Antidepressant‐Like Effects of Electroacupuncture by Regulating NLRP3‐mediated Hippocampal Inflammation and Pyroptosis in Rats With Post‐Stroke Depression

Abstract

ABSTRACT

Objective

This study aimed to investigate whether the antidepressant‐like effects of electroacupuncture (EA) are associated with the regulation of inflammation and pyroptosis mediated by the NLRP3 inflammasome, as well as the protection of neuron cells in the hippocampus (HP) in a rat model of post‐stroke depression (PSD).

Methods

Depressive‐like behaviors (DLBs) in PSD rats were evaluated through a series of behavioral tests. The expression levels of NLRP3, caspase‐1 (Casp‐1), and apoptosis‐associated speck‐like protein (ASC), as well as the cleavage product gasdermin D (GSDMD), were assessed using real‐time PCR (RT‐PCR), immunofluorescence, and Western blot (WB). IL‐1β and IL‐18 levels were measured by RT‐PCR and WB. To upregulate NLRP3 expression, adeno‐associated virus (AAV) was injected into the hippocampus. Nissl staining was employed to evaluate neuronal morphology and count in the hippocampus.

Results

EA significantly alleviated DLBs in PSD rats and suppressed the overexpression of NLRP3, Casp‐1, ASC, GSDMD, IL‐1β, and IL‐18 in the ischemic hippocampus. NLRP3 overexpression attenuated the therapeutic effects of EA on both behavioral outcomes and neuroinflammatory markers.

Conclusions

EA mitigated hippocampal inflammation and pyroptosis in PSD by downregulating NLRP3 inflammasome activation, indicating that NLRP3 may serve as a potential therapeutic target for PSD.

Introduction

Post-stroke depression (PSD) is a common neuropsychiatric complication following stroke, significantly diminishing patients’ quality of life and hindering recovery efforts (Wan et al. 2024, Zheng et al. 2024). The incidence of depression markedly increases within the first few weeks to three months after stroke, adversely affecting rehabilitation outcomes and reducing long-term survival rates (Gu et al. 2024, Liu et al. 2023, Masuccio et al. 2024). Although pharmacotherapies, such as selective serotonin reuptake inhibitors, are widely used and often effective, they are associated with notable side effects, including myocardial infarction, sexual dysfunction, and an increased risk of hemorrhage (Coupland et al. 2011, Hackett et al. 2008). These limitations highlight the urgent need for safer and more tolerable therapeutic alternatives for PSD.

Recent studies have underscored the critical role of hippocampal (HP) inflammation in the pathogenesis of both stroke (Zhou et al. 2022) and depression (Ruilian et al. 2021, Xu et al. 2016). A meta-analysis has concluded that proinflammatory cytokines are significantly linked to the development of PSD (Chen et al. 2020). Experimental research has further demonstrated that inhibition of HP inflammation can ameliorate depressive-like behaviors (DLBs) in PSD animal models (Li et al. 2017). Clinically, stroke patients with higher serum proinflammatory cytokine levels contribute to a higher PSD risk (Kang et al. 2016, Kim et al. 2017), suggesting that hippocampal inflammatory activation is a key driver of post-stroke mood disturbances.

The NLRP3 (NOD-, LRR-, and pyrin domain-containing protein 3) inflammasome is a central regulator of inflammation, comprising NLRP3, the adaptor protein ASC (apoptosis-associated speck-like protein containing a CARD), and caspase-1 (Casp-1) (Zhong et al. 2018). Upon activation, NLRP3 promotes the cleavage of pro-Casp-1 into its active form, which in turn cleaves gasdermin D (GSDMD), facilitating the maturation and release of interleukins IL-1β and IL-18. This process leads to pyroptosis, a proinflammatory form of programmed cell death (McKenzie et al. 2018, Fann et al. 2018, Ren et al. 2018). The resulting inflammatory cascade contributes to neuronal damage and cognitive impairment, which are believed to exacerbate depressive symptoms (You et al. 2011, Czeh and Nagy 2018).

Acupuncture has emerged as a promising alternative for PSD, particularly for patients who are unable to tolerate conventional antidepressants (Liu et al. 2021, Wang et al. 2021). Electroacupuncture (EA), a modern adaptation of traditional acupuncture, has shown efficacy in alleviating DLBs by suppressing hippocampal inflammation in animal models (Chen et al. 2022, Wang et al. 2022, Zhou et al. 2022). Additionally, EA has been shown to reduce neuronal apoptosis in the hippocampus (HP) (Cheng et al. 2021) and promote neuroplasticity by enhancing dendritic arborization and spine density in the CA1 region of the hippocampus (Davila-Hernandez et al. 2018).

Given these findings, our study aimed to investigate whether the antidepressant effects of EA in PSD rats are mediated by the inhibition of NLRP3 inflammasome activation, suppression of pyroptosis, and protection of hippocampal neurons.

Methods

Animals

Male Sprague–Dawley rats (2 months, 180–200 g) were obtained from Beijing Wei Tong Li Hua Laboratory Animal Technology Co., Ltd. (Shanghai, China). Animals were housed under standard laboratory conditions (22–24°C, 55%-65% humidity, 12-h light-dark cycle) with free access to food and water. All experimental procedures were approved by the Ethics Committee of Shanghai University of Traditional Chinese Medicine (No. PZOHUTCM210305007) and conducted in accordance with the ARRIVE guidelines, the Animals (Scientific Procedures) Act 1986, and EU Directive 2010/63 on the protection of animals utilized for scientific purposes.

