+:p53^loxP/loxP mice with Rosa26-LSL-PIK3CA^H1047R:p53^loxP/loxP mice to generate Ptf1a^cre/+; Rosa26-LSL-PIK3CA^H1047R:p53^loxP/loxP mice (PPC mice) (Fig 1B). We dissected these PPC mice at 50, 100, and 150 days of age to explore their tumorigenesis. Tumorigenic changes became significant at around 100 days of age, and invasive pancreatic ductal carcinoma was observed at 150 days of age (S1 Table). Tumors in PPC mice included the cystic lesions observed in PC mice (Fig 1C). IHC analysis of pancreatic tumors collected at 150 days of age showed positive signals for phosphorylated AKT in tumor epithelial cells, suggesting that PI3K mutations activate the AKT pathway, resulting in pancreatic tumor formation. We compared these mice with Ptf1a^ER–Cre/+ Kras^G12D/+ p53 ^loxP/loxP mice (KPC mice), a popular mouse model of pancreatic cancer. AKT activation was not observed in pancreatic tumors in KPC mice [24](Fig 1D). PPC tumor epithelial cells were positive for CK19 (cytokeratin 19), phospho-extracellular signal regulated kinase (ERK), and Ki67, similar to those of PKC mice. Abundant αSMA-positive fibroblasts were observed in tumor stroma (Fig 1E). These staining results resembled the tumors of KPC mice, suggesting that PPC mice may be a pancreatic cancer mouse model with a new pathogenetic mechanism independent of Kras mutation.

[Figure omitted. See PDF.]

(A) H&E staining of the pancreatic tumor from a Ptf1a^Cre/+:PIK3CA^H1047R/+ mouse (PC) sacrificed at 250 days of age (scale bar, 500 μm). (B) Diagram of mouse mating to generate PPC (Ptf1a^cre/+; Rosa26-LSL-PIK3CA^H1047R:p53^loxP/loxP) mice. (C) H&E staining of the pancreatic tumors from PPC mice at 50, 100, and 150 days of age (scale bar, 500 μm). (D) IHC analysis of phospho-AKT (p-AKT) in PPC and KPC (Ptf1a^ER–Cre/+ Kras^G12D/+ p53 ^loxP/loxP) mice. KPC mice were fed tamoxifen at 6 weeks of age and dissected at 18 weeks of age. (E) IHC analysis of CK19, phospho-ERK (p-ERK), Ki67, and α-SMA in PPC mouse tumors.

Effect of alpelisib on PPC and KPC cells in vitro

Alpelisib is an orally available PI3K inhibitor with specific activity against PI3K alpha (PI3Kα) currently being developed. This inhibitor is approved by the United States Food and Drug Administration to treat certain breast cancers [25] but is not approved for pancreatic cancer. To explore the effect of the PI3K inhibitor alpelisib on pancreatic tumors in PPC mice, we established a pancreatic cancer cell line from a PPC mouse tumor. For comparison, we established the Kras-mutated pancreatic cancer cell line (KPC cells) from KPC mice. Recombination of the PIK3CA gene in PPC cells was confirmed by Polymerase Chain Reaction (S1 Fig). PPC or KPC cells were treated with the PI3K inhibitor alpelisib in vitro, and activation of AKT and ERK was analyzed through Western blotting. As humoral factors in the FBS in the cell culture medium may affect the activation of AKT, we used two types of medium, with, and without FBS. In non-treated PPC cells, phosphorylation of AKT was observed in both media, but the phosphorylation level of AKT was greater in FBS(+) than FBS(-) medium. In PPC cells, treatment with alpelisib led to significantly downregulated phosphorylation of AKT in both media. Furthermore, the phosphorylation level of ERK was slightly upregulated by 0.5 μM alpelisib (Fig 2A). In non-treated KPC cells, phosphorylation of AKT was observed in FBS(+) but not FBS(-) medium. Alpelisib suppressed phosphorylation of AKT in FBS(+) medium (Fig 2B). ERK signaling was not affected by alpelisib administration in KPC cells (Fig 2B).

[Figure omitted. See PDF.]

(A, B) Immunoblotting analysis of alpelisib-treated PPC cells (A) and KPC cells (B) for p-AKT, AKT, p-ERK, ERK, and β-actin. PPC or KPC cells were treated with alpelisib for 1 h at the indicated concentration. The left three lanes represent cells grown with FBS in the medium, and the right three lanes show results without FBS. (C, D, E, F) Proliferation of PPC cells with FBS (C) and without FBS (D) in the medium, and of KPC cells with FBS (E) and without FBS (F). These cells were analyzed using Cell Counting Kit 8 (CCK-8) assays at the indicated time with or without alpelisib at the indicated concentration. (n = 4 per treatment) (*P < 0.05, **P < 0.01, ***P < 0.001, N.S. = not significant).

