ASPM predicts poor prognosis and regulates cell proliferation in bladder cancer

Abstract

Bladder cancer (BCa) is one of the most common malignancies with high morbidity and mortality worldwide. In recent years, it is of great importance to investigate the molecular etiology associated with of BCa. Abnormal spindle‐like microcephaly associated gene (ASPM) is the human orthologous of the Drosophila abnormal spindle (asp) and the most commonly mutated gene of autosomal recessive primary microcephaly. ASPM is overexpressed in several types of cancer cell lines and affects the progression and development of multiple types of cancers. However, its possible role in BCa progression is still unclear. Herein, we demonstrated the possible involvement of ASPM in the progression of BCa. We noticed that high expression of ASPM was positively associated with the poor prognosis. Its knockdown could significantly inhibit the proliferation of BCa cells in vitro and in mice. Therefore, we thought ASPM could act as a promising therapeutic target for BCa.

INTRODUCTION

Bladder cancer (BCa) is one of the most common malignancies in the world, with about 380 000 new cases and almost 150 000 deaths per year worldwide.¹ Hyperproliferation and early metastasis of cancers, including BCa, resulted in its therapeutic failure and poor survival.² Despite advances in surgical techniques and comprehensive therapy, approximately 50% to 70% of newly diagnosed patients are still confronted with the risk of recurrence within the next 5 years,³ and the 5‐year cancer‐related mortality of all patients has decreased by only 5% over the last 15 years.⁴ Hence, it is of great importance to investigate the molecular etiology associated with of BCa，which may offer insight into identifying novel therapeutic targets for treating the patients with BCa.

Abnormal spindle‐like microcephaly associated gene (ASPM) is the human orthologous of the Drosophila abnormal spindle (asp) and the most commonly mutated gene of autosomal recessive primary microcephaly.^5–7 The ASPM gene encodes a protein of 3477 amino acids with a NH2‐terminal microtubule‐binding domain, two calponin homology domains, 74 repeated calmodulin‐binding isoleucine‐glutamine domains, and a COOH‐terminal region,^5,8,9 which localizes to centrosomes, spindle poles, and the midbody.^10–16 It allows for symmetric, proliferative division of neuroepithelial cells during brain development and consequently brain surface expansion by promoting neuroblast proliferation and driving the orientation of mitotic cleavage.¹⁰ ASPM is also required for efficient nonhomologous end‐joining in mammalian cells.¹⁷

Despite its role in embryonic development, ASPM is overexpressed in many cancer cell lines,¹⁸ suggesting a possible relevance of this gene during tumorigenesis. Growing evidence showed that ASPM was also enhanced in different kinds of malignant tumors, such as ovarian cancer, gliomas, pancreatic cancer, breast cancer, prostate cancer, and hepatocellular carcinoma (HCC), which contributed to tumor progression and correlated with poor prognosis.^5,19–23 A previous study indicated that ASPM was abnormally expressed in human BCa tissues, however, whether ASPM affected the progression of BCa was still unclear.²⁴

In this study, we focused on the role of ASPM in BCa progression and prognosis, which had never been reported. ASPM could act as a novel target for combination therapy as well as a useful biomarker for BCa prognosis.

MATERIALS AND METHODS

Patients and tissue samples

A cohort of 127 paraffin‐embedded blocks from BCa patients were supplied by our hospital. All specimens were handled and made anonymous according to the ethical and legal standards, appropriate ethical approval was obtained from our hospital. All participants were fully informed and all data were analyzed anonymously. These patient follow up through the method of cystoscopy and computed tomography (CT). Additionally, cystoscopy recurrence was based on image study. The initial treatment modalities were the combination of transurethral resection of bladder tumor (TUR‐BT) with chemotherapy. We track all patient information, including the condition of patients, and investigate the following information and records, including patient age, sex, tumor stage, tumor grade, lymph node metastasis, and relapse. We further analyzed the correlations between ASPM expression in tumor tissues of patients and the clinical pathological characteristics.