After a 1-week acclimatization period, 60 rats were randomly divided into two groups: sham (n = 8) and middle cerebral artery occlusion (MCAO, n = 52). Of the 52 rats undergoing MCAO surgery, 12 died within 72 h post-surgery. The remaining 40 surviving rats were randomly assigned to five groups (n = 8/group): PSD, EA, PSD + overexpression (OE)-NLRP3 + EA, PSD + null virus (NV) + EA, and PSD + OE-NLRP3.

Establishment of the PSD Model

The PSD model was developed by middle cerebral artery occlusion (MCAO) plus chronic unpredictable mild stress (CUMS) (Fan et al. 2023, Hu et al. 2019, Jiang et al. 2021, Liu et al. 2024, Lv et al. 2024). MCAO was conducted to generate cerebral ischemia (Belayev et al. 1996). Under sodium pentobarbital anesthesia, a midline cervical incision was made to expose the right common carotid artery (CCA), external carotid artery (ECA), and internal carotid artery (ICA). A 0.32 mm-diameter nylon monofilament (Beijing Xinong Technology Co. Ltd., China) was inserted into the ICA to occlude the middle cerebral artery. After 90 minutes of ischemia, the filament was removed to allow reperfusion.

Twenty-four hours after surgery, neurological function was assessed using the Longa-Z scoring method (Longa et al. 1989). Rats with scores between 1 and 3 were included in the study. Sham-operated rats underwent the same surgical procedure without filament insertion.

Following a 7-day postoperative recovery period, all groups—except the sham group—were subjected to a 6-week CUMS protocol (Willner et al. 1992). The CUMS procedure involved daily exposure to any two randomly selected stressors from the following set: 24-h food or water deprivation, overnight illumination, soiled bedding (24 h), 45° cage tilt (24 h), 4-h restraint, 2-h restraint at 4°C, 8-h noise exposure, 6-hour strobe lighting, and 15-min cage shaking.

EA Stimulus

EA was administered at the Baihui (DU20) and Shenting (DU24) acupoints (Guo 2021) (Figure 1). Stainless steel needles (0.25 mm diameter, 40 mm length; Jiajian Medical Supplies Co. Ltd., Jiangsu, China) were inserted to a depth of 5–8 mm. Acupoint selection was based on our previous studies, which demonstrated significant efficacy in alleviating depressive-like symptoms in animal models (Cai et al. 2019, Cai et al. 2023, Cai et al. 2024). The inserted needles were connected to an electroacupuncture device (Hwato SDZ-II, Suzhou Medical Supplies Co. Ltd., Jiangsu, China), delivering continuous stimulation at a frequency of 20 Hz and an intensity of 1 mA. Each session lasted 20 min. EA treatment began at the end of the third week of the CUMS protocol and was administered once daily for three consecutive weeks.

[IMAGE OMITTED. SEE PDF]

Behavioral Tests

All behavioral assessments were conducted on day 21 and day 42 (before and after EA treatment) of the experiment:

Sucrose Preference Test (SPT)

The SPT was used to assess anhedonia in rats (Tang et al. 2015). On day 1, rats were provided with two bottles of 1% sucrose solution for 24 h. On day 2, one bottle of 1% sucrose and one bottle of purified water were presented, with bottle positions switched after 12 h to avoid side bias. On day 3, rats underwent 24 h of water deprivation. On day 4, rats were given access to both sucrose and water bottles for 2 h. Sucrose preference was calculated as sucrose intake (g) / [sucrose intake (g) + water intake (g)].

Open Field Test (OFT)

The OFT was used to evaluate locomotor activity and exploratory behavior (Tang et al. 2015). Each rat was placed in the center of a dark, open-field box (100 × 100 × 50 cm) equipped with an automated data acquisition system (Xinruan Information & Technology Co., Ltd., Shanghai, China). Rats were allowed to explore freely for 5 min. The total distance traveled, number of rearing events, and number of entries into the central area were recorded. The arena was thoroughly cleaned between sessions to eliminate olfactory cues.

Forced Swim Test (FST)

The FST was conducted to assess behavioral despair. Each rat was placed in a transparent cylindrical tank (height: 55 cm, diameter: 22 cm) filled with water (20–22°C) to a depth of approximately 30 cm. The test lasted for 6 min, with immobility time recorded during the final 4 min. Immobility was defined as the absence of active swimming, with minimal movements required only to keep the head above water (Detke and Lucki 1996).

Viral Injection

Two weeks after MCAO surgery, rats were anesthetized with sodium pentobarbital and secured in a stereotaxic apparatus for hippocampal injection. Recombinant adeno-associated virus (AAV) vectors were injected into the hippocampus at a rate of 100 nL/min, with a total volume of 1000 nL. Stereotaxic coordinates were as follows: anteroposterior (AP) −3.4 mm, mediolateral (ML) + 4.0 mm, and dorsoventral (DV) −3.5 mm. To induce NLRP3 overexpression, we used recombinant AAV encoding NLRP3 (pAAV-CMV-Nlrp3-3FLAG). Control rats received AAV encoding a null vector (pAAV-CMV-MCS-3FLAG; all from Obio Technology, Shanghai, China).