Next, we explore the effect of alpelisib on the proliferation of PPC and KPC cells. Alpelisib inhibited the cell growth of PPC and KPC cells in medium containing FBS (Fig 2C, 2D). Without FBS, the proliferation of PPC cells was inhibited by alpelisib, while the effect of alpelisib on KPC cells was weak (Fig 2E, 2F). Determining which condition, with FBS or without FBS, better resembles the in vivo environment is difficult, but these data suggest that alpelisib alone is effective for PPC cells, but insufficient for KPC cells.

Effect of alpelisib on PPC and KPC cells in vivo

To explore the effects of alpelisib on PPC and KPC cells in vivo, PPC, and KPC cells were transplanted subcutaneously into NOD/SCID mice. One week after transplantation, alpelisib was administered by oral gavage for two weeks (5 out of 7 days). These mice were dissected 4 h after the last dose (Fig 3A). Treatment with alpelisib significantly reduced the tumor of PPC cells compared to treatment with vehicle, but not the tumor of KPC cells (Fig 3B). The tumor weight at harvested was also significantly reduced in PPC cells, but not in KPC cells (Fig 3C). Next, we examined the number of cleaved caspase-3 positive cells in each tumor by IHC. IHC revealed that, for PPC cells, alpelisib treatment significantly increased the ratio of cleaved caspase-3-positive cells, indicating that apoptosis of tumor cells is promoted by alpelisib. However, among KPC cells, alpelisib did not increase the number of cleaved caspase-3 positive cells (Fig 3D, 3E). These data suggest that administration of alpelisib alone is effective for PPC cells, but insufficient in KPC cells in vivo.

[Figure omitted. See PDF.]

(A) Diagram of this analysis. PPC or KPC cells were subcutaneously transplanted into NOD/SCID mice, and alpelisib (40 mg/kg) or vehicle was given by oral gavage for two weeks (5 out of 7 days). The mice were dissected 4 h after the last dose. (B) Photographs of mice subcutaneously transplanted with PPC or KPC cells containing vehicle or alpelisib. White arrowhead shows the subcutaneous tumor. (C) Subcutaneous tumor area over time for alpelisib-treated and control tumors. (D) Tumor weight at harvest. (E) IHC analyses of cleaved caspase-3 for PPC and KPC cell tumors with and without alpelisib. Scale bar, 100 μm. (F) Number of cleaved caspase-3-positive cells per field.

Synergistic effects of alpelisib and MEK inhibitor on PPC cells

As shown in Fig 2A, administration of alpelisib to PPC cells enhances ERK activation. Therefore, we expected that inhibition of both the AKT/PI3K and ERK pathways would have a synergistic anti-tumor effect on PPC cells. To inhibit the ERK pathway, we used PD98059, an inhibitor of MEK, which is just upstream of ERK. Phosphorylation of AKT and ERK was analyzed through Western blotting after treatment with PD98059, alpelisib or both. Alpelisib alone inhibited the phosphorylation of AKT with compensatory elevation of the phosphorylation level of ERK. PD98059 inhibited phosphorylation of ERK and did not alter the phosphorylation of AKT. Co-administration of alpelisib and PD98059 markedly suppressed the phosphorylation of AKT and ERK (Fig 4A). Next, we explored cell proliferation after treatment with these agents. Combination treatment with alpelisib and PD98059 synergistically inhibited the growth of PPC cells (Fig 4B). To further evaluate the effect of this drug combination, we performed a multidimensional two-drug synergy assay using alpelisib combined with PD98059 and assessed the effect using the highest single agent (HSA) model. Synergistic effects were considered to occur if the combined effect was more significant than expected (HSA synergy score > 0). The resulting HSA synergy score was 5.64 (Fig 4C). These data suggest that co-inhibition of the PI3K/AKT pathway and ERK pathway in pancreatic tumor cells effectively suppresses tumor growth in PI3K/AKT pathway-activated pancreatic tumor cells.

[Figure omitted. See PDF.]

(A) Immunoblotting analysis of PPC cells for p-AKT, AKT, p-ERK, ERK, and β-actin. PPC cells were treated with alpelisib or PD98059 as indicated for one hour. (B) Cell proliferation was analyzed via Cell Counting Kit 8 (CCK-8) assay in PPC cells treated with vehicle, alpelisib (0.5 μM), PD98059 (50 μM), or both at the indicated time. (*P < 0.01, **P < 0.001) (C) PPC cells were treated with alpelisib and PD98059 for 48 h at the indicated concentration. Cell viability was assessed using the CCK-8 assay. The two-dimensional surface response for cell inhibition and three-dimensional surface HSA synergy score are shown. Data are presented as the mean of duplicate analyses.