The patients involved in the immunohistochemistry were given a follow‐up exam.

Cell culture and establish of stable cell lines

Human BCa cell lines, T24 and 5637 were cultured in RPMI 1640 medium (Gibco) supplemented with 10% fetal bovine serum (Gibico) and were maintained at 37°C in a humidified chamber supplemented with 5% CO₂.

In order to establish ASPM knockdown stable cell lines, we selected two effective shRNA sequences. The following are primers of ASPM shRNA: shRNA 1 for ASPM (NM_018136): CCGGTCCTGTCTCTCAGCCACTT, shRNA 2 for ASPM (NM_018136): AACAGGGCTTCACTTGGTGGTTA, shRNA 3 for ASPM (NM_018136): AATGATAATTGCTGTTACATCTT, shRNA 4 for ASPM (NM_018136): AACCTATAGAGCTTCAGCTATTA.

The cells were co‐transfected with expression vectors and virus skeleton vectors using X‐treme GENE HP DNA transfection reagent (Roche, Mannheim, Germany). Infectious lentiviruses were collected after transfection for 48 hours, and filtered by a 0.45 μm filter (Millipore, Boston, Massachusetts). Then, the lentiviruses were used to infect cells. The stable cell lines were selected with 1 μg/mL of puromycin (Sigma) for 3 days.

Immunohistochemistry

The paraffin‐embedded tissues were sectioned at 3‐μm thickness. The sections were deparaffinized with xylene and rehydrated for immunohistochemistry. Following a brief proteolysis digestion and hydrogen peroxide treatment to inactivate the endogenous peroxidase, the slides were incubated overnight with the primary antibody (sc‐488 883, Santa Cruz Biotech Co., Ltd.) at a dilution of 1:300 at 4°C. After washing, the sections were incubated with peroxidase conjugated secondary antibody for 1 hour. The specifically bound secondary antibody were visualize with the substrate chromogen.

We found ASPM was mainly located in the nucleus of BCa cells. However, there was still a small amount of ASPM in the cytoplasm. For ASPM the replicate cores for each sample was scored for staining intensities of nuclear and cytoplasmic staining (intensity score, 0 = no staining, 1 = weak staining, 2 = moderate staining, and 3 = strong staining) as well as the proportion of cells with positive nuclear or cytoplasmic staining within the cores (proportion score). For data analysis of ASPM expression, a slightly more sensitive data analysis system was used, in which the staining intensity was multiplied by the percentage of cells with nuclear or cytoplasmic staining.²⁵

Western blot analysis

Proteins were extracted 48 hours posttransfection or excised xenograft tumor tissues for immunoblot analyses. Proteins (30 μg) were fractioned on SDS‐PAGE and transferred onto Hybond nitrocellulose membranes (GE Healthcare). The membranes were blocked with 5% bovine serum albumin (BSA) in tris‐buffered saline Tween 20 (TBST) and probed with anti‐ASPM antibody (1:1000 dilution, sc‐488 883, Santa Cruz Biotech Co., Ltd.), mouse anti‐β‐actin (1:1000 dilution, ab8226, Abcam plc, Cambridge, UK), anti‐Ki67 (1:1000 dilution, ab16667, Abcam plc) or anti‐proliferating cell nuclear antigen (PCNA) (1:500 dilution, ab29, Abcam plc), β‐actin was used as an internal loading control.

CCK‐8 assay

Cell proliferation was assessed by the cell counting kit 8 (CCK‐8) assay according to the manufacturer's instruction (Dojindo Molecular Technologies, Rockville, Maryland). T24 and 5637 cells in 96‐well plates were incubated with CCK‐8 solutions for 1.5 hour at 37°C. Absorbance of each well was quantified at 450 nm by an enzyme‐linked immunosorbent assay microplate reader.