Brain Sample Collection

At the end of the experiment, rats were deeply anesthetized with an overdose of anesthesia using 2 mL of sodium pentobarbital injected intraperitoneally. For qPCR and Western blot (WB) analyses, the brains were rapidly removed, and hippocampal (HP) tissues from the ischemic side were dissected, flash-frozen in liquid nitrogen, and stored at −80°C until usage. For immunofluorescence and Nissl staining, rats were transcardially perfused with 4% paraformaldehyde. Brains were post-fixed, dehydrated, embedded in optimal cutting temperature (OCT) compound (Tissue-Tek), and sectioned at 30 µm using a freezing microtome (Leica CM1950, Nussloch, Germany). Serial sections were collected into six sets and maintained in 50% glycerol at −20°C.

Quantitative Real-Time (qRT) PCR

Gene expression in the HP ischemic penumbra was analyzed by qRT-PCR. Total RNA was extracted via TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Massachusetts, USA), and cDNA was synthesized following the protocols with a cDNA Synthesis Kit (Wuhan Servicebio Technology, Wuhan, China). qPCR was carried out through a thermocycler (Bio-Rad Laboratories, California, USA). The specific primers used for amplification are listed below (Table 1).

TABLE 1 The specific primers used for amplification in qRT-PCR.

Target	Sequence
R-NLRP3-S	GATTTCTCCACAACTCACCCAA
R-NLRP3-A	AGTCTGGAAGAACAGGCAACAT
R-ASC-S	ACTATCTGGAGGGGTATGGCTT
R-ASC-A	CAATGAGTGCTTGCCTGTGTT
R-Caspase1-S	AAGCCCAAGGTTATCATTATTCAGG
R-Caspase1-A	ATCCCTCTTCGGAGTTCCCTAC
R-GSDMD-S	CAGGCAGCATCCTTGAGTGTC
R-GSDMD-A	CCAAGACGTGCTTCACCAACT
R-IL-18-S	AACAGCCAACGAATCCCAGAC
R-IL-18-A	TTGTTTTTACAGGAGAGGGTAGACA
R-IL-1β-S	TGTGACTCGTGGGATGATGAC
R-IL-1β-A	CCACTTGTTGGCTTATGTTCTGTC

Western Blot

Total protein extraction from the ischemic HP was carried out by RIPA tissue lysis buffer. Protein concentrations were determined with a Bicarbonate Protein Assay Kit (Wuhan Servicebio Technology, Wuhan, China). The WB was performed by incubating the membranes with primary antibodies: anti-NLRP3 (1:1000, NOVUS), ASC (1:500, Santa Cruz), Casp-1 (1:1000, Proteintech), GSDMD (1:500, Santa Cruz), and IL-1β/18 (1:1000, Abcam) at 4°C for a whole night, followed by secondary antibody incubation.

Immunofluorescent Staining

Coronal sections of the ischemic HP were prepared at a thickness of 12 µm. For immunofluorescence, we deployed the following primary antibodies: anti-NLRP3 (1:1000, NOVUS), ASC (1:500, Santa Cruz), Casp-1 (1:1000, Proteintech), NeuN (1:1000, Abcam), and GSDMD (1:500, Santa Cruz). Fluorescence-labeled secondary antibodies were applied, counterstaining nuclei with DAPI (Wuhan Servicebio Technology, Wuhan, China). Visualization was performed using an ECLIPSE C1 upright fluorescence microscope (Nikon Instruments Inc., Shanghai, China), and mean fluorescence intensity was quantified by ImageJ software (v1.51, National Institutes of Health, Bethesda, USA).

Nissl Staining

Ischemic HP sections were subjected to staining with 0.5% thionin at room temperature, dehydrating in 95% ethanol, baking at 65°C, clearing with xylene, and sealing with neutral gum. Ischemic HP region images were captured using a light microscope (Nikon Eclipse E100). Neuronal counting was performed with the ImageJ software.

Statistical Analyses

Statistical analyses were conducted via SPSS software (v21.0; SPSS Inc., Chicago, IL, USA). Data normality was validated prior to analysis. Group differences were evaluated by one-way ANOVA, with P < 0.05 indicating statistical significance.

Results

EA Ameliorated DLBs of PSD Rats

Rats in the PSD model group exhibited marked depressive-like behaviors, as indicated by significant reductions in total distance traveled, rearing frequency, central zone entries in the open field test, and sucrose preference in the SPT, along with increased immobility time in the forced swim test. EA treatment significantly improved these behavioral impairments. Specifically, EA increased locomotor and exploratory activity, enhanced sucrose preference, and reduced immobility time compared to the untreated PSD group (Figures 2A-F).

[IMAGE OMITTED. SEE PDF]

EA Inhibited Inflammatory Response in the Ischemic HP

RT-PCR analysis showed a significant elevation in IL-1β mRNA expression in the ischemic hippocampus of PSD rats compared to the sham group. EA treatment markedly reduced this upregulation. Although IL-18 mRNA levels were also elevated in PSD rats, EA administration led to a reduction that did not reach statistical significance (Figures 2G–H). These mRNA findings were further supported by Western blot analysis, which demonstrated parallel trends in protein expression (Figures 2I–K). Collectively, these results indicate that EA mitigates the inflammatory response in the ischemic hippocampus of PSD rats.