Discussion

We generated a novel PI3K/AKT pathway-activated pancreatic cancer mouse model and demonstrated the effectiveness of the PI3K inhibitor in tumors. Pdx1^CreER:PIK3CA ^H1047R mice may not develop pancreatic intraepithelial neoplasia until 6 months after Cre transduction with tamoxifen [26]. However, the expression of a constitutively active PI3K in Pdx1^cre/+:R26Stop^FLP110*mice results in pancreatic tumor formation [27], and Stefan Eser et. al. reported that Ptf1a^Cre/+:PIK3CA^H1047R/+ mice developed pancreatic intraepithelial neoplasia like Kras-driven tumor [28]. In the present study, PC mice developed cystic pancreatic tumors at 250 days of age, while PPC mice developed PDAC with cystic lesions at 100–150 days of age. Thus, we considered gain-of-function PIK3CA mutations to be potential oncogenes for PDAC.

Several small-molecule inhibitors of the PI3K/AKT/mTOR pathway, including alpelisib [11], capivasertib [29], and everolimus [30], have been approved for the treatment of various malignancies, but clinical trials of these agents for PDAC have generally not been very promising [6]. One possible reason for this lack of efficacy is the low positive rate for PIK3CA (3%) and PTEN (below 1%) mutations. However, as cancer genome medicine has expanded in recent years, we are increasingly able to elucidate the details of genetic mutations in individual cases of PDAC. As demonstrated in this study, PI3K inhibitors are highly effective for PIK3CA-mutated PDAC. Therefore, identifying such cases and providing this treatment option is crucial to improving the prognosis of pancreatic cancer.

Another possible reason is a metabolic mechanism causing resistance to treatment. A previous study found that systemic hyperinsulinemia due to hyperglycemia caused by PI3K inhibitors would make these agents ineffective, and that administration of ketogenic diets to suppress insulin feedback enhances the efficacy of PI3K inhibitors in mouse model [23]. Ketogenic diets have been used to treat patients with epilepsy since the 1970s [31] and are applicable to PDAC patients.

We reported that treatment with a PI3K inhibitor for pancreatic cancer with PIK3CA mutations complementarily enhanced the activation of ERK. Reactivation of ERK is a major basis for acquired resistance to KRAS inhibitor therapy [32,33]. Our study indicates that ERK signaling is also crucial in PI3K/AKT pathway-enhanced pancreatic cancer. MEK inhibition leads to PI3K/AKT activation by relieving negative feedback on ERBB receptors [34]. The MEK/ERK and PI3K/AKT pathways might be complementary in PDAC, and thus inhibition of both pathways may lead to strong suppression of PDAC.

This study has several limitations. First, more than 90% of human pancreatic cancers are Kras-positive [13], but PPC mice do not exhibit Kras mutation. The phenotypes of mice with both Kras and PIK3CA mutations remain unclear, including their drug sensitivity and responses to PI3K and Kras inhibitors, and warrant further investigation. Second, the effect of alpelisib for PPC tumor was evaluated in a subcutaneous tumor model. Although the transgenic model more closely resembles human pancreatic tumors, it is difficult to measure tumor size over time. Therefore, our results may not reflect the effect in human pancreatic tumors due to differences in the tumor microenvironment. Finally, we demonstrated the efficacy of the combination of alpelisib and PD98059 in vitro, but we did not perform in vivo experiments.

In summary, we generated a novel PI3K/AKT pathway-activated pancreatic cancer mouse model. PI3K inhibitors were effective against these tumors, but compensatory activation of ERK was observed in PI3K inhibitor-treated cancer cells. Suppression of MEK/ERK signaling in addition to the PI3K/AKT pathway might be required to suppress disease progression in PI3K/AKT pathway-activated PDAC.

Supporting information

S1 Fig. The image of nucleic acid electrophoresis of PPC/KPC mice and cells on an agarose gel.

DNA was extracted from KPC/PPC mouse tails or KPC/PPC cells and underwent Polymerase Chain Reaction (PCR). Lanes 1 and 2 indicated that the LSL-PIK3CA^H1047R sequence was included in PPC mice and PPC cells. Lanes 3 and 4 indicated that recombination of LSL-PIK3CA^H1047R sequence occurs only in PPC cells. Lane 5–8 indicated that KPC mice and cells did not have LSL-PIK3CA^H1047R sequence. The primer sequences are as follows:>PIK3CA: detecting the sequence of PIK3CA^H1047R/+ Forward: 5’-gtgtgccagagcaagtcattg −3’ Backward: 5’-atgacggcatggtgaagctat −3’ >re-PIK3CA: detecting recombination of LSL-PIK3CA^H1047R/+Forward: 5’- ggttgaggacaaactcttcgc −3’ Backward: 5’- ttcgtcttgcagaagctgatg −3’

https://doi.org/10.1371/journal.pone.0326491.s001

S2 Fig. Full blots of western blotting assay in Fig 2A, 2B, and 4A.