Colony formation assays

About 1 × 10³ cells were placed into a 6‐well plate. T24 and 5637 cells transfected with indicated plasmid were cultured at 37°C. Ten days later, the cells were fixed with 4% of paraformaldehyde and dyed with 0.5% of crystal violet. The number of visible colonies was measured manually.

RNA extraction and quantitative real‐time polymerase chain reaction

Total RNA was isolated from tissue samples and cell lines using RNAiso Plus (Takara, Japan) according to the manufacturer's instruction. RNAs were reversely transcribed into cDNA with the PrimeScript RT Reagent Kit (Takara). Subsequently, quantitative real‐time polymerase chain reaction (qRT‐PCR) was carried out by using the SYBR Green PCR Kit (Roche, Switzerland) on the ABI 7500 Fast Real‐Time PCR System (Applied Biosystems, California). The relative expressions of related genes were detected by using the 2‐ΔΔCt method. The primer sequences were provided as follows: ASPM forward, 5′‐GGGAAAGGCAAATGGAAAAC and reverse 5′‐CCCAAGGCCATACAAGTGTT‐3′; GAPDH forward, 5′‐CGCTCTCTGCTCCTCCTGTTC‐3′ and reverse, 5′‐CCGTTGACTCCGACCTTCAC‐3′.

Xenograft tumor formation assay

Six‐week‐old BALB/c nude mice were obtained from Shanghai Laboratory Animal Center (Shanghai, China). About 2 × 10⁶ T24 cells stably expressing ASPM or control shRNA suspended in 100 μL of HBSS medium were injected subcutaneously into the inguinal areas of nude mice. After about 2 weeks, tumors were removed from 12 mice every week and the tumor volume was measured by Vernier caliper; tumors were isolated, measured, and photographed until 7 weeks.

Statistics analysis

Statistical analyses were performed with SPSS 17.0 (SPSS Inc., Chicago, Illinois). Differences between two groups were analyzed using the unpaired Student t test. P < .05 was considered statistically significant.

RESULTS

High expression of ASPM in human BCa tissues predicts poor prognosis

To determine the expression of ASPM in BCa tissues, bioinformatics method were performed to analyze the mRNA level of ASPM in BCa tissues and normal bladder tissues. As shown in Figure 1, ASPM expression at mRNA level was highly expressed in cancer tissues compared with normal tissues (Figure 1A, P < .05). As shown in Figure 1B, the median ASPM mRNA expression was used as the cutoff point to divide BCa patients into high group (n = 81, from TCGA dataset) and low group (n = 81). Patients with high ASPM expression had poor disease‐free survival (DFS). These data suggest that ASPM may be a poor prognostic factor in BCa patients (Figure 1A,B). Then, we examined the expression of ASPM protein in 127 paraffin‐embedded BCa samples by immunohistochemical analysis. Eighty‐five (66.9%) tumor samples were defined as ASPM protein high expression. Low expression of ASPM protein was detected in 42 (33.1%) tumors. Given that the ASPM expression exhibits high heterogeneity in BCa, we then investigated whether there was a correlation between ASPM expression and patient prognosis. To this end, we quantified the staining intensities of ASPM in the 127 BCa cohort. Association of ASPM expression with various clinicopathological characteristics of 127 BCa patients is given in Table 1. As shown in Figure 2A,B, ASPM expression was upregulated in BCa tissues compared to normal tissues. In addition, the patients with high ASPM expression had a shorter overall survival and a shorter progression‐free survival time, compared with the patients with low ASPM expression (Figure 2C). Our results suggest that high ASPM expression was a significant predictor for poor overall survival and progression‐free survival in BCa patients.