EA Suppressed NLRP3 Activation in the Ischemic HP

Both mRNA and protein expression levels of NLRP3, ASC, Casp-1, and GSDMD were significantly upregulated in the ischemic hippocampus of PSD rats compared to the sham group. EA treatment effectively downregulated the expression of these inflammasome-related markers (Figures 3A-I). Immunofluorescence staining further confirmed that NLRP3 was expressed in hippocampal neurons. In PSD rats, increased neural expression of NLRP3, ASC, Casp-1, and GSDMD was observed in the CA3 region of the ischemic hippocampus. EA treatment markedly attenuated these elevations (Figures 4A-H). These findings suggest that EA inhibits NLRP3 inflammasome activation at both the molecular and cellular levels in the hippocampus of PSD rats.

[IMAGE OMITTED. SEE PDF]

[IMAGE OMITTED. SEE PDF]

EA Reduced the Loss of Neuron Cells to Attenuate Neuronal Pyroptosis in the Ischemic HP

Nissl staining revealed marked neuronal damage in the ischemic hippocampus of PSD rats, characterized by disorganized cell arrangement, irregular morphology, and a reduced number of Nissl-positive neurons compared to the sham group (Figures 5A-B). EA treatment significantly mitigated these pathological changes, preserving neuronal structure and reducing cell loss. These findings suggest that EA attenuates neuronal pyroptosis and protects hippocampal neurons in PSD rats.

[IMAGE OMITTED. SEE PDF]

Effects of EA on DLBs and HP Inflammation Response were Reversed by NLRP3 Upregulation

To validate the role of NLRP3 in mediating the antidepressant effects of EA, an AAV encoding NLRP3 (PSD + OE-NLRP3 + EA) was microinjected into the hippocampus of PSD rats receiving EA treatment seven days post-MCAO (Figure 6A). NLRP3 overexpression significantly increased the protein levels of NLRP3, ASC, Casp-1, and GSDMD in the hippocampus compared to the EA-treated PSD group without viral transduction (Figures 6G–K).

[IMAGE OMITTED. SEE PDF]

Behavioral assessments revealed that, in contrast to the PSD + NV + EA group, rats in the PSD + OE-NLRP3 + EA group displayed a significant decline in total distance traveled, rearing events, central zone entries, and sucrose preference, alongside increased immobility time (Figures 6B-F). These results indicate that NLRP3 overexpression effectively abolished the antidepressant-like effects of EA.

Additionally, IL-1β and IL-18 protein levels were significantly elevated in the hippocampus of NLRP3-overexpressing rats compared to the NV control group (Figures 6L-M), further confirming that NLRP3 upregulation reverses the anti-inflammatory effects of EA in PSD rats.

Discussion

This study demonstrated that EA exerts significant antidepressant effects in a PSD rat model by inhibiting NLRP3 inflammasome activation, thereby reducing hippocampal inflammation and neuronal pyroptosis. These findings suggest that NLRP3 may serve as a promising therapeutic target for PSD (Figure 7).

[IMAGE OMITTED. SEE PDF]

Following ischemic stroke, oxygen and glucose deprivation lead to impaired ATP production and extensive neuronal damage. This cellular stress triggers the release of danger-associated molecular patterns (DAMPs), which are recognized by toll-like receptors (TLRs) (Kaur and Ling 2009). DAMP-TLR interaction activates NF-κB signaling, promoting IL-1β pro-inflammatory cytokine synthesis (Yao et al. 2013, Yao et al. 2013), thereafter processed by NLRP3 activation (Hanamsagar et al. 2011). Blocking IL-1β signaling by hampering NLRP3 reduces brain inflammation and injury in rats after stroke (Abulafia et al. 2009, de et al. 2009, Garcia et al. 1995, Relton et al. 1996). Moreover, stroke-triggered IL-1β/18 and TNF-α pro-inflammatory cytokine upregulation can amplify neuroinflammation, activate indoleamine 2,3-dioxygenase, and reduce serotonin levels, all of which are implicated in PSD pathophysiology (Fang and Cheng 2009, Spalletta et al. 2006). Clinically, elevated serum IL-1β/18 levels at stroke onset are related to escalated risk of developing PSD (Kang et al. 2016, Kim et al. 2017).

The hippocampus (HP), a critical structure within the limbic system, is composed of the dentate gyrus (DG) and hippocampal gyrus (CA1–CA4 regions), with the latter rich in pyramidal neurons involved in mood regulation. Patients with depression often exhibit reduced volumes in the CA1–CA3 and DG regions (Huang et al. 2013). Although structural and functional alterations in the HP are associated with depressive disorders, the specific HP subregion most implicated in PSD remains uncertain. Notably, depression models have been reported to display significant neuronal loss in the CA3 region (Kempermann and Kronenberg 2003)—a finding corroborated by our current results, which demonstrated that EA mitigated neuronal loss in the CA3 region of PSD rat.