The area in red frame is used in Fig (A)2A, (B)2B and (C)4A. Molecular size (kDa) are indicated on the right side of the membrane. (B) These blots are cut off before hybridization with the antibody.

https://doi.org/10.1371/journal.pone.0326491.s002

S1 Table. The details of PC, PPC, and KPC mice.

The sex, tumor weight, body weight, histology, and metastasis of PC, PPC, and KPC mice. KPC mice (Ptf1a^ER–Cre/+ Kras^G12D/+ p53^loxP/loxP) was fed tamoxifen at 6 weeks of age and dissected at 18 weeks of age.

https://doi.org/10.1371/journal.pone.0326491.s003

S1 File. Full source data for Fig 3C and 3D.

The raw and analyzed data used to generate the graphs shown in Fig 3C and 3D

https://doi.org/10.1371/journal.pone.0326491.s004

(XLSX)

Acknowledgments

We thank Manaka Kawauchi for her assistance with the experiments.

References

1. 1. Siegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. CA Cancer J Clin. 2024;74(1):12–49. pmid:38230766

* View Article

* PubMed/NCBI

* Google Scholar

2. 2. Huang X, Zhang G, Tang T-Y, Gao X, Liang T-B. Personalized pancreatic cancer therapy: from the perspective of mRNA vaccine. Mil Med Res. 2022;9(1):53. pmid:36224645

* View Article

* PubMed/NCBI

* Google Scholar

3. 3. Tiriac H, Belleau P, Engle DD, Plenker D, Deschênes A, Somerville TDD, et al. Organoid Profiling Identifies Common Responders to Chemotherapy in Pancreatic Cancer. Cancer Discov. 2018;8(9):1112–29. pmid:29853643

* View Article

* PubMed/NCBI

* Google Scholar

4. 4. Pourali G, Kazemi D, Chadeganipour AS, Arastonejad M, Kashani SN, Pourali R, et al. Microbiome as a biomarker and therapeutic target in pancreatic cancer. BMC Microbiol. 2024;24(1):16. pmid:38183010

* View Article

* PubMed/NCBI

* Google Scholar

5. 5. Hirsch E, Gulluni F, Martini M. Phosphoinositides in cell proliferation and metabolism. Adv Biol Regul. 2020;75:100693. pmid:32008962

* View Article

* PubMed/NCBI

* Google Scholar

6. 6. Mortazavi M, Moosavi F, Martini M, Giovannetti E, Firuzi O. Prospects of targeting PI3K/AKT/mTOR pathway in pancreatic cancer. Crit Rev Oncol Hematol. 2022;176:103749. pmid:35728737

* View Article

* PubMed/NCBI

* Google Scholar

7. 7. Fresno Vara JA, Casado E, de Castro J, Cejas P, Belda-Iniesta C, González-Barón M. PI3K/Akt signalling pathway and cancer. Cancer Treat Rev. 2004;30(2):193–204. pmid:15023437

* View Article

* PubMed/NCBI

* Google Scholar

8. 8. Samuels Y, Wang Z, Bardelli A, Silliman N, Ptak J, Szabo S, et al. High frequency of mutations of the PIK3CA gene in human cancers. Science. 2004;304(5670):554. pmid:15016963

* View Article

* PubMed/NCBI

* Google Scholar

9. 9. Isakoff SJ, Engelman JA, Irie HY, Luo J, Brachmann SM, Pearline RV, et al. Breast cancer-associated PIK3CA mutations are oncogenic in mammary epithelial cells. Cancer Res. 2005;65(23):10992–1000. pmid:16322248

* View Article

* PubMed/NCBI

* Google Scholar

10. 10. Fritsch C, Huang A, Chatenay-Rivauday C, Schnell C, Reddy A, Liu M, et al. Characterization of the novel and specific PI3Kα inhibitor NVP-BYL719 and development of the patient stratification strategy for clinical trials. Mol Cancer Ther. 2014;13(5):1117–29. pmid:24608574

* View Article

* PubMed/NCBI

* Google Scholar

11. 11. André F, Ciruelos E, Rubovszky G, Campone M, Loibl S, Rugo HS, et al. Alpelisib for PIK3CA-Mutated, Hormone Receptor-Positive Advanced Breast Cancer. N Engl J Med. 2019;380(20):1929–40. pmid:31091374

* View Article

* PubMed/NCBI

* Google Scholar

12. 12. Samuels Y, Waldman T. Oncogenic mutations of PIK3CA in human cancers. Curr Top Microbiol Immunol. 2010;347:21–41. pmid:20535651