1 FIGURE. Bioanalysis revealed that ASPM was highly expressed in BCa and correlated with the prognosis of patients. A, The TCGA database showed the expression level of ASPM in BCa tissues and corresponding normal tissues. B, The TCGA database showed the correlation between ASPM and disease‐free survival in patients with BCa

1 TABLERelationships of ASPM and clinicopathological characteristics in 127 patients with muscular invasive bladder cancer

Feature	All n = 127	ASPM expression
Low	High
n = 42	n = 85	χ2	P
Age (y)				2.128	0.145
<65	52	21	31
≥65	75	21	54
Gender				0.640	0.218
Male	94	30	64
Female	33	12	21
Tumor stage				8.862	0.003*
T2	70	31	39
T3/T4	57	11	46
Tumor grade				1.609	0.205
Low	39	16	23
High	88	26	62
Lymph node metastasis				1.066	0.302
Yes	41	11	30
No	86	31	55
Recurrence				1.740	0.187
Yes	65	18	47
No	62	24	38

*P < 0.05.

2 FIGURE. High expression of ASPM in human BCa tissues correlates with poor prognosis. Bioinformatic analysis of the expression of ASPM in bladder cancer tissues and normal bladder tissues (A). Immunohistochemical analysis of ASPM expression in tumor tissues (A) and normal tissues (B). (C); Kaplan–Meier survival analysis of overall survival and progression‐free survival between BCa patients with high and low ASPM expression

ASPM is downregulated in T24 and 5637 cells transfected with control or ASPM shRNA

Given that the high expression of ASPM is closely related to poor prognosis of BCa, we then examined the function of ASPM in BCa cells. T24 and 5637 cells were transfected with shRNA against ASPM, to specifically knockdown the expression of ASPM. The knockdown efficiency was verified by qRT‐PCR and immunoblot (Figure 3).

3 FIGURE. Quantitative PCR analysis (A) and immunoblot images (B) displayed decreased expression level of ASPM in T24 or 5637 cells transfected with control or ASPM shRNA plasmids. *P < 0.05

Effect of ASPM depletion on proliferation of BCa cells

Subsequently, proliferation ability of T24 and 5637 cells was monitored with CCK‐8 and colony formation assay. As a result, T24 and 5637 cells stably expressing ASPM shRNA had a markedly lower number of colonies compared with control shRNA transfected cells (Figure 4A). Moreover, ASPM depletion remarkably suppressed the proliferation of T24 and 5637 cells (Figure 4B). PCNA and Ki‐67 are two widely used markers to evaluate tissue or tumor proliferative status,²⁶ both of which were suppressed along with the knockdown of ASPM in T24 and 5637 cells (Figure 4C,D). Therefore, we confirmed that ASPM may exert a crucial role in regulating proliferation of BCa cells.

4 FIGURE. ASPM regulates the proliferation of BCa cells. (A, B) colony formation assay (A) and CCK‐8 assay (B) were performed to evaluate the proliferative ability of T24 cell and 5637 cell transfected with negative control (NC) or shRNA (the number of foci were counted.). (C, D) Ki67 (C) and PCNA (D) expression was detected in T24 cell and 5637 cell transfected with negative control (NC) or shRNA using Immunoblot. *P < 0.05

ASPM modulates BCa proliferation and tumorigenesis in vivo

To determine whether the results obtained from in vitro observations could be recapitulated in an in vivo setting, we performed the experiments with the xenograft model of BCa in BALB/c nude mice using T24‐ASPM‐shRNA or T24‐Con‐shRNA cells. T24 cells were injected subcutaneously into BALB/c nude mice in the inguinal area, and tumor sizes were evaluated at 2 to 7 weeks (n = 6) after injection. Consistent with in vitro experiments, significant smaller tumors were observed in mice receiving ASPM knockdown T24 cells, compared with control group (Figure 5A). And the lower ASPM expression level of mice injected with ASPM knockdown T24 cells was validate in excised xenograft tumor tissues using immunoblot and immunohistochemistry analysis (Figure 5B,C). We further confirmed the depletion of ASPM led to the decrease of Ki67 and PCNA in tumor tissues of mice (Figure 5D), suggesting the inhibition of cancer cell proliferation in vivo. Taken together, these results showed that ASPM depletion could inhibit tumor formation in vivo, which indicate the important role of ASPM in BCa proliferation and tumorigenesis.