The hippocampal inflammation is closely associated with depression (Mokhtari et al. 2023, Mokhtari et al. 2023). Inhibition of HP inflammation has been reported to alleviate DLBs in LPS-induced mice (Li et al. 2017). CUMS exposure can activate the NLRP3 inflammasome, promoting ASC oligomerization, caspase-1 activation, GSDMD cleavage, and ultimately pyroptosis (Faria et al. 2021). Accumulating evidence supports the role of NLRP3-induced inflammation and pyroptosis in depression pathogenesis (Kaufmann et al. 2017). Our study confirmed that NLRP3 contributes to hippocampal inflammation, neuronal loss, and pyroptosis in PSD rats—all of which were significantly alleviated by EA. While previous research has shown NLRP3 activation in both microglia and neurons (Gong et al. 2018), our study focused on neuronal NLRP3 expression and demonstrated that EA downregulates neuronal NLRP3 levels, aligning with recent findings (Jiang et al. 2019). Importantly, overexpression of NLRP3 in EA-treated PSD rats reversed the behavioral and anti-inflammatory effects of EA, further supporting the pivotal role of NLRP3 in mediating EA's therapeutic effects.

From a traditional Chinese medicine (TCM) perspective, DU20 and DU24 can efficiently alleviate depressive behaviors in PSD (Wang et al. 2021, Zhang et al. 2021). DU20, located at the vertex of the head, is believed to elevate clear yang, while DU24 calms the mind and alleviates stress. The combination of DU20 and DU24 could regulate qi and relieve depression (Liang and Wang 2021). Our previous work has shown that EA at these points improves depressive-like behaviors in CUMS- and LPS-induced models (Zhang et al. 2020, Zhang et al. 2021). The present study extended these findings to a PSD model, showing that EA at DU20 and DU24 alleviates depressive symptoms by inhibiting NLRP3-mediated inflammation and protecting hippocampal neurons.

However, several limitations must be acknowledged. First, the relatively small sample size may limit the generalizability of the findings. Future studies should include larger cohorts. Second, needle insertion may cause discomfort or stress, potentially confounding behavioral outcomes. Third, the upstream regulators and downstream pathways of NLRP3-induced pyroptosis were not explored and warrant further investigation. Lastly, other hippocampal subregions such as the DG and CA1–CA4 were not comprehensively assessed and should be included in future analyses.

In summary, our findings demonstrate that the antidepressant effects of EA in PSD are closely linked to its ability to inhibit NLRP3 activation, reduce hippocampal inflammation and pyroptosis, and preserve neuronal integrity. This study highlights the pathological role of hippocampal neuroinflammation in PSD and identifies NLRP3 as a potential target for intervention.

Conclusion

This study provides novel evidence that electroacupuncture exerts antidepressant effects in a PSD rat model by suppressing NLRP3 inflammasome activation, thereby reducing hippocampal inflammation and pyroptosis. These findings suggest that targeting NLRP3 may represent a promising therapeutic strategy for the treatment of post-stroke depression.

Author Contributions

CW and SWD: Study design. CW and WXF: Experimental procedure. WXF: Statistical analysis. CW: Manuscript drafting. LT: Manuscript revision and finalization. All authors read and authorized the final manuscript.

Ethics Statement

The Shanghai University of Traditional Chinese Medicine Animal Research Ethics Committee authorized the experiment (PZSHUTCM210305007).

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Peer Review

The peer review history for this article is available at .

References

Abulafia, D. P., R. de J. P. Vaccari, et al. 2009. “Inhibition of the Inflammasome Complex Reduces the Inflammatory Response After Thromboembolic Stroke in Mice.” Journal of Cerebral Blood Flow and Metabolism 29, no. 3: 534–544.

Belayev, L., O. F. Alonso, R. Busto, W. Zhao, and M. D Ginsberg. 1996. “Middle Cerebral Artery Occlusion in the Rat by Intraluminal Suture. Neurological and Pathological Evaluation of an Improved Model.” Stroke; A Journal of Cerebral Circulation 27, no. 9: 1616–1622. discussion 1623.

Cai, W., W. Ma, G. T. Wang, Y. J. Li, and W. D Shen. 2019. “Antidepressant, Anti‐inflammatory, and Antioxidant Effects of Electroacupuncture Through Sonic Hedgehog‐signaling Pathway in a Rat Model of Post‐Stroke Depression.” Neuropsychiatric Disease and Treatment 15: 1403–1411.

Cai, W., X. F. Wei, C. Hu, J. Ji, H. S. Cui, and W. D Shen. 2023. “Effects of Electroacupuncture on Gut Microbiota and Fecal Metabolites in Rats with Post‐Stroke Depression.” Neuropsychiatric Disease and Treatment 19: 1581–1592.

Cai, W., X. F. Wei, J. R. Zhang, et al. 2024. “Acupuncture Ameliorates Depression‐Like Behavior of Poststroke Depression Model Rats Through the Regulation of Gut Microbiota and NLRP3 Inflammasome in the Colon.” Neuroreport 35, no. 14: 883–894.

Chen, Y., C. Hao, W. Chen, et al. 2022. “Anti‐Depressant Effects of Acupuncture: The Insights From NLRP3 Mediated Pyroptosis and Inflammation.” Neuroscience Letters 785: 136787.

Chen, Y., J. Pu, Y. Liu, et al. 2020. “Pro‐inflammatory Cytokines Are Associated With the Development of Post‐Stroke Depression in the Acute Stage of Stroke: A Meta‐analysis.” Topics in Stroke Rehabilitation 27, no. 8: 620–629.