* View Article

* PubMed/NCBI

* Google Scholar

13. 13. Waddell N, Pajic M, Patch A-M, Chang DK, Kassahn KS, Bailey P, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature. 2015;518(7540):495–501. pmid:25719666

* View Article

* PubMed/NCBI

* Google Scholar

14. 14. Lowery MA, Jordan EJ, Basturk O, Ptashkin RN, Zehir A, Berger MF, et al. Real-Time Genomic Profiling of Pancreatic Ductal Adenocarcinoma: Potential Actionability and Correlation with Clinical Phenotype. Clin Cancer Res. 2017;23(20):6094–100. pmid:28754816

* View Article

* PubMed/NCBI

* Google Scholar

15. 15. Mehra S, Deshpande N, Nagathihalli N. Targeting PI3K Pathway in Pancreatic Ductal Adenocarcinoma: Rationale and Progress. Cancers (Basel). 2021;13(17):4434. pmid:34503244

* View Article

* PubMed/NCBI

* Google Scholar

16. 16. Kawaguchi Y, Cooper B, Gannon M, Ray M, MacDonald RJ, Wright CVE. The role of the transcriptional regulator Ptf1a in converting intestinal to pancreatic progenitors. Nat Genet. 2002;32(1):128–34. pmid:12185368

* View Article

* PubMed/NCBI

* Google Scholar

17. 17. Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C, Jacobetz MA, et al. Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell. 2003;4(6):437–50. pmid:14706336

* View Article

* PubMed/NCBI

* Google Scholar

18. 18. Pan FC, Bankaitis ED, Boyer D, Xu X, Van de Casteele M, Magnuson MA, et al. Spatiotemporal patterns of multipotentiality in Ptf1a-expressing cells during pancreas organogenesis and injury-induced facultative restoration. Development. 2013;140(4):751–64. pmid:23325761

* View Article

* PubMed/NCBI

* Google Scholar

19. 19. Adams JR, Xu K, Liu JC, Agamez NMR, Loch AJ, Wong RG, et al. Cooperation between Pik3ca and p53 mutations in mouse mammary tumor formation. Cancer Res. 2011;71(7):2706–17. pmid:21324922

* View Article

* PubMed/NCBI

* Google Scholar

20. 20. Marino S, Vooijs M, van Der Gulden H, Jonkers J, Berns A. Induction of medulloblastomas in p53-null mutant mice by somatic inactivation of Rb in the external granular layer cells of the cerebellum. Genes Dev. 2000;14(8):994–1004. pmid:10783170

* View Article

* PubMed/NCBI

* Google Scholar

21. 21. Percie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol. 2020;18(7):e3000410. pmid:32663219

* View Article

* PubMed/NCBI

* Google Scholar

22. 22. Lee HJ, Kim K-J, Sung JH, Nam M, Suh KJ, Kim J-W, et al. PI3K p110α Blockade Enhances Anti-Tumor Efficacy of Abemaciclib in Human Colorectal Cancer Cells. Cancers (Basel). 2020;12(9):2500. pmid:32899250

* View Article

* PubMed/NCBI

* Google Scholar

23. 23. Hopkins BD, Pauli C, Du X, Wang DG, Li X, Wu D, et al. Suppression of insulin feedback enhances the efficacy of PI3K inhibitors. Nature. 2018;560(7719):499–503. pmid:30051890

* View Article

* PubMed/NCBI

* Google Scholar

24. 24. Suzuki Y, Sato T, Sugimori M, Kanemaru Y, Onodera S, Tsuchiya H, et al. Activation of STING in pancreatic cancer-associated fibroblasts exerts an antitumor effect by enhancing tumor immunity. Sci Rep. 2024;14(1):17071. pmid:39048609

* View Article

* PubMed/NCBI

* Google Scholar

25. 25. André F, Ciruelos EM, Juric D, Loibl S, Campone M, Mayer IA, et al. Alpelisib plus fulvestrant for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative advanced breast cancer: final overall survival results from SOLAR-1. Ann Oncol. 2021;32(2):208–17. pmid:33246021

* View Article

* PubMed/NCBI

* Google Scholar

26. 26. Collisson EA, Trejo CL, Silva JM, Gu S, Korkola JE, Heiser LM, et al. A central role for RAF→MEK→ERK signaling in the genesis of pancreatic ductal adenocarcinoma. Cancer Discov. 2012;2(8):685–93. pmid:22628411

* View Article

* PubMed/NCBI

* Google Scholar

27. 27. Payne SN, Maher ME, Tran NH, Van De Hey DR, Foley TM, Yueh AE, et al. PIK3CA mutations can initiate pancreatic tumorigenesis and are targetable with PI3K inhibitors. Oncogenesis. 2015;4(10):e169. pmid:26436951