5 FIGURE. Tumor growth of T24 cells in nude mice. A, Tumor growth curve of T24 cells stably expressing ASPM‐shRNA or Con‐shRNA were injected into nude mice, and tumor sizes were evaluated at 2 to 7 weeks (n = 6) after injection (left); representative tumors derived from T24 cell‐injected nude mice at different time point (right). B, Expression of ASPM in excised xenograft tumor tissues (7 weeks after xenotransplantation) was detected by quantitative real‐time PCR and western blot. C, Excised xenograft tumor tissues (7 weeks after xenotransplantation) were analyzed for the expression of ASPM using immunohistochemistry analysis. D, The expression levels of Ki67 and PCNA in tumors from control and ASPM depletion groups were detected through immunoblot assays. *P < 0.05

DISCUSSION

The ASPM gene encoding a protein of 3477 amino acids, which localizes to centrosomes, spindle poles, and the midbody,^10–16 is closely related to cell mitosis. The identified functions indicated that ASPM may regulate cell proliferation and be involved in various human cancers. Sufficient evidence has pointed out that ASPM is an oncogene and the prognostic value of ASPM has been investigated in epithelial ovarian cancer, gliomas, pancreatic cancer, breast cancer, prostate cancer, and HCC.^5,19–23 For several types of high metastasis cancer, it is prone to bone metastasis.^27,28 Recently, a study using bioinformatic approaches indicated overexpression of the ASPM gene is associated with aggressiveness and poor outcome in BCa,²⁴ but still there is a lack of substantial evidence about the relationship between ASPM expression and overall survival as well as the role of ASPM in tumor progression in BCa.

In our study, we first examined the protein level of ASPM on BCa tissues and nontumor tissues, and observed that the ASPM expression in tumor tissues were significantly higher than that in adjacent normal tissues. The correlation analysis with clinical‐pathological parameters identified that high expression of ASPM was positively associated with shorter overall survival and progression‐free survival, which indicates high ASPM expression is a significant predictor for poor prognosis in BCa patients. Moreover, the knockdown of ASPM expression could inhibit proliferation and colony formation of BCa cells in vitro and the tumorigenic ability in vivo was obviously inferior to that in negative control.

In brief, our study revealed the tumor‐promoting effect of ASPM in BCa, which may be a potential therapeutic target for BCa treatment. And a research from Horvath et al had identified ASPM as a molecular target through analysis of oncogenic signaling networks in glioblastoma.²⁹ Vange et al revealed ASPM as a possible gastric stem/progenitor cell marker overexpressed in cancer and another study suggested that ASPM is associated with the malignant progression of gliomas, possibly through expansion of a cancer stem cell compartment.³⁰ Vulcani‐Freitas et al also found that ASPM high expression may correlate with the development of medulloblastoma because it could modify the ability of stem cells in differentiation during the development of central nervous system.³¹ What's more, Pai et al's recent study elucidated ASPM could promote prostate cancer stemness and progression by augmenting Wnt‐Dvl‐3‐β‐catenin signaling.³² Buchman et al also revealed ASPM could regulate Wnt signaling pathway activity in the developing brain.³³ All these evidence suggested that ASPM may be associated with the stemness of cancer cells, thereby promoting tumor progression via different signaling pathways.

However, the regulatory mechanisms of how ASPM influence tumor progression and prognosis in BCa remained elusive and needed to be further explored. It is necessary to gain a full understanding of the underlying molecular effect.

CONCLUSION

In conclusion, we found the high expression of ASPM in human BCa tissues and investigated the clinical characteristics of the enrolled patients. We also found that ASPM expression was correlated with the prognosis of bladder cancer tissues. Then, both in vivo and in vitro experiments showed that ASPM knockdown could significantly inhibit the proliferation of bladder cancer. ASPM could therefore act as a potential molecular target for bladder cancer treatment.

CONFLICT OF INTEREST

The authors declare no conflict of interest.