Cheng, W. J., P. Li, W. Y. Huang, et al. 2021. “Acupuncture Relieves Stress‐Induced Depressive Behavior by Reducing Oxidative Stress and Neuroapoptosis in Rats.” Frontiers in Behavioral Neuroscience 15: 783056.

Coupland, C., P. Dhiman, R. Morriss, A. Arthur, G. Barton, and J. Hippisley‐Cox. 2011. “Antidepressant Use and Risk of Adverse Outcomes in Older People: Population Based Cohort Study.” BMJ 343: d4551.

Czeh, B., and S. A Nagy. 2018. “Clinical Findings Documenting Cellular and Molecular Abnormalities of Glia in Depressive Disorders.” Frontiers in Molecular Neuroscience 11: 56.

Davila‐Hernandez, A., S. R. Zamudio, L. Martinez‐Mota, and R. Gonzalez‐Gonzalez, Ramirez‐San Juan E. 2018. “Antidepressant Effects of Acupoint Stimulation and Fluoxetine by Increasing Dendritic Arborization and Spine Density in CA1 Hippocampal Neurons of Socially Isolated Rats.” Neuroscience Letters 675: 48–53.

de, R. J. P. Vaccari, G. Lotocki, et al. 2009. “Therapeutic Neutralization of the NLRP1 Inflammasome Reduces the Innate Immune Response and Improves Histopathology After Traumatic Brain Injury.” Journal of Cerebral Blood Flow and Metabolism 29, no. 7: 1251–1261.

Detke, M. J., and I. Lucki. 1996. “Detection of Serotonergic and Noradrenergic Antidepressants in the Rat Forced Swimming Test: the Effects of Water Depth.” Behavioural Brain Research 73, no. 1‐2: 43–46.

Fan, Q., Y. Liu, L. Sheng, et al. 2023. “Chaihu‐Shugan‐San Inhibits Neuroinflammation in the Treatment of Post‐Stroke Depression Through the JAK/STAT3‐GSK3β/PTEN/Akt Pathway.” Biomedicine and Pharmacotherapy 160: 114385.

Fang, J., and Q. Cheng. 2009. “Etiological Mechanisms of Post‐Stroke Depression: A Review.” Neurological Research 31, no. 9: 904–909.

Fann, D. Y., Y. A. Lim, Y. L. Cheng, et al. 2018. “Evidence That NF‐kappaB and MAPK Signaling Promotes NLRP Inflammasome Activation in Neurons Following Ischemic Stroke.” Molecular Neurobiology 55, no. 2: 1082–1096.

Faria, S. S., S. Costantini, V. C. C. de Lima, et al. 2021. “NLRP3 Inflammasome‐mediated Cytokine Production and Pyroptosis Cell Death in Breast Cancer.” Journal of Biomedical Science 28, no. 1: 26.

Garcia, J. H., K. F. Liu, and J. K Relton. 1995. “Interleukin‐1 Receptor Antagonist Decreases the Number of Necrotic Neurons in Rats With Middle Cerebral Artery Occlusion.” American Journal of Pathology 147, no. 5: 1477–1486.

Gong, Z., J. Pan, Q. Shen, M. Li, and Y. Peng. 2018. “Mitochondrial Dysfunction Induces NLRP3 Inflammasome Activation During Cerebral Ischemia/Reperfusion Injury.” Journal of Neuroinflammation 15, no. 1: 242.

Gu, P., Y. Ding, M. Ruchi, et al. 2024. “Post‐stroke Dizziness, Depression and Anxiety.” Neurological Research 46, no. 5: 466–478.

Guo, Y. 2021. Experimental Acupuncture Science. Chinese Medicine Press.

Hackett, M. L., C. S. Anderson, A. House, and J. Xia. 2008. “Interventions for Treating Depression After Stroke.” Cochrane Database of Systematic Reviews (Online) 4: CD003437.

Hanamsagar, R., V. Torres, and T. Kielian. 2011. “Inflammasome Activation and IL‐1beta/IL‐18 Processing Are Influenced by Distinct Pathways in Microglia.” Journal of Neurochemistry 119, no. 4: 736–748.

Hu, M. Z., A. R. Wang, Z. Y. Zhao, X. Y. Chen, Y. B. Li, and B. Liu. 2019. “Antidepressant‐Like Effects of Paeoniflorin on Post‐Stroke Depression in a Rat Model.” Neurological Research 41, no. 5: 446–455.

Huang, Y., N. J. Coupland, R. M. Lebel, et al. 2013. “Structural Changes in Hippocampal Subfields in Major Depressive Disorder: A High‐Field Magnetic Resonance Imaging Study.” Biological Psychiatry 74, no. 1: 62–68.

Jiang, T., M. Wu, Z. Zhang, et al. 2019. “Electroacupuncture Attenuated Cerebral Ischemic Injury and Neuroinflammation Through alpha7nAChR‐mediated Inhibition of NLRP3 Inflammasome in Stroke Rats.” Molecular Medicine 25, no. 1: 22.

Jiang, W., L. Gong, F. Liu, Y. Ren, and J. Mu. 2021. “Alteration of Gut Microbiome and Correlated Lipid Metabolism in Post‐Stroke Depression.” Frontiers in Cellular and Infection Microbiology 11: 663967.