* View Article

* PubMed/NCBI

* Google Scholar

28. 28. Eser S, Reiff N, Messer M, Seidler B, Gottschalk K, Dobler M, et al. Selective requirement of PI3K/PDK1 signaling for Kras oncogene-driven pancreatic cell plasticity and cancer. Cancer Cell. 2013;23(3):406–20. pmid:23453624

* View Article

* PubMed/NCBI

* Google Scholar

29. 29. Turner NC, Oliveira M, Howell SJ, Dalenc F, Cortes J, Gomez Moreno HL, et al. Capivasertib in Hormone Receptor-Positive Advanced Breast Cancer. N Engl J Med. 2023;388(22):2058–70. pmid:37256976

* View Article

* PubMed/NCBI

* Google Scholar

30. 30. Yao JC, Fazio N, Singh S, Buzzoni R, Carnaghi C, Wolin E, et al. Everolimus for the treatment of advanced, non-functional neuroendocrine tumours of the lung or gastrointestinal tract (RADIANT-4): a randomised, placebo-controlled, phase 3 study. Lancet. 2016;387(10022):968–77. pmid:26703889

* View Article

* PubMed/NCBI

* Google Scholar

31. 31. Neal EG, Chaffe H, Schwartz RH, Lawson MS, Edwards N, Fitzsimmons G, et al. The ketogenic diet for the treatment of childhood epilepsy: a randomised controlled trial. Lancet Neurol. 2008;7(6):500–6. pmid:18456557

* View Article

* PubMed/NCBI

* Google Scholar

32. 32. Klomp JE, Diehl JN, Klomp JA, Edwards AC, Yang R, Morales AJ, et al. Determining the ERK-regulated phosphoproteome driving KRAS-mutant cancer. Science. 2024;384(6700):eadk0850. pmid:38843329

* View Article

* PubMed/NCBI

* Google Scholar

33. 33. Klomp JA, Klomp JE, Stalnecker CA, Bryant KL, Edwards AC, Drizyte-Miller K, et al. Defining the KRAS- and ERK-dependent transcriptome in KRAS-mutant cancers. Science. 2024;384(6700):eadk0775. pmid:38843331

* View Article

* PubMed/NCBI

* Google Scholar

34. 34. Turke AB, Song Y, Costa C, Cook R, Arteaga CL, Asara JM, et al. MEK inhibition leads to PI3K/AKT activation by relieving a negative feedback on ERBB receptors. Cancer Res. 2012;72(13):3228–37. pmid:22552284

* View Article

* PubMed/NCBI

* Google Scholar

Citation: Suzuki Y, Sugimori M, Kanemaru Y, Onodera S, Tsuchiya H, Ikeda A, et al. (2025) Development of a novel PIK3CA-mutated pancreatic tumor mouse model and evaluation of the therapeutic effects of a PI3K inhibitor. PLoS One 20(7): e0326491. https://doi.org/10.1371/journal.pone.0326491

About the Authors:

Yoshimasa Suzuki

Roles: Data curation, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing

Affiliation: Department of Gastroenterology, Yokohama City University Graduate School of Medicine, Yokohama, Japan

Makoto Sugimori

Roles: Investigation, Methodology, Supervision, Writing – review & editing

Affiliation: Gastroenterological Center, Yokohama City University Medical Center, Yokohama, Japan

ORICD: https://orcid.org/0000-0001-5272-5167

Yushi Kanemaru

Roles: Methodology, Resources, Writing – review & editing

Affiliation: Department of Gastroenterology, Yokohama City University Graduate School of Medicine, Yokohama, Japan

Sho Onodera

Roles: Validation, Writing – review & editing

Affiliation: Department of Gastroenterology, Yokohama City University Graduate School of Medicine, Yokohama, Japan

Hiromi Tsuchiya

Roles: Validation, Visualization, Writing – review & editing

Affiliation: Gastroenterological Center, Yokohama City University Medical Center, Yokohama, Japan

Aya Ikeda

Roles: Supervision, Validation, Writing – review & editing

Affiliation: Department of Gastroenterology, Yokohama City University Graduate School of Medicine, Yokohama, Japan

Ryosuke Ikeda

Roles: Validation, Visualization, Writing – review & editing

Affiliation: Department of Gastroenterology, Yokohama City University Graduate School of Medicine, Yokohama, Japan

Yoshihiro Goda

Roles: Supervision, Validation, Writing – review & editing

Affiliation: Department of Gastroenterology, Yokohama City University Graduate School of Medicine, Yokohama, Japan

Hiroaki Kaneko

Roles: Supervision, Validation, Writing – review & editing

Affiliation: Department of Gastroenterology, Yokohama City University Graduate School of Medicine, Yokohama, Japan