Kang, H. J., K. Y. Bae, S. W. Kim, et al. 2016. “Effects of Interleukin‐6, Interleukin‐18, and Statin Use, Evaluated at Acute Stroke, on Post‐stroke Depression During 1‐year Follow‐up.” Psychoneuroendocrinology 72: 156–160.

Kaufmann, F. N., A. P. Costa, G. Ghisleni, et al. 2017. “NLRP3 Inflammasome‐driven Pathways in Depression: Clinical and Preclinical Findings.” Brain, Behavior, and Immunity 64: 367–383.

Kaur, C., and E. A Ling. 2009. “Periventricular White Matter Damage in the Hypoxic Neonatal Brain: Role of Microglial Cells.” Progress in Neurobiology 87, no. 4: 264–280.

Kempermann, G., and G. Kronenberg. 2003. “Depressed New Neurons–adult Hippocampal Neurogenesis and a Cellular Plasticity Hypothesis of Major Depression.” Biological Psychiatry 54, no. 5: 499–503.

Kim, J. M., H. J. Kang, J. W. Kim, et al. 2017. “Associations of Tumor Necrosis Factor‐alpha and Interleukin‐1beta Levels and Polymorphisms With Post‐Stroke Depression.” American Journal of Geriatric Psychiatry 25, no. 12: 1300–1308.

Li, M., C. Li, H. Yu, et al. 2017. “Lentivirus‐mediated Interleukin‐1beta (IL‐1beta) Knock‐Down in the Hippocampus Alleviates Lipopolysaccharide (LPS)‐induced Memory Deficits and Anxiety‐ and Depression‐Like Behaviors in Mice.” Journal of Neuroinflammation 14, no. 1: 190.

Liang, F. R., and H. Wang. 2021. Science of Acupuncture and Moxibustion. Chinese Medicine Press.

Liu, H., Y. Zhang, X. Hou, et al. 2024. “CRHR1 Antagonist Alleviated Depression‐Like Behavior by Downregulating p62 in a Rat Model of Post‐stroke Depression.” Experimental Neurology 378: 114822.

Liu, L., X. Li, I. J. Marshall, A. Bhalla, Y. Wang, and M. D. L O'Connell. 2023. “Trajectories of Depressive Symptoms 10 Years After Stroke and Associated Risk Factors: A Prospective Cohort Study.” Lancet 402, no. 1: S64.

Liu, R., K. Zhang, Q. Y. Tong, G. W. Cui, W. Ma, and W. D Shen. 2021. “Acupuncture for Post‐stroke Depression: A Systematic Review and Meta‐analysis.” BMC Complementary Medecine and Therapies 21, no. 1: 109.

Longa, E. Z., P. R. Weinstein, S. Carlson, and R. Cummins. 1989. “Reversible Middle Cerebral Artery Occlusion Without Craniectomy in Rats.” Stroke; A Journal of Cerebral Circulation 20, no. 1: 84–91.

Lv, Z., C. Zhao, X. Wu, et al. 2024. “Facile Engineered Macrophages‐derived Exosomes‐functionalized PLGA Nanocarrier for Targeted Delivery of Dual Drug Formulation against Neuroinflammation by Modulation of Microglial Polarization in a Post‐Stroke Depression Rat Model.” Biomedicine and Pharmacotherapy 179: 117263.

Masuccio, F. G., E. Grange, R. Di Giovanni, M. Rolla, and C. M Solaro. 2024. “Post‐Stroke Depression in Older Adults: An Overview.” Drugs and Aging 41, no. 4: 303–318.

McKenzie, B. A., M. K. Mamik, L. B. Saito, et al. 2018. “Caspase‐1 Inhibition Prevents Glial Inflammasome Activation and Pyroptosis in Models of Multiple Sclerosis.” PNAS 115, no. 26: E6065–E6074.

Mokhtari, T., M. Lu, and A. E El‐Kenawy. 2023. “Potential Anxiolytic and Antidepressant‐Like Effects of Luteolin in a Chronic Constriction Injury Rat Model of Neuropathic Pain: Role of Oxidative Stress, Neurotrophins, and Inflammatory Factors.” International Immunopharmacology 122: 110520.

Mokhtari, T., L. P. Yue, and L. Hu. 2023. “Exogenous Melatonin Alleviates Neuropathic Pain‐induced Affective Disorders by Suppressing NF‐kappaB/NLRP3 Pathway and Apoptosis.” Scientific Reports 13, no. 1: 2111.

Relton, J. K., D. Martin, R. C. Thompson, and D. A Russell. 1996. “Peripheral Administration of Interleukin‐1 Receptor Antagonist Inhibits Brain Damage After Focal Cerebral Ischemia in the Rat.” Experimental Neurology 138, no. 2: 206–213.

Ren, H., Y. Kong, Z. Liu, et al. 2018. “Selective NLRP3 (Pyrin Domain‐Containing Protein 3) Inflammasome Inhibitor Reduces Brain Injury After Intracerebral Hemorrhage.” Stroke; A Journal of Cerebral Circulation 49, no. 1: 184–192.

Ruilian, L., Q. Honglin, X. Jun, et al. 2021. “H(2)S‐mediated Aerobic Exercise Antagonizes the Hippocampal Inflammatory Response in CUMS‐depressed Mice.” Journal of Affective Disorders 283: 410–419.

Spalletta, G., P. Bossu, A. Ciaramella, P. Bria, C. Caltagirone, and R. G Robinson. 2006. “The Etiology of Post‐Stroke Depression: A Review of the Literature and a New Hypothesis Involving Inflammatory Cytokines.” Molecular Psychiatry 11, no. 11: 984–991.

Tang, J., W. Xue, B. Xia, et al. 2015. “Involvement of Normalized NMDA Receptor and mTOR‐related Signaling in Rapid Antidepressant Effects of Yueju and Ketamine on Chronically Stressed Mice.” Scientific Reports 5: 13573.

Wan, M., Y. Zhang, Y. Wu, and X. Ma. 2024. “Cognitive Behavioural Therapy for Depression, Quality of Life, and Cognitive Function in the Post‐Stroke Period: Systematic Review and Meta‐analysis.” Psychogeriatrics 24, no. 4: 983–992.

Wang, Q., H. Bi, H. Huang, et al. 2022. “Electroacupuncture Prevents the Depression‐Like Behavior by Inhibiting the NF‐kappaB/NLRP3 Inflammatory Pathway in Hippocampus of Mice Subjected to Chronic Mild Stress.” Neuropsychobiology 81, no. 3: 237–245.

Wang, X., W. Cai, Y. Wang, S. Huang, Q. Zhang, and F. Wang. 2021. “Is Electroacupuncture an Effective and Safe Treatment for Post‐Stroke Depression? An Updated Systematic Review and Meta‐Analysis.” BioMed Research International 2021: 8661162.

Willner, P., R. Muscat, and M. Papp. 1992. “Chronic Mild Stress‐induced Anhedonia: A Realistic Animal Model of Depression.” Neuroscience and Biobehavioral Reviews 16, no. 4: 525–534.

Xu, Y., H. Sheng, Q. Bao, Y. Wang, J. Lu, and X. Ni. 2016. “NLRP3 inflammasome Activation Mediates Estrogen Deficiency‐induced Depression‐ and Anxiety‐Like Behavior and Hippocampal Inflammation in Mice.” Brain, Behavior, and Immunity 56: 175–186.

Yao, L., E. M. Kan, C. Kaur, et al. 2013. “Notch‐1 Signaling Regulates Microglia Activation via NF‐kappaB Pathway after Hypoxic Exposure in Vivo and in Vitro.” PLoS ONE 8, no. 11: e78439.

Yao, L., E. M. Kan, J. Lu, et al. 2013. “Toll‐Like Receptor 4 Mediates Microglial Activation and Production of Inflammatory Mediators in Neonatal Rat Brain Following Hypoxia: Role of TLR4 in Hypoxic Microglia.” Journal of Neuroinflammation 10: 23.

You, Z., C. Luo, W. Zhang, et al. 2011. “Pro‐ and Anti‐inflammatory Cytokines Expression in Rat's Brain and Spleen Exposed to Chronic Mild Stress: Involvement in Depression.” Behavioural Brain Research 225, no. 1: 135–141.

Zhang, K., G. Cui, Y. Gao, and W. Shen. 2021. “Does Acupuncture Combined With Antidepressants Have a Better Therapeutic Effect on Post‐Stroke Depression? A Systematic Review and Meta‐analysis.” Acupuncture in Medicine 39, no. 5: 432–440.

Zhang, K., R. Liu, Y. Gao, W. Ma, and W. Shen. 2020. “Electroacupuncture Relieves LPS‐Induced Depression‐Like Behaviour in Rats Through IDO‐Mediated Tryptophan‐Degrading Pathway.” Neuropsychiatric Disease and Treatment 16: 2257–2266.

Zhang, K., R. Liu, J. Zhang, et al. 2021. “Electroacupuncture Ameliorates Depression‐Like Behaviour in Rats by Enhancing Synaptic Plasticity via the GluN2B/CaMKII/CREB Signalling Pathway.” Evidence Based Complementary Alternative Medicine 2021: 2146001.

Zheng, T., T. Jiang, R. Li, Y. Zhu, Q. Han, and M. Wang. 2024. “Circulating Interleukins Concentrations and Post‐Stroke Depression: A Systematic Review and Meta‐analysis.” Progress in Neuro‐Psychopharmacology & Biological Psychiatry 134: 111050.

Zhong, Z., S. Liang, E. Sanchez‐Lopez, et al. 2018. “New Mitochondrial DNA Synthesis Enables NLRP3 Inflammasome Activation.” Nature 560, no. 7717: 198–203.

Zhou, F., H. Jiang, N. Kong, et al. 2022. “Electroacupuncture Attenuated Anxiety and Depression‐Like Behavior via Inhibition of Hippocampal Inflammatory Response and Metabolic Disorders in TNBS‐Induced IBD Rats.” Oxidative Medicine and Cellular Longevity 2022: 8295580.

Zhou, H. Y., Y. P. Huai, X. Jin, et al. 2022. “An Enriched Environment Reduces Hippocampal Inflammatory Response and Improves Cognitive Function in a Mouse Model of Stroke.” Neural Regen Res 17, no. 11: 2497–2503.