Kuniyasu Irie

Roles: Supervision, Validation, Writing – review & editing

Affiliation: Department of Gastroenterology, Yokohama City University Graduate School of Medicine, Yokohama, Japan

Soichiro Sue

Roles: Project administration, Supervision, Validation, Writing – review & editing

Affiliation: Department of Gastroenterology, Yokohama City University Graduate School of Medicine, Yokohama, Japan

Hideaki Ijichi

Roles: Resources

Affiliation: Department of Gastroenterology, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan

Shin Maeda

Roles: Conceptualization, Project administration, Supervision, Writing – review & editing

E-mail: [email protected]

Affiliation: Department of Gastroenterology, Yokohama City University Graduate School of Medicine, Yokohama, Japan

ORICD: https://orcid.org/0000-0002-0246-1594

References

1. Siegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. CA Cancer J Clin. 2024;74(1):12–49. pmid:38230766

2. Huang X, Zhang G, Tang T-Y, Gao X, Liang T-B. Personalized pancreatic cancer therapy: from the perspective of mRNA vaccine. Mil Med Res. 2022;9(1):53. pmid:36224645

3. Tiriac H, Belleau P, Engle DD, Plenker D, Deschênes A, Somerville TDD, et al. Organoid Profiling Identifies Common Responders to Chemotherapy in Pancreatic Cancer. Cancer Discov. 2018;8(9):1112–29. pmid:29853643

4. Pourali G, Kazemi D, Chadeganipour AS, Arastonejad M, Kashani SN, Pourali R, et al. Microbiome as a biomarker and therapeutic target in pancreatic cancer. BMC Microbiol. 2024;24(1):16. pmid:38183010

5. Hirsch E, Gulluni F, Martini M. Phosphoinositides in cell proliferation and metabolism. Adv Biol Regul. 2020;75:100693. pmid:32008962

6. Mortazavi M, Moosavi F, Martini M, Giovannetti E, Firuzi O. Prospects of targeting PI3K/AKT/mTOR pathway in pancreatic cancer. Crit Rev Oncol Hematol. 2022;176:103749. pmid:35728737

7. Fresno Vara JA, Casado E, de Castro J, Cejas P, Belda-Iniesta C, González-Barón M. PI3K/Akt signalling pathway and cancer. Cancer Treat Rev. 2004;30(2):193–204. pmid:15023437

8. Samuels Y, Wang Z, Bardelli A, Silliman N, Ptak J, Szabo S, et al. High frequency of mutations of the PIK3CA gene in human cancers. Science. 2004;304(5670):554. pmid:15016963

9. Isakoff SJ, Engelman JA, Irie HY, Luo J, Brachmann SM, Pearline RV, et al. Breast cancer-associated PIK3CA mutations are oncogenic in mammary epithelial cells. Cancer Res. 2005;65(23):10992–1000. pmid:16322248

10. Fritsch C, Huang A, Chatenay-Rivauday C, Schnell C, Reddy A, Liu M, et al. Characterization of the novel and specific PI3Kα inhibitor NVP-BYL719 and development of the patient stratification strategy for clinical trials. Mol Cancer Ther. 2014;13(5):1117–29. pmid:24608574

11. André F, Ciruelos E, Rubovszky G, Campone M, Loibl S, Rugo HS, et al. Alpelisib for PIK3CA-Mutated, Hormone Receptor-Positive Advanced Breast Cancer. N Engl J Med. 2019;380(20):1929–40. pmid:31091374

12. Samuels Y, Waldman T. Oncogenic mutations of PIK3CA in human cancers. Curr Top Microbiol Immunol. 2010;347:21–41. pmid:20535651

13. Waddell N, Pajic M, Patch A-M, Chang DK, Kassahn KS, Bailey P, et al. Whole genomes redefine the mutational landscape of pancreatic cancer. Nature. 2015;518(7540):495–501. pmid:25719666

14. Lowery MA, Jordan EJ, Basturk O, Ptashkin RN, Zehir A, Berger MF, et al. Real-Time Genomic Profiling of Pancreatic Ductal Adenocarcinoma: Potential Actionability and Correlation with Clinical Phenotype. Clin Cancer Res. 2017;23(20):6094–100. pmid:28754816

15. Mehra S, Deshpande N, Nagathihalli N. Targeting PI3K Pathway in Pancreatic Ductal Adenocarcinoma: Rationale and Progress. Cancers (Basel). 2021;13(17):4434. pmid:34503244

16. Kawaguchi Y, Cooper B, Gannon M, Ray M, MacDonald RJ, Wright CVE. The role of the transcriptional regulator Ptf1a in converting intestinal to pancreatic progenitors. Nat Genet. 2002;32(1):128–34. pmid:12185368

17. Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C, Jacobetz MA, et al. Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell. 2003;4(6):437–50. pmid:14706336

18. Pan FC, Bankaitis ED, Boyer D, Xu X, Van de Casteele M, Magnuson MA, et al. Spatiotemporal patterns of multipotentiality in Ptf1a-expressing cells during pancreas organogenesis and injury-induced facultative restoration. Development. 2013;140(4):751–64. pmid:23325761

19. Adams JR, Xu K, Liu JC, Agamez NMR, Loch AJ, Wong RG, et al. Cooperation between Pik3ca and p53 mutations in mouse mammary tumor formation. Cancer Res. 2011;71(7):2706–17. pmid:21324922

20. Marino S, Vooijs M, van Der Gulden H, Jonkers J, Berns A. Induction of medulloblastomas in p53-null mutant mice by somatic inactivation of Rb in the external granular layer cells of the cerebellum. Genes Dev. 2000;14(8):994–1004. pmid:10783170

21. Percie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol. 2020;18(7):e3000410. pmid:32663219

22. Lee HJ, Kim K-J, Sung JH, Nam M, Suh KJ, Kim J-W, et al. PI3K p110α Blockade Enhances Anti-Tumor Efficacy of Abemaciclib in Human Colorectal Cancer Cells. Cancers (Basel). 2020;12(9):2500. pmid:32899250

23. Hopkins BD, Pauli C, Du X, Wang DG, Li X, Wu D, et al. Suppression of insulin feedback enhances the efficacy of PI3K inhibitors. Nature. 2018;560(7719):499–503. pmid:30051890

24. Suzuki Y, Sato T, Sugimori M, Kanemaru Y, Onodera S, Tsuchiya H, et al. Activation of STING in pancreatic cancer-associated fibroblasts exerts an antitumor effect by enhancing tumor immunity. Sci Rep. 2024;14(1):17071. pmid:39048609

25. André F, Ciruelos EM, Juric D, Loibl S, Campone M, Mayer IA, et al. Alpelisib plus fulvestrant for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative advanced breast cancer: final overall survival results from SOLAR-1. Ann Oncol. 2021;32(2):208–17. pmid:33246021

26. Collisson EA, Trejo CL, Silva JM, Gu S, Korkola JE, Heiser LM, et al. A central role for RAF→MEK→ERK signaling in the genesis of pancreatic ductal adenocarcinoma. Cancer Discov. 2012;2(8):685–93. pmid:22628411

27. Payne SN, Maher ME, Tran NH, Van De Hey DR, Foley TM, Yueh AE, et al. PIK3CA mutations can initiate pancreatic tumorigenesis and are targetable with PI3K inhibitors. Oncogenesis. 2015;4(10):e169. pmid:26436951

28. Eser S, Reiff N, Messer M, Seidler B, Gottschalk K, Dobler M, et al. Selective requirement of PI3K/PDK1 signaling for Kras oncogene-driven pancreatic cell plasticity and cancer. Cancer Cell. 2013;23(3):406–20. pmid:23453624

29. Turner NC, Oliveira M, Howell SJ, Dalenc F, Cortes J, Gomez Moreno HL, et al. Capivasertib in Hormone Receptor-Positive Advanced Breast Cancer. N Engl J Med. 2023;388(22):2058–70. pmid:37256976

30. Yao JC, Fazio N, Singh S, Buzzoni R, Carnaghi C, Wolin E, et al. Everolimus for the treatment of advanced, non-functional neuroendocrine tumours of the lung or gastrointestinal tract (RADIANT-4): a randomised, placebo-controlled, phase 3 study. Lancet. 2016;387(10022):968–77. pmid:26703889

31. Neal EG, Chaffe H, Schwartz RH, Lawson MS, Edwards N, Fitzsimmons G, et al. The ketogenic diet for the treatment of childhood epilepsy: a randomised controlled trial. Lancet Neurol. 2008;7(6):500–6. pmid:18456557

32. Klomp JE, Diehl JN, Klomp JA, Edwards AC, Yang R, Morales AJ, et al. Determining the ERK-regulated phosphoproteome driving KRAS-mutant cancer. Science. 2024;384(6700):eadk0850. pmid:38843329

33. Klomp JA, Klomp JE, Stalnecker CA, Bryant KL, Edwards AC, Drizyte-Miller K, et al. Defining the KRAS- and ERK-dependent transcriptome in KRAS-mutant cancers. Science. 2024;384(6700):eadk0775. pmid:38843331

34. Turke AB, Song Y, Costa C, Cook R, Arteaga CL, Asara JM, et al. MEK inhibition leads to PI3K/AKT activation by relieving a negative feedback on ERBB receptors. Cancer Res. 2012;72(13):3228–37. pmid:22